Enhancing Osteogenic Differentiation of MC3T3-E1 Cells by

Nov 25, 2014 - Enhancing Osteogenic Differentiation of MC3T3-E1 Cells by Immobilizing Inorganic Polyphosphate onto Hyaluronic Acid Hydrogel. Andy T. H...
0 downloads 0 Views 7MB Size
Download PDF
Article pubs.acs.org/Biomac

Enhancing Osteogenic Differentiation of MC3T3-E1 Cells by Immobilizing Inorganic Polyphosphate onto Hyaluronic Acid Hydrogel Andy T. H. Wu,† Teruo Aoki,‡ Megumu Sakoda,⊥ Seiichi Ohta,§ Shigetoshi Ichimura,⊥ Taichi Ito,‡,§,∥ Takashi Ushida,†,§ and Katsuko S. Furukawa*,†,∥ †

Department of Mechanical Engineering, ‡Department of Chemical System Engineering, §Center for Disease Biology and Integrative Medicine, and ∥Department of Bioengineering, The University of Tokyo, 7-3-1, Hongo, Bunkyo-ku, Tokyo 113-8656, Japan ⊥ Department of Applied Bioscience, Kanagawa Institute of Technology, 1030 Shimo-ogino, Atsugi, Kanagawa 243-0292, Japan S Supporting Information *

ABSTRACT: In tissue engineering, precise control of cues in the microenvironment is essential to stimulate cells to undergo bioactivities such as proliferation, differentiation, and matrix production. However, current approaches are inefficient in providing nondepleting cues. In this study, we have developed a novel bioactive hydrogel (HAX-PolyP) capable of enhancing tissue growth by conjugating inorganic polyphosphate chains onto hyaluronic acid macromers. The immobilized polyphosphates provided constant osteoconductive stimulation to the embedded murine osteoblast precursor cells, resulting in up-regulation of osteogenic marker genes and enhanced levels of ALP activity. The osteoconductive activity was significantly higher when compared to those stimulated with free-floating polyphosphates. Even at very low concentrations, immobilization of polyphosphates onto the scaffold allowed sufficient signaling leading to more effective osteoconduction. These results demonstrate the potential of our novel material as an injectable bioactive scaffold, which can be clinically useful for developing bone grafts and bone regeneration applications. promoting the growth factor to its receptors.22,23 Other studies have also showed the effect of PolyP on enhancing osteoblastic differentiation and calcification of precursor and stem cells.24−26 Although potent osteoinductive factors are available, optimal delivery systems have yet to be established. Conventional direct injection of growth factors into the surrounding medium has only transient effects and is impractical for in vivo or clinical applications without additional timed injections. In this study, we are the first to conjugate PolyP chains onto hyaluronic acid (HA) polymers for use as a novel bone tissue engineering scaffold material. Hyaluronic acid is a nonsulfated glycosaminoglycan found abundantly in the extracellular matrix (ECM) that has been demonstrated to help modulate cell adhesion, proliferation and other physiological processes.27 It has also shown promise as a natural scaffold for bone tissue engineering purposes.12−14,28 By combining the osteoinductive effects of PolyP with HA, our hypothesis is that the covalently bonded PolyP will allow the embedded cells to be constantly stimulated for synthesizing higher quality tissue-engineered bone constructs. Also, by immobilizing PolyP to the scaffold,

1. INTRODUCTION Damage and degradation to bone tissues, incurred by either physical trauma or degenerative diseases, can significantly impact the quality of life of individuals. The tissue’s endogenous regeneration is limited, especially for large bone defects.1,2 Current standards of treatment include the use of autogenous bone grafts; however, complications such as limited supplies and additional damage to donor sites still persist.2,3 Biocompatible materials including hydroxyapatite4−7 and tricalcium phosphate8−10 have also been explored as bone graft substitutes, but have yet to provide clinically satisfactory results.11 Hence, these obstacles have driven the field to move focus toward cell-based therapies, such as tissue engineering. There have been many reports on the osteogenic potentials of various growth factors in bone tissue engineering, including the well-established effects of bone morphogenetic proteins (BMPs),12−16 fibroblast growth factors (FGFs)15−17 and insulin-like growth factors (IGFs).18−20 Recently, a lessreported therapeutic agent, inorganic polyphosphate (PolyP) has become a study of interest.21−25 PolyP is an orthophosphate polymer found abundantly in mammalian cells, although its functions are not completely elucidated. Its existence in osteoblasts has suggested a role in osteogenesis, where studies have demonstrated its interaction with bFGF by stabilizing and © 2014 American Chemical Society

