Enhancing the Thermostability of Highly Active and Glucose-Tolerant

Subscriber access provided by Gothenburg University Library

Biotechnology and Biological Transformations

Enhancing the thermostability of highly active and glucose-tolerant #-glucosidase Ks5A7 by directed evolution for good performance on three properties Lichuang Cao, Shuifeng Li, Xin Huang, Zongmin Qin, Wei Kong, Wei Xie, and Yuhuan Liu J. Agric. Food Chem., Just Accepted Manuscript • DOI: 10.1021/acs.jafc.8b05662 • Publication Date (Web): 29 Nov 2018 Downloaded from http://pubs.acs.org on December 1, 2018

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 34

Journal of Agricultural and Food Chemistry

Enhancing the thermostability of highly active and glucose-tolerant β-glucosidase Ks5A7 by directed evolution for good performance on three properties

Lichuang Cao1, Shuifeng Li1, Xin Huang1, Zongmin Qin1, Wei Kong1, Wei Xie2,*, Yuhuan Liu1,*

1

School of Life Sciences, Institute of Aquatic Economic Animals and Guangdong

Provincial Key Laboratory for Aquatic Economic Animals, National Engineering Center for Marine Biotechnology of South China Sea, Sun Yat-Sen University, Guangzhou, 510275, P. R. China. 2

MOE Key Laboratory of Gene Function and Regulation, State Key Laboratory for

Biocontrol, School of Life Sciences, The Sun Yat-Sen University, Guangzhou, Guangdong, 510006, P. R. China.

*Correspondence

should

be

addressed

to:

Wei

Xie

(E-mail:

[email protected]) or Yuhuan Liu (E-mail:[email protected]).

Tel: 86-20-84113712, Fax: 86-20-84036215.

1

ACS Paragon Plus Environment


1

Abstract

2

A high-performance β-glucosidase for efficient cellulose hydrolysis needs to excel on

3

thermostability, catalytic efficiency and resistance to glucose inhibition. However, it

4

is challenging to achieve superb properties on all these three aspects in a single

5

enzyme. In this study, a hyperactive and glucose-tolerant β-glucosidase Ks5A7 was

6

employed as the starting point. Four rounds of random mutagenesis were then

7

performed, giving rise to a thermostable mutant 4R1 with five amino acid

8

substitutions. The half-life of 4R1 at 50 °C is 8640-fold of that of Ks5A7 (144 h vs 1

9

min). Meanwhile, 4R1 had a higher specific activity (374.26 vs 243.18 U mg-1) than

10

the wild type with a similar glucose-tolerance. When supplemented to Celluclast 1.5L,

11

the mutant significantly enhanced the hydrolysis of pre-treated sugarcane bagasse,

12

improving the released glucose concentration by 44%. With excellent performance on

13

thermostability, activity and glucose-tolerance, 4R1 will serve as an exceptional

14

catalyst for industrial applications.

15 16

Keywords: β-Glucosidase, Thermostability, Glucose-tolerance; Random mutagenesis,

17

High-throughput screening, Cellulase

2


Page 2 of 34

Page 3 of 34


18 19

Introduction Efficient bio-refining of cellulosic biomass is critical to the sustainable

20

development of modern society.1-3 The key to this process is the conversion of

21

cellulose to glucose at a low cost. Enzymatic saccharification of cellulose usually

22

needs the synergy of endoglucanases (EGs, EC 3.2.1.4), exoglucanases

23

(cellobiohydrolases, CBHs, EC 3.2.1.91), and β-glucosidases (BGLs, EC 3.2.1.21).