Received: September 11, 2014 Revised: November 21, 2014 Published: November 25, 2014 166

dx.doi.org/10.1021/bm501356c | Biomacromolecules 2015, 16, 166−173

Biomacromolecules

Article

Figure 1. Reaction schematics for synthesizing HA-CHO, HA-ADH, and HA-PolyP. (A) High molecular weight HA polymers were reacted with sodium periodate to yield HA-CHO. (B) Medium molecular weight HA polymers were reacted with adipic dihydraze to yield HA-ADH. (C) Twostep process was necessary for synthesizing HA-PolyP. Imidazole groups were first conjugated to free PolyP then further reacted with HA-ADH to form covalent bonds.

then added at a final concentration of 0.03 M, and the pH was readjusted to 6.0 with 1 N NaOH. The reaction was performed for 90 min at room temperature, and the reactant was purified via ethanol precipitation. The purified PolyP-IM was lyophilized for storage. HA-ADH was dissolved in distilled water at a concentration of 0.35 wt % with 1.5 fold excess of PolyP-Im. The solution was adjusted to pH 8.5 with 1 N NaOH and reacted at 50 °C for 5 h. The final HA-PolyP product was purified by dialysis (MW cut-off 6000−8000) against distilled water at room temperature with periodic changes of water for up to 72 h and freeze-dried for storage at 4 °C. 2.2. Polymer Characterization. Aldehyde modification in HA-CHO was determined by aldehyde quantification as previously described.29 Proper conjugation of HA-ADH with PolyP was confirmed by31P NMR (α500, JEOL, Japan) in D2O. ADH modification was quantified via 1H NMR in D2O. The corresponding modification degree with PolyP was determined by standard molybdenum blue assay. Briefly, HA-PolyP was dissolved in 0.5 M sulfuric acid and incubated at 80 °C for 2 h. The pyrolysized HA-PolyP was then diluted to 1 mg/mL with distilled water and reacted with the reaction mixture (2.5 M sulfuric acid, 4.11 M tartar emetic solution, 32.4 M ammonium molybdate, 100 mM L-ascorbic acid, distilled water) at 4:1 volume for 10 min at room temperature. Phosphate in the solutions were then quantified against known standards via a spectrometer measuring the absorbance at 335nm. Molecular weight distribution of the polymers were determined via gel permeation chromatography (GPC) as previously described.31

osteoinductive effects are expected to be observable even at very low concentrations. This bioactive approach can lead to better in vitro tissue growth and maturation, which has not yet been achieved, and would have significant clinical impact.

2. MATERIALS AND METHODS 2.1. Polymer Synthesis. Hyaluronan was kindly gifted by Kikkoman Biochemifa Co. HA-aldehyde (HA-CHO) and HAadipic dihydrazide (HA-ADH) was synthesized as previously described28,30 with slight modifications. Briefly, high molecular weight HA (FCH200, MW 2.0 MDa) was reacted with equal molar volumes of sodium periodate (Wako) for 2 h at room temperature in the dark and terminated by the addition of ethylene glycol (Figure 1A) to synthesize HA-CHO. Medium molecular weight HA (FCH80, MW 0.8 MDa) was reacted with adipic dihydrazide (Wako) at 30-fold molar excess and in the presence of 1-ethyl-3-carbodiimide (EDC) (Wako) and 1hydroxybenzotriazole (HOBt) (TCI Chemicals, Japan) at room temperature and pH 6.8 (Figure 1B) to synthesize HA-ADH. Both reaction products were purified via dialysis (MW cut-off at 6000−8000) against distilled water at room temperature with periodic changes of water for up to 72 h and freeze-dried for storage at 4 °C. To conjugate PolyP onto HA-ADH, terminal hydroxyl groups of PolyP were first activated with imidazole to react with hydrazide groups on HA-ADH. Briefly, imidazole and 1ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride (EDC·HCl) were prepared at 0.45 and 0.16 M, respectively, in distilled water and adjusted to pH 6.0 with 1 N HCl. Sodium hexametaphosphate (Sigma) with 13 units of phosphate was 167