24

EGs hydrolyze the long-chain cellulose into cellodextrin and oligosaccharides. CBHs

25

release cellobiose units, and BGLs convert cellobiose into glucose. BGLs are often

26

inhibited by the end-product glucose, making the hydrolysis of cellobiose a

27

rate-limiting step. The accumulated cellobiose further inhibits EGs and CBHs,

28

slowing down the entire degradation process.4-6 Therefore, glucose-tolerant BGLs are

29

of great importance to accelerate this process.7, 8 Considering the long reaction time of

30

cellulose hydrolysis at 50 ºC (maybe >100 h),9 thermostability is also required for

31

BGLs. In addition, high catalytic efficiency is always an attractive property. Taken

32

together, an “ideal” β-glucosidase for efficient cellulose hydrolysis needs to have

33

strong resistance to glucose inhibition, excellent thermostability and high catalytic

34

efficiency.

35

BGLs universally exist in many living organisms, including archaea, eubacteria and

36

eukaryotes.10 In the past decades, great efforts have been devoted to screening robust

37

BGLs from various environmental sources. However, these enzymes usually meet

38

only two of the above three requirements at most. For example, some members of

39

glucoside hydrolase (GH) family 3 display kcat/Km values higher than 100 s-1 mM-1 and

40

good thermostabilities, but poor glucose-tolerance with the inhibition constants (Ki)

41

less than 0.1 M.6, 11 In contrast, some GH1 BGLs are hundreds of times more

42

glucose-tolerant. The BGLs from Pyrococcus furiosus 12and Thermococcus sp.13 have 3



43

both high glucose-tolerance (Ki of 0.3 M and >4 M respectively) and excellent

44

thermostability, but questionable catalytic efficiency (kcat/Km of 23 and 5.42 s-1 mM-1

45

respectively). Four BGLs isolated from Humicola grisea var. thermoidea,14 Humicola

46

insolens RP86,15 Neurospora Crassa16 and a genomic library17 respectively have

47

kcat/Km values of 100-450 s-1 mM-1 and half maximal inhibitory concentrations (IC50s)

48

higher than 0.6 M, but their thermostabilities need to be improved. In addition to

49

mining the natural sources, protein engineering of the existing BGLs may provide an

50

alternative to obtain a high-performing catalyst on all these properties.

51

Directed evolution is a powerful tool to modify enzymatic properties. An efficient

52

screening method for the desired property is the key to success.18-20 To date, screening

53

for mutants with higher glucose-tolerance21, 22 and cellobiose activity23 are

54

labor-intensive and time-consuming. By contrast, screening for mutants with better

55

thermostability is much easier with many successful examples.24-30 Recently, a petri

56

dish-based double-layer high-throughput screening strategy has been developed,

57

significantly increasing the substrate preference of a 6-phosphogluconate

58

dehydrogenase,31 the thermostability of a glucose 6-phosphate dehydrogenase32 and a

59

polyphosphate glucokinase33 by 4278-fold, 124-fold and 7200-fold, respectively. With

60

a little modification to this strategy by replacing the substrate, it may be a very

61

efficient method for the directed evolution on BGLs.

62

In this study, a highly active (kcat/Km of 386 s-1 mM-1) and glucose-tolerant (IC50 >

63

1.0 M) BGL Ks5A717 was employed as the starting point. Based on above mentioned

64

high-throughput screening method, four rounds of random mutagenesis were

65

performed for thermostability enhancement. Five beneficial single mutations jointly

66

improved the half-life by more than 8000-fold and increased the specific activity on

67

cellobiose by 1.5-2 folds without lowering the glucose-tolerance. The underlying 4


Page 4 of 34

Page 5 of 34


68

structural basis was analyzed and its hydrolysis of pre-treated sugarcane bagasse

69

(SCB) was evaluated. Through this study, a robust BGL was successfully constructed.