dx.doi.org/10.1021/bm501356c | Biomacromolecules 2015, 16, 166−173

Biomacromolecules

Article

2.3. Mechanical Testing. Acellular HAX and HAX-PolyP hydrogels were saturated in PBS for 3 h prior to mechanical testing. Unconfined compression test was performed using a mechanical spectrometer (AGS-G, Shimazu, Japan). Samples were compressed up to 20% strain followed by 10 min hold to reach equilibrium. 2.4. Cell Embedding and Culture. Murine preosteoblasts MC3T3-E1 (Riken, Japan) were expanded with AlphaMinimum Essential Medium (α-MEM, Invitrogen) containing 5% fetal bovine serum (FBS, Invitrogen). HA-ADH, HA-CHO and HA-PolyP were sterilized via germicidal UV exposure for at least 30 min then dissolved in sterile PBS into 2 wt %/v solutions. Trypsin-lifted cells were centrifuged and resuspended in HA-CHO solution. Cell-embedded hydrogels were formed by further mixing of the cell-HA-CHO solution with equal volumes of either HA-ADH or HA-PolyP solutions precasted in custom stainless steel molds to form HAX and HAX-PolyP hydrogels, respectively. Constructs (9 mm in diameter and 2 mm in thickness) were seeded at a final density of 40 × 106 cells/mL. After 10 min of incubation at room temperature, the constructs were removed from the molds and cultured in ultralow attachment six-well plates (Corning) with growth medium supplemented with 50 μg/mL L-ascorbic acid, 10 mM β-glycerophosphate, 100 nM dexamethasone, and 100 μg/mL streptomycin and the medium was exchange once every 2 days. Free-floating polyphosphate controls were maintained by adding calculated volumes of polyphosphate directly into the growth medium (HAX/PolyP) or directly into the hydrogel (HAX*PolyP) of a portion of the HAX hydrogels to match the concentration existing in the HAX-PolyP hydrogels. HAX/ PolyP samples received replenishment of PolyP during the medium change, while HAX*PolyP did not. All samples were cultured for one week and briefly washed with PBS prior to analysis. 2.5. Real Time-PCR Analysis. Samples were washed with PBS and fully homogenized in TRIzol solution (Invitrogen) using RNase-free mortar and petals for total RNA isolation from the cells according to the manufacturer’s protocol. The RNA templates were then reverse-transcribed into cDNA using the ReverTra Ace qPCR RT kit (TOYOBO, Japan) following the manufacturer’s instructions. Quantitative RT-PCR was carried with the StepOnePlus Real-Time PCR system (Applied Biosystems) using the Thunderbird SYBR qPCR Mix (TOYOBO, Japan) with the primers listed in Table 1. Expression of major osteogenic markers were examined,

namely, runt-related transcription factor 2 (Runx2), alkaline phosphatase (ALP), osteocalcin (OC), osteopontin (OPN), and type I collagen (COL1). FGF2 receptor (FGFR2) expression was also examined. All values were normalized to the housekeeping gene GAPDH, and further normalized to the polyphosphate-free control (HAX) samples. 2.6. Biochemical Analysis. Samples were washed in PBS then homogenized in 500 μL of lysate buffer (50 mM Tris/ HCl, pH 7.6, 0.1% Triton X-100) with a power homogenizer (Polytron PT3100, Kinematica, Switzerland) followed by brief applications of ultrasound sonication (XL-2000 Microson, Labcaire Systems, UK) to rupture the cells. After centrifugation (1300 rpm, 10 min, 4 °C) to remove excess scaffold materials, the supernatant was collected for analysis. ALP activity was determined via the LabAssay ALP Kit (Wako, Japan) according to the manufacturer’s instructions. Briefly, ALP activity was quantified by the protein-facilitated hydroxylation of p-nitrophenylphosphate into p-nitrophenol, which was measured spectrophotometrically with a microplate reader at an absorbance wavelength of 405 nm. The ECM−calcium concentration was determined via the Calcium Quantification Kit − Red Fluorescence (ab112115, abcam). Briefly, calcium ions were tagged by RhodRed fluorescent dyes and measured with a fluorescence plate reader at excitation/emission wavelengths of 540/590 nm respectively. Acellular constructs were also synthesized and culture under the same conditions for up to 1 week. Samples were collected and measured at days 0, 1, and 7 to examine the accumulation of calcium ions within the hydrogel. 2.7. Histological Analysis. Samples were washed with PBS and fixed in 10% formalin neutral buffer solution (Wako, Japan) immediately after collection. Samples were then dehydrated via a serial dilution of ethanol, cleared with xylene, and embedded in paraffin. Five micrometer-thick sections were sliced for histological staining. Alkaline phosphatase was stained using the ALP Staining Kit (MUTO Pure Chemicals, Japan) according to the manufacturer’s protocol. Calcium ions were stained with 2% Alizarin Red S (Sigma) at pH 4.1∼4.3 for up to 5 min then dehydrated in acetone and cleared in xylene. Stained samples were dried and mounted on a glass slide for image capturing. 2.8. Statistical Analysis. All numerical values are represented as mean ± standard error of mean (SEM). Statistical significance was determined by using ANOVA followed by Fisher’s least significant difference (LSD) (with a = 0.05) calculation to determine significance (p < 0.05) in the difference between groups. Groups with mean differences greater than the LSD value considered significant.