70 71

Materials and Methods

72

Materials

73

Plasmid pET-28a (+)-tac was constructed by inserting tac promoter between T7

74

promoter and RBS sequence in pET-28a (+) according to the method of Huang et al.31

75

and was used for the construction of random mutagenesis libraries. E. coli DH5α

76

Electro-Cells were purchased from Takara (Dalian, China). E. coli BL21 (DE3)

77

(Novagen, Madison, WI, USA) was used for protein expression. DNA polymerase

78

and T4 DNA ligase were purchased from Thermo Fisher Scientific (Hudson, NH,

79

USA). Cellulase Celluclast 1.5L, cellobiose, glucose, and

80

para-nitrophenyl-β-D-glucopyranoside (pNPG) were purchased from Sigma-Aldrich

81

(St. Louis, MO, USA). All other chemicals and reagents were of analytical grade and

82

purchased from commercial sources, unless indicated otherwise.

83 84 85

Construction and screening of random mutagenesis library The DNA sequence of Ks5A7 (Genbank: HV348683) was codon-optimized and

86

synthesized by Generay Biotechnology (Shanghai, China). DNA alignment of the

87

original sequence and the optimized sequence of gene Ks5A7 was shown as Figure S1.

88

The error-prone PCR (epPCR) was performed by using GeneMorph II Random

89

Mutagenesis Kit (Stratagene, La Jolla, CA, USA) with the primer pair of

90

epPCR-Ks5A7-F (TATATTCATATGAAATTTAATGAAAATTTTGTTTGGGG)

91

and epPCR-Ks5A7-R

92

(TATATTCTCGAGCAGATTTTCACCATTTTCTTCGATCAC). After being 5



93

digested by Nde I and XhoI, the product was ligated into pET-28a (+)-tac. The ligation

94

product was purified by MicroElute Cycle-Pure Kit (Omega Bio-tek, Norcross, USA)

95

and subsequently transformed into E. coli DH5α via electroporation. The

96

transformants were cultured on LB-agar plates containing 50 μg/mL kanamycin and

97

0.02 mM isopropyl-β-D-1-thiogalactopyranoside (IPTG) at 30 °C for 48 h. For the

98

first round of screening, the plates were incubated for 40 min at 60 °C. When they

99

were cooled down to room temperature, ~10-15 mL mixture containing 0.5 % (w/v)

100

melted agar, 0.1 % (w/v) esculin and 0.25 % (w/v) ferric ammonium citrate was

101

poured onto the plates. The colonies that formed brown halos were considered as

102

positive mutants. Their plasmids were extracted and transformed into E. coli DH5α.

103

The mutations were identified by sequencing. For the second, third and fourth round

104

of screening, the heat treatment conditions were 40 min at 70 °C, 40 min at 75 °C, and

105

40 min at 85 °C, respectively.

106 107 108

Expression and purification of the recombinant proteins The plasmids containing the coding sequences of the positive mutants were

109

transformed into E. coli BL21 (DE3) for expression. Induction of the protein

110

expression was triggered by adding IPTG at the final concentration of 1.0 mM when

111

the cell density (OD600) reached 0.8. Then the culture was incubated at 30 C for 12 h

112

with shaking at 200 rpm. Then cells were collected by centrifugation.

113

All the recombinant proteins contain a 6×His tag at their C-terminus. Therefore the

114

purification was carried out by using the His Bind Purification Kit (Novagen)

115

according to the product manual. Purified proteins in the Elution buffer (20 mM

116

Tris−HCl, 500 mM NaCl, 1.0 M imidazole, pH 8.0) were dialyzed in 100 mM

117

phosphate buffer (pH 6.0) for three times. Then they were stored at 4 °C for the 6


Page 6 of 34

Page 7 of 34


118

following experiments. The protein concentration was determined by using

119

CoomassiePlusTM (Bradford) Assay Kit (Thermo Fisher Scientific, Waltham, MA,

120

USA) according to the product manual.

121 122

Enzymatic assay

123

The reaction mixture consisted of 10-μL sample and 490-μL 1.0 % (w/v) cellobiose

124

solution (100 mM phosphate buffer, pH 6.0). The reaction was conducted at 50 °C for

125

10 min and then was terminated by boiling for 6 min. The concentration of glucose

126

was quantified by using the Glucose Oxidase-Peroxidase Assay Kit (Sigma-Aldrich).

127

One unit of enzyme activity was defined as the amount of enzyme required to release

128

1 μmol of glucose per min. To determine the initial reaction rate, the substrate

129

consumption was less than 10% for all the reactions.

130

The optimal pHs were determined at 50 C except for wild type (WT) Ks5A7 (45

131

C) and the optimal temperatures were determined at pH 6.0. The buffers used were

132

citric acid-sodium citrate (100 mM, pH 5.0-6.0) and phosphate buffers (100 mM, pH

133

6.0-8.0) respectively.

134

The thermostability of Ks5A7 and the mutants was evaluated by the parameters of

135

half-life (T1/2) and T50 value. The T1/2 was determined by measuring the residual

136

activity of the enzymes at 50 C and pH 6.0. T50 is defined as the temperature where

137

50 % of the enzyme was inactivated in 10 min. In detail, the purified enzymes (0.01

138

mg/mL) were incubated at various temperatures (30-80 °C) for 10 min and then the

139

residual activities were measured. T50 value was determined by fitting a shifted

140

sigmoid function to the thermal inactivation curves.30

141 142

Determination of glucose-tolerance 7



143

The activities of Ks5A7 and its mutants were stimulated by glucose, so

144

glucose-tolerance was evaluated by IC50 values, not Ki values. IC50 is defined as the

145

concentration of the glucose that inhibits 50 % of the initial activity.34 In brief, the

146

initial reaction rates of the enzymes were determined by using 5 mM pNPG as

147

substrate in the presence of 0-2.0 M glucose. Reactions were performed at 50 °C in

148

100 mM phosphate buffer (pH 6.0) except for Ks5A7 (45 °C). The initial reaction

149

rates determined in the absence of glucose were defined as 100 %.

150 151 152

Hydrolysis of pre-treated sugarcane bagasse SCB was pre-treated according to the method described previously.29 Hydrolysis of

153

SCB was performed in 20 mL of 100 mM phosphate buffer (pH 6.0) at 50 °C with

154

shaking at 120 rpm. The SCB concentration was 10 % (w/v, dry weight). The enzyme

155

load for cellulose Celluclast 1.5L (cellulase from Trichoderma reesei ATCC 26921,

156

Sigma-Aldrich) was 40 FPU (filter paper unites) per gram of SCB.35 The cellulase

157

activity of Celluclast 1.5L was determined according to the NREL method36 in 100

158

mM phosphate buffer (pH 6.0).The amounts of Ks5A7 and mutant 4R1 were both 0.1

159

mg purified protein per gram of SCB.17 To avoid contamination during the hydrolysis

160

process, nystatin (80 μg/mL) and tetracycline (60 μg/mL) were added into the reaction

161

mixtures. The concentrations of glucose during the reaction processes were monitored

162

by using the Glucose Oxidase-Peroxidase Assay Kit (Sigma-Aldrich). Qualitative

163

analysis of the hydrolysis products was carried out by thin-layer chromatography

164

(TLC) according to the method described previously.37

165 166

Homology-modelling of Ks5A7

8


Page 8 of 34

Page 9 of 34

167


Homology-based model of Ks5A7 was constructed by using the SWISS-MODEL

168

webserver with the crystal structure of the β-glucosidase from Thermotoga

169

neapolitana (PDB code: 5IDI) as the template.38 Visualization of the modeled

170

structure was carried out by using the program PyMOL (http://www.pymol.org/).