Table 1. Forward and Reverse Sequences of Primers Used in RT-PCR Analysis target gene

sequence

gene ID

Runx2

F: 5′ GCACAAACATGGCCAGATTCA3′ R: 5′ AAGCCATGCCCGTTAG 3′ F: 5′ AACCCAGACACAAGCATTCC 3′ R: 5′ CGAAGGGTCAGTCAGGTTGT 3′ F: 5′ GCGCTCTGTCTCTCTGACCT 3′ R: 5′ GCCGGAGTCTGTTCACTACC 3′ F: 5′ GGCTTATGGACTGAGGTC 3′ R: 5′ GTTGTCCTGATCAGAGGG 3′ F: 5′ GCGAAGGCAACAGTCGCT 3′ R: 5′ CTTGGTGGTTTTGTATTCGATGAC 3′ F: 5′ AGGGACACAGGATGGACAAG 3′ R: 5′ TTCGACCAACTGCTTGAATG 3′

12393

ALP OC OPN COL1 FGFR2

3. RESULTS 3.1. HA-PolyP characterization. Conjugation of the polyphosphate groups onto HA was successful as confirmed by the changes in 1H NMR and 31P NMR readings before and after modification. Peaks in the HA-ADH 1H NMR spectrum were observed at 2.11 ppm, 2.22 ppm (m, 4H, COCH2), and 1.48 ppm (m, 4H, CH2CH2), which were absent in the HA spectrum (Figure 2A). Adipic dihydrazide modification rate was calculated to be 62.8% by using the −CH3 peak and −CH2− CH2 peak in the HA and HA-ADH spectra, respectively. Observable peaks at −21.1 ppm (penultimate phosphorus) and −6.78 ppm (end phosphorus) was present in the PolyP 31P NMR spectrum (Figure 2B). Similarly, the −21.1 ppm peak was preserved in the PolyP-Im and HA-PolyP spectra. Due to the conjugation between imidazole and ADH, a shift (PolyP-

11467 12096 20750 12842 14183

168

dx.doi.org/10.1021/bm501356c | Biomacromolecules 2015, 16, 166−173

Biomacromolecules

Article

Figure 2. (A) 1H NMR spectra of HA, HA-ADH, and HA-PolyP. Observable peaks at 1.48, 2.11, and 2.22 ppm represent the existence of ADH groups on the HA-ADH and HA-PolyP polymers. (B) 31P NMR of PolyP, PolyP-Im, and HA-PolyP. The characteristic phosphorus peak at 21.1 ppm of the polyphosphate chains was shown to be preserved in Poly-P and HA-PolyP, depicting their presence in the conjugated polymers. (C) Molecular weight distributions of polymers as measured by GPC. (D) Young’s modulus and aggregate were calculated for HAX and HAX-PolyP hydrogels via unconfined compression test.

Im: −9.38 ppm, HA-PolyP: −9.85 ppm) in the end phosphorus peak was also observed. The presence of the phosphorus peak in the HA-PolyP spectrum confirmed the proper conjugation of the polyphosphate groups onto the HA-ADH polymers. The modification rate of the PolyP was determined via molybdenum blue assay to be 9.38% and 5.89% with respect to ADH and HA. Modification rate of CHO onto HA was determined by aldehyde assay to be 16.6% in each repeating unit of HA. GPC was also performed to determine the molecular weight distributions of the synthesized polymers as shown in Figure 2C as follows: HA (Mw = 2.5 × 107, Mn = 2.7 × 105, Mw/Mn = 94.2), HA-ADH (Mw = 9.4 × 106, Mn = 4.0 × 105, Mw/Mn = 23.6), HA-PolyP (Mw = 1.2 × 106, Mn = 6.4 × 103, Mw/Mn = 1.8 × 102), and PolyP (Mw = 5.1 × 102, Mn = 2.9 × 102, Mw/Mn = 1.78). Notably, there is a decrease in molecular weight after modification with PolyP due to the reaction conditions. Since the reaction was carried out at pH 8.5, the alkaline condition is likely to induce hydrolysis of the polymer. Mechanical properties of the hydrogels were examined via an unconfined compression creep test, where the Young’s modulus (EY) and the aggregate modulus (HA) were calculated. (Figure 2D). Although there is appeared to be a slight increase in the modulus after modification with PolyP, the change was not significant. Similarly, the initial swelling between the constructs was not significantly different as shown in Figure 2E. 3.2. Growth of HA Hydrogels Embedded with Preosteoblasts. MC3T3-E1 cells were successfully embedded

isotropically in the HAX hydrogels by simply mixing HA-CHO with either HA-ADH or HA-PolyP. Samples containing no PolyP (HAX) and samples containing free-floating PolyP (HAX/PolyP, HAX*PolyP) served as controls for conjugated PolyP samples (HAX-PolyP). The general experiment concept is as shown in Figure 3. The conjugated PolyP molecules in the HA-PolyP hydrogels did not appear to affect the gelation process. All mixtures were fully solidified after 10 min of incubation at ambient conditions, where the hydrogels maintained their integrity even after being submerged in the culture medium. The hydrogel constructs remained intact after 1 week of culture, although some degradation of the scaffolds was also observed. (Figure 4A). The majority of the embedded cells were alive after 1 week of culture in both HAX and HAX-PolyP hydrogels, as illustrated with Live/Dead staining using calcein-AM and propidium iodide (Figure 4C,D). HAX-PolyP constructs underwent considerable shrinkage in size from the initial mold dimensions, while HAX constructs remained the same with or without freefloating PolyP. Noticeably, HAX-PolyP was observed to be more opaque in growth morphology in comparison to the controls, owing to the higher accumulation of ECM material and/or calcium. Under bright field microscopy, large cell aggregation was also observed in HAX-PolyP constructs only (Figure 4). 3.3. Effect of Conjugated PolyP on MC3T3-E1 Osteoconduction. 3.3.1. Osteogenic Marker Genes Are 169

dx.doi.org/10.1021/bm501356c | Biomacromolecules 2015, 16, 166−173

Biomacromolecules

Article

significance in the up-regulation of Runx2, OC, COL1, and OPN (Figure 5). Free-floating PolyP in HAX/PolyP and HAX*PolyP constructs did not seem to have any significant effect on the regulation of osteogenic marker gene expressions. Expression of FGF2 receptor (FGFR2) genes were also examined, and was found to be up-regulated by the immobilization of PolyP. Free-floating PolyP, however, seems to down-regulate FGFR2 expression. 3.3.2. Cells Embedded in HA-PolyP Exhibits Higher Levels of Osteogenic Activity. ALP is expressed abundantly in bone tissues and is an early marker for osteogenesis. As such, we evaluated the activity of ALP via the p-nitrophenylphosphate hydrolysis assay after 1 week of culture. A similar trend to gene regulation was observed, where higher ALP activity was detected in HAX-PolyP constructs when compared to those of HAX, HAX/PolyP, and HAX*PolyP controls (Figure 6A). There was no difference in ALP activity in HAX constructs with or without free-floating PolyP, demonstrating their limited effect on osteoconduction. Distribution of the protein was also visualized via ALP staining as shown in Figure 7 (top). HAXPolyP constructs were stained darker demonstrating the higher amount of protein produced. In addition, higher levels of calcium accumulation were also observed in HAX-PolyP samples when compared to the controls via calcium quantification (Figure 6B) and Alizarin Red S staining (Figure 7, bottom). Quantification of calcium content in acellular HAX hydrogels was also carried out to examine the accumulating Ca2+ chelating effects of PolyP (Figure 6C). Ca2+ accumulation was observed in all samples but was significantly higher (up to 4 times) in HAX-PolyP hydrogels in comparison to the other hydrogels. It appears that free-floating PolyP does not significantly aid in the accumulation of Ca2+ within the hydrogel construct, whether added in the culture medium or directly into the hydrogel.

Figure 3. Cells were suspended in HA-CHO solutions and mixed with either HA-ADH or HA-PolyP in custom molds to form hydrogels. (A) HAX samples containing no polyphosphate were used as negative controls. (B,C) Free-floating polyphosphate was added either in the culture medium (HAX/PolyP) or in the hydrogel (HAX*PolyP) in amounts resulting in equal concentration to those found in HAXPolyP samples. (D) HAX-PolyP samples contain immobilized PolyP present within the hydrogel.

4. DISCUSSION In tissue engineering, external signaling via growth factors is more than often necessary for stimulating differentiation, growth, and maturation of tissue-engineered constructs toward the targeted tissue. Delivery methods of these factors have been widely explored, from direct application to designing complex drug-delivering carrier systems.19 There is also a growing interest in designing and synthesizing bioactive scaffolding materials that can provide appropriate signals to the embedded cells with controllable timing and dosage.17 Some studies have started to explore the potential in covalently immobilizing growth factors to provide constant chemical cues to the seeded cells.15,32,33 In this study, we have conjugated inorganic polyphosphate (PolyP) chains onto hyaluronic acid (HA) molecules to use as a novel scaffold material for the purpose of bone tissue engineering. In our system, adipic dihydrazide and aldehyde groups on HA-ADH and HA-CHO macromers, respectively, are crosslinked together to form the HAX hydrogel. Gelation was achieved by simply mixing the two solutions. During the brief period of cross-link formation, the gel can potentially be injected and filled into any space with no limitations in shape and size hence allowing in situ applications. By first attaching imidazole groups onto PolyP chains, we were able to further conjugate polyphosphate chains onto ADH groups to form HA-PolyP. Successful conjugation was demonstrated by the appearance of specialized peaks in 1H NMR and 31P NMR spectra. Approximately 10% modification of ADH conjugated

Figure 4. (A) Gross morphology of samples after 1 week of culture (scale bar = 10 mm). (B) Bright field images of 3D culture. Cell aggregation observable in HAX-PolyP (scale bar = 100 μm). (C,D) Calcein-AM/PI staining (scale bar = 300 μm). Live cells are stained green, while dead cells are stained red. Cell viability after 1 week of culture was high in all scaffolds.