171 172

Results and Discussion

173

Screening of random mutagenesis libraries for mutants with better thermostability

174

We chose a hyperactive (kcat/Km of 386 mM s-1 towards cellobiose) and

175

glucose-tolerant (IC50 > 1.0 M) β-glucosidase Ks5A717 as starting point for

176

thermostability improvement. The coding sequence of Ks5A7 was cloned into a

177

modified vector pET-28a(+)-tac, which contains the tac and T7 promoters for protein

178

expression in E. coli DH5α and BL21(DE3), respectively.31 The recombinant E. coli

179

DH5α strains expressing WT Ks5A7 showed activity only when cultivated at 30 °C,

180

not 37 °C, indicating poor thermostability of this enzyme (Figure 1A). The IPTG

181

concentration in the agar-plates was then optimized. A low concentration of 20 μM

182

was used since higher concentrations showed similar results (Figure 1A). The heat

183

treatment condition for each round of screening was optimized as well. For example,

184

in the first round, the strains containing Ks5A7 completely lost activity after being

185

incubated for 10 min at 60 °C (Figure 1B). Then the screening condition was set as 40

186

min at 60 °C. The random mutagenesis libraries growing on the agar-plates were

187

treated with heat, cooled down to room temperature and covered by the second layer

188

of reaction mixture containing 0.5% (w/v) melted agar, 0.1 % (w/v) esculin and 0.25

189

% (w/v) ferric ammonium citrate. Most of the mutants became inactivated, allowing

190

the mutants with improved thermostability to stand out (Figure 1C). The positive

191

clones were picked by toothpick for plasmid extraction. The plasmids were 9



192

transformed into E. coli DH5α for amplification and the mutations were identified by

193

DNA sequencing. In some cases, the positive clone was not a single colony. The

194

extracted plasmids were re-transformed into E. coli DH5α, and the transformants were

195

treated with heat again to obtain a single colony (Figure S2).

196

The mutation rate of random mutagenesis libraries was one or two amino acid

197

changed per gene because multiple mutations usually inactivated the enzyme.39 Each

198

epPCR library contained about 26,000-50,000 colonies. The mutants with the best

199

thermostability generated from each round were used as the template for the next

200

round of mutagenesis. Successive four rounds of random mutagenesis were performed,

201

resulting in a thermostable mutant 4R1 with five amino acid substitutions

202

(T167I/V181F/K186T/A187E/A298G). The screening conditions for each round and

203

the amino acids changes in the mutants were shown in Figure 2.

204

Although a similar method was applied to screen for BGLs mutants with improved

205

thermostability in the early studies,25, 26, 40 it has not been widely used since then,

206

which may be due to the ambiguous description of the protocol. Several latter studies

207

on the directed evolution of BGLs were based on microplates28 or duplicated agar

208

plates27, 29. These methods involve complicated processes consisting of multiple steps

209

from colony-picking to enzymatic assay, and were therefore labor-intensive and

210

time-consuming. A high-throughput screening method based on droplet microfluidics

211

was reported, but it required special and expensive instruments.30 By contrast, the

212

strategy in this work is simple, easy to operate, and does not require costly

213

instruments. With slight modifications, this method can be applied to the protein

214

engineering of various enzymes.

215 216

Enzyme characterization 10


Page 10 of 34

Page 11 of 34

217


All the recombinant proteins were expressed in E. coli BL21 (DE3), purified and

218

used for enzyme characterization (Figure S3). The mutations increased the optimal

219

temperature from 45 C to 60-65 C (Figure 3A). While the optimal pH of the enzyme

220

was not changed, the relative activity at pH 4.5 was increased from 50% to 80%

221

(Figure 3B). This may be helpful in the application of this enzyme since the optimal

222

working pHs of the cellulases are around 5.0.11

223

The T50 value of the best thermostable mutant 4R1 is 66.4 °C, 25.5 °C higher than

224

that of the Ks5A7 (40.9 °C) (Figure 4A). The half-life of 4R1 at 50 C is 8640-fold of

225

that of Ks5A7 (8640 min versus 1min) (Figure 4B).

226

To compare the kinetics of Ks5A7 and the mutants, their specific activities toward

227

cellobiose at a wide range of concentrations (2-150 mM) were determined. In all the

228

tested conditions, the specific activities of the mutants were about 1.5-2.1 folds that of

229

Ks5A7 (Figure 5A). Similar to that of Ks5A7, no substrate inhibition was observed

230

for all the mutants at concentrations up to 150 mM (Figure 5A).