Up-Regulated by Constant PolyP Stimulation. To investigate the effects of PolyP on the osteogenic activity of MC3T3-E1 cells, quantitative RT-PCR was performed after 1 week of culture to look at the regulation of gene expressions. Specifically, gene expression levels of well-known osteogenic/ bone markers were examined, including runt-related transcription factor 2 (Runx2), alkaline phosphatase (ALP), osteocalcin (OC), osteopontin (OPN), and type 1 collagen (COL1). Up-regulation of all osteogenic marker genes were facilitated by the conjugated PolyP in HAX-PolyP constructs, up to roughly 3- to 6-folds more than the controls, with 170

dx.doi.org/10.1021/bm501356c | Biomacromolecules 2015, 16, 166−173

Biomacromolecules

Article

Figure 5. RT-PCR was performed to examine osteogenic marker gene expressions. All samples were first normalized to the housekeeping gene, GAPDH, and then normalized again to the HAX control (n = 3, mean ± S.E.M, bar indicates significance between groups).

Figure 6. (A,B) ALP activity was quantified via the p-nitrophenol assay with 1 h of reaction then measured at an absorbance wavelength of 405 nm. Values were normalized to construct wet weight or DNA content. (C) Calcium ions were tagged with RhodRed fluorescent dye and quantified spectrometrically at excitation/emission wavelengths of 540/590 nm, respectively. Values were normalized to construct wet weight. (D) Ca2+ content in acellular constructs were also measured to examine the accumulation over time. All values were normalized to construct wet weight for comparison (n = 3, mean ± S.E.M, bar indicates significance between groups).

with PolyP was achieved, as determined by molybdenum blue assay, with the remaining nonconjugated ADH groups available

for cross-linking in the presence of CHO groups. All chemical modifications to the HA molecules exhibited minimal 171

dx.doi.org/10.1021/bm501356c | Biomacromolecules 2015, 16, 166−173

Biomacromolecules

Article

Figure 7. Histological staining was used to evaluate osteogenic activity of the samples via (top) ALP and (bottom) Alizarin Red S staining. Darker staining was observed in HAX-PolyP samples, especially in the aggregates, indicating higher levels of ALP expression and calcification (scale bar = 100 μm). Figure 8. Schematic of the proposed polyphosphate mechanism within the HAX-PolyP scaffold. Immobilized PolyP helps to stabilize and catalyze the interaction between growth factors (e.g., FGF2) and the corresponding receptors on the surface of embedded cells leading to enhanced osteoconductive signaling. Chelation of calcium ions to PolyP also helps attract cells and further increases osteoconduction effects.

cytotoxicity, where cell viability was high enough for scaffolding applications. Our hypothesis was that conjugated PolyP in the scaffold would provide a nondepleting signal to the preosteoblasts and stimulate differentiation more so than the transient free-floating counterparts. Indeed, this was confirmed by the up-regulation of osteogenic and bone marker genes (Runx2, ALP, OC, OPN, COL1), as well as the increased activity of alkaline phosphatase when compared to the controls. Even in the case of the preloaded PolyP control (HAX*PolyP), unconjugated PolyP within the hydrogel quickly diffused out of the construct to reach equilibrium as early as after only 1 h of incubation (Figure S1). Osteoconductive effect of free-floating PolyP, however, was not observed as there was no significant difference in gene expression or enzyme activity when compared to the negative control without PolyP. This appeared to be contradictory to the literature, as previous studies showed that PolyP increases osteogenic activity even in the free form.24,25 However, this may be explained by the concentration of PolyP, where most existing reports investigated ranges of 0.1−1 mM,23−25 while in our study the concentration was only limited to the order of 0.1 μM. As a result, even at such low concentrations, the conjugated PolyP chains were more readily available and accessible to the embedded cells to facilitate and promote differentiation. The general schematic of the proposed mechanism behind the osteoconductive effect of inorganic polyphosphates is shown in Figure 8. It has been previously suggested by a few studies that PolyP can help stabilize and catalyze the interaction between fibroblastic growth factor 2 (FGF-2) and its corresponding receptors on the cell membrane.23 FGF-2, a well-known osteogenic inducing agent, was also present in the serum in the culture medium used in our experiments and hence may have played a role in the enhanced osteoconductive effects by immobilized PolyP in the HAX-PolyP scaffolds. RUNX2, which is an osteogenic transcriptional factor regulated by FGF-2, was shown to be up-regulated in HAX-PolyP constructs. In addition, expression of FGF2R was found to be up-regulated by immobilized PolyP while down-regulated by free-floating PolyP. Furthermore, PolyP chains also exhibit chelating actions on calcium ions,34 where the immobilized PolyP maintained the accumulated Ca2+ within the HAX-PolyP hydrogels and improved the accessibility of the ions to the embedded cells. The precipitation of Ca2+ in turn attracts the preosteoblasts to aggregate and further stimulate the proliferation and osteoconduction process.35 This is a possible explanation of the cell aggregation that was observed in the

HAX-PolyP hydrogels but not in the control samples, which may be associated with the higher level of osteogenic activities.

5. CONCLUSIONS The novel polyphosphate-conjugated hyaluronic acid hydrogel synthesized in this study shows promise as a potential scaffold for bone tissue engineering, as demonstrated by the enhanced osteogenesis of the embedded osteoblast precursor cells. As an in situ cross-linkable hydrogel, this biomaterial can be expected to be applicable in various clinical and research settings including direct injection into small or irregular bone defects to promote bone regeneration. It can also be used in conjunction with ceramic bone graft substitutes (such as hydroxyapatite, tricalcium phosphate, etc.) to complement and further increase osteogenic effects for the treatment of larger bone defects. This study also demonstrates the potential of bioactive materials for tissue engineering, in particular the conjugation of signal molecules for nondepleting stimulation. This concept can be easily applied in designing other novel biomaterials.

■

ASSOCIATED CONTENT

S Supporting Information *

Diffusivity of PolyP in and out of the HAX hydrogel has been examined to demonstrate the importance of conjugation for retaining the factors within the construct. This material is available free of charge via the Internet at http://pubs.acs.org.

■

AUTHOR INFORMATION

Corresponding Author

*E-mail: [email protected]; TEL: +81-3-58416331; FAX: + 81-3-5841-6447. Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS This work was funded by the program of Next Generation on World-Leading Researchers (NEXT), Japan Society for the Promotion of Science (JSPS) and in part by the Global COE Program (GCOE), Medical System Innovation on Multidisciplinary Integration, MEXT, Japan. 172

dx.doi.org/10.1021/bm501356c | Biomacromolecules 2015, 16, 166−173

Biomacromolecules

■

Article

(33) Ito, Y.; Chen, G.; Imanishi, Y. Bioconjugate Chem. 1998, 9, 277− 282. (34) de Kort, E.; Minor, M.; Snoeren, T.; van Hooijdonk, T.; van der Linden, E. Dairy Sci. Technol. 2009, 89, 283−299. (35) Chai, Y. C.; Roberts, S. J.; Schrooten, J.; Luyten, F. P. Tissue Eng., Part A 2011, 17, 1083−1097.