231

The eﬀects of glucose on the initial reaction rates of the mutants were shown in

232

Figure 5B. Both IC50 values and stimulation levels of the mutants were similar to that

233

of Ks5A7, indicating that the mutations had little effects on glucose-tolerance.

234

High specific activity and thermostability are two critical properties of industrial

235

biocatalysts. As the naturally occurring enzymes featuring both properties are rare,

236

protein engineering was employed to obtain such catalysts. Two major approaches are

237

enhancing the thermostability of highly active mesophilic enzymes, or increasing the

238

activity of thermophilic enzymes, both leading to many successes examples.41, 42

239

Furthermore, the thermostability of phosphite dehydrogenase,43 feruloyl esterase

240

EstF27,44 glucose 6-phosphate dehydrogenase32 and polyphosphate glucokinase33 was

241

improved by >7000-fold, 3360-fold, 124-fold and 7200-fold without compromising 11



242

the specific activities. In the present work, the half-life and specific activity of Ks5A7

243

were improved by 8640-fold and 1.5-2 folds, respectively (Figure 4B and Figure 5A).

244

These results are against the longstanding idea that there is an inherent trade-off

245

between stability and activity of enzymes,45, 46 and indicate that it is realistic to obtain

246

both properties by directed evolution.

247

In addition to activity and thermostability, glucose-tolerance is another property

248

that determines the performance of BGLs. In the last decades, many glucose-tolerant

249

BGLs have been isolated and characterized, but most of them are heat sensitive.7 In

250

this work, the thermostability of a mesophilic BGL was enhanced by more than

251

8000-fold without reducing the glucose-tolerance, suggesting that these two properties

252

are not incompatible. At present, most of the residues reported to affect

253

glucose-tolerance are located in and around the active site.8, 22, 47-51 Structural analysis

254

showed that three mutations in 4R1 are on the surface of the protein, far away from

255

this region (Figure 6). Although mutation T167I and A298G are located in the active

256

pocket, they appear to have no contacts with the modeled cellobiose substrate (data

257

not shown), thus showing little influences on glucose-tolerance. These results also

258

suggested that some residues in the active site not involved in glucose-tolerance may

259

be good candidates to be mutated for better properties.

260 261

Possible consequences caused by the mutations

262

A search in the PDB database indicates that the closest orthologs of Ks5A7 with

263

known structures are from Thermotoga neapolitana (PDB 5IDI, sequence identity

264

46%), Ruminiclostridium Thermocellum (PDB 5OGZ, sequence identity 46%) and

265

Thermotoga maritima (PDB 1OD0, sequence identity 45%) respectively, all from

266

thermophiles (Figure 6A). Despite highly shared sequence homologies with these 12


Page 12 of 34

Page 13 of 34


267

thermophilic BGLs, none of the mutations is absolutely conserved. To understand the

268

possible structure basis behind the boosted thermostability caused by these mutations,

269

we generated a model of the WT Ks5A7 based on the PDB entry 5IDI using the Swiss

270

server. The protein retains the general hydrolase fold. Four of the five key mutations

271

are distributed to two adjacent helices while A298G is isolated, close to the active

272

pocket (Figure 6B). According to the secondary structure prediction by the APSSP2

273

server,52 the V181F (all Ks5A7 numbering herein) mutation would slightly reduce the

274

tendency of the local environment to form a helix, while the double K186T/A187E

275

mutation would slightly enhance the possibility. The other two mutations, on the other

276

hand, did not show any evident tendency to cause any changes on the secondary

277

structure. The general fold of the protein is unlikely to undergo large conformational

278

changes either as judged by the Swiss server. However, local subtle changes could be

279

induced by each individual mutation as explained as follows. The corresponding

280

residues of T167 in other orthologs are valines, indicating the importance of a

281

non-polar residue at this position, presumably to increase the hydrophobic interactions

282

of the protein core. The T167I mutation changes a polar residue to a non-polar one,

283

which agrees with the consensus sequence. A similar situation applies to the V181F

284

mutation, which was indicated by the alignment profile that a more hydrophobic

285

residue is preferred here. On the other hand, the consequences of the K186T and

286

A187E mutations are difficult to predict, considering the fact that K186 is an extra

287

residue inserted into Ks5A7 and the random occurrence of residues at position 187.