REFERENCES

(1) Boerckel, J. D.; Kolambkar, Y. M.; Stevens, H. Y.; Lin, A. S. P.; Dupont, K. M.; Guldberg, R. E. J. Orthop. Res. 2012, 30, 1067−1075. (2) Amini, A. R.; Laurencin, C. T.; Nukavarapu, S. P. Crit. Rev. Biomed. Eng. 2012, 40, 363−408. (3) Rogers, G. F.; Greene, A. K. J. Craniofacial Surg. 2012, 23, 323− 327. (4) Rodrigues, C. V. M.; Serricella, P.; Linhares, A. B. R.; Guerdes, R. M.; Borojevic, R.; Rossie, M. A.; Duarte, M. E. L.; Farina, M. Biomaterials 2003, 24, 4987−4997. (5) Woodard, J. R.; Hilldore, A. J.; Lan, S. K.; Park, C. J.; Morgan, A. W.; Eurell, J. A. C.; Clark, S. G.; Wheeler, M. B.; Jamison, R. D.; Johnson, A. J. W. Biomaterials 2007, 28, 45−54. (6) Yoshikawa, H.; Tamai, N.; Murase, T.; Myoui, A. J. R. Soc. Interface 2009, 6, 341−348. (7) Huang, Y.; Niu, X.; Song, W.; Guan, C.; Feng, Q.; Fan, Y. J. Nanomaterials 2013, 2013, 1−7. (8) Walsh, W. R.; Vizesi, F.; Michael, D.; Auld, J.; Langdown, A.; Oliver, R.; Yu, Y.; Irie, H.; Bruce, W. Biomaterials 2008, 29, 266−271. (9) Feng, Y. F.; Wang, L.; Li, X.; Ma, Z. S.; Zhang, Y.; Zhang, Z. Y.; Lei, W. PLOS One 2012, 7, 1−12. (10) Tarafder, S.; Balla, V. K.; Davies, N. M.; Bandyopadhyay, A.; Bose, S. J. Tissue Eng. Regener. Med. 2013, 7, 631−641. (11) Stevens, M. M. Mater. Today 2008, 11, 18−25. (12) Kim, J.; Kim, I. S.; Cho, T. H.; Lee, K. B.; Hwang, S. J.; Tae, G.; Noh, I.; Lee, S. H.; Park, Y.; Sun, K. Biomaterials 2007, 28, 1830− 1837. (13) Kisiel, M.; Martino, M. M.; Ventura, M.; Hubbell, J. A.; Hilborn, J.; Ossipov, D. A. Biomaterials 2013, 34, 704−712. (14) Hulsart-Billström, G.; Yuen, P. K.; Marsell, R.; Hilborn, J.; Larsoon, S.; Ossipov, D. A. Biomacromolecules 2013, 14, 3055−3063. (15) Budiraharjo, R.; Neoh, K. G.; Kang, E. T. J. Biomater. Sci. 2013, 24, 645−662. (16) Zellin, G.; Linde, A. Bone 2000, 26, 161−168. (17) Huang, Z.; Ren, P. G.; Ma, T.; Smith, R. L.; Goodman, S. B. Cytokine 2010, 51, 305−310. (18) Kang, H.; Sung, J.; Jung, H. M.; Woo, K. M.; Hong, S. D.; Roh, S. Tissue Eng., Part A 2012, 18, 331−340. (19) Lee, S. H.; Shin, H. Adv. Drug Delivery Rev. 2007, 59, 339−359. (20) Wang, S.; Mu, J.; Fan, Z.; Yu, Y.; Yan, M.; Lei, G.; Tang, C.; Wang, Z.; Zheng, Y.; Yu, J.; Zhang, G. Stem Cell Res. 2012, 8, 346− 356. (21) Morita, K.; Doi, K.; Kubo, T.; Takeshita, R.; Kato, S.; Shiba, T.; Akagawa, Y. Acta Biomater. 2010, 6, 2808−2815. (22) Shiba, T.; Nishimura, D.; Kawazoe, Y.; Onodera, Y.; Tsutsumi, K.; Nakamura, R.; Ohsiro, M. J. Biol. Chem. 2003, 278, 26788−26792. (23) Kawazoe, Y.; Katoh, S.; Onodera, Y.; Kohgo, T.; Shindoh, M.; Shiba, T. Int. J. Biol. Sci. 2008, 4, 37−47. (24) Kawazoe, Y.; Shiba, T.; Nakamura, R.; Mizuno, A.; Tsutsumi, K.; Uematsu, T.; Yamaoka, M.; Shindoh, M.; Kohgo, T. J. Dent. Res. 2004, 83, 613−618. (25) Morimoto, D.; Tomita, T.; Kuroda, S.; Higuchi, C.; Kato, S.; Shiba, T.; Nakagami, H.; Morishita, R.; Yoshikawa, H. J. Bone Miner. Metabol. 2010, 28, 418−423. (26) Usui, Y.; Uematsu, T; Uchihashi, T.; Takahashi, M.; Ishizuka, M.; Doto, R.; Tanaka, H.; Komazaki, Y.; Osawa, M.; Yamada, K.; Yamaoka, M.; Furusawa, K. J. Dent. Res. 2010, 89, 504−509. (27) Yoneda, M.; Yamagata, M.; Suzuki, S.; Kimata, K. J. Cell Sci. 1988, 90, 265−273. (28) Aslan, M.; Şimşek, G.; Dayi, E. J. Biomat. Appl. 2006, 20, 209− 220. (29) Yeo, Y.; Highley, C. B.; Bellas, E.; Ito, T.; Marini, R.; Langer, R.; Kohane, D. S. Biomaterials 2006, 27, 4698−4705. (30) Ito, T.; Yeo, Y.; Highley, C. B.; Bellas, E.; Benitez, C. A.; Kohane, D. S. Biomaterials 2007, 28, 975−983. (31) Nakagawa, Y.; Nakasako, S.; Ohta, S.; Ito, T. Carbohydr. Polym. 2015, 117, 43−53. (32) Chen, G.; Ito, Y.; Imanishi, Y. Biochim. Biophys. Acta 1997, 1358, 200−208. 173

dx.doi.org/10.1021/bm501356c | Biomacromolecules 2015, 16, 166−173