288

However, careful analysis of the modeled structure suggests that the mutation of

289

K186T may destroy a salt bridge with E277 while gaining a hydrogen bond with

290

H278 (Figure 6C). Both interactions pull the E277H278 dipeptide towards residue

291

186, and it is unclear what possible outcome the K186T mutation leads to. 13



292

Alternatively, the K186T/A187E double mutation together changes the local

293

environment of the tip of the helix, and it somehow stabilizes the protein. Lastly,

294

A298 is located on a strand that forms the TIM barrel structure. This position is

295

usually occupied by small residues like alanines and glycines, while it is immediately

296

preceded by two hydrophobic residues FL/V/I. The A298G may partly loose up the

297

local structure of the strand and allows the two hydrophobic residues to make better

298

non-polar contacts (Figure 6D). At this point it is not clear whether these mutations

299

work synergistically to account for the observed significant stabilization effect as the

300

first four residues are spatially close, and further investigation such as structural

301

information along with biochemical studies may contribute to the understanding of the

302

structure-activity relationship of this protein.

303 304

SCB hydrolysis

305

To evaluate the performance of mutant 4R1 in cellulose hydrolysis, it was

306

supplemented to cellulase Celluclast 1.5L for pre-treated SCB degradation. WT

307

Ks5A7 with the same amount was used in the control group. In a 96-h hydrolysis, the

308

glucose released from SCB by Celluclast 1.5L alone was 64 mM (Figure 7).

309

Supplementation of Ks5A7 showed similar results because of its rapid denaturation at

310

50 C (Figure 4B). By contrast, supplementation of mutant 4R1 significantly

311

enhanced the glucose production, improving the glucose concentration by 43%

312

(Figure 7). The concentrations of cellobiose were much lower than that in the control

313

group (Figure S4). These results showed the potential of 4R1 in cellulose hydrolysis.

314

The cost of cellulase is an important factor limiting the development of

315

cellulose-based products. Performance enhancement on cellulase greatly reduces the

316

operational cost, and thus is critical to the utilization of this abundant renewable 14


Page 14 of 34

Page 15 of 34


317

source.53-57 However, a big challenge is to obtain one enzyme excelling in multiple

318

properties. Researchers have sought to obtain BGLs characterized with excellent

319

thermostability, activity and glucose-tolerance for decades. It is still difficult to find

320

one possessing all aspects either by screening from the natural resources or by protein

321

engineering the known ones.6, 7 It has even been suggested that high glucose-tolerance

322

and catalytic efficiency (especially high cellobiose affinity) exclude each other.6 But

323

soon this opinion was proved wrong by the identification of BGLs with dual

324

properties, including Ks5A7 employed in this work.14-17 Furthermore, we improved its

325

thermostability by thousands of folds without compromising the other two properties.

326

These findings clearly show that all three properties could co-exist.

327

In conclusion, functional screening of four successive rounds of random

328

mutagenesis was performed based on a modified petri dishes double-layer

329

high-throughput screening strategy, leading to the identification of five beneficial

330

mutations. Their combination improved the thermostability by 8640-fold, increased

331

the specific activity by about 1.5-2 folds and maintained a high glucose-tolerance with

332

an IC50 of 1.5 M. Supplementation of the enzyme to cellulase Celluclast 1.5L

333

significantly increased the glucose released from SCB by 43%. In this study, we

334

successfully constructed a BGL mutant with good properties on thermostability,

335

activity and glucose-tolerance, and it provides insight into the interplay of properties

336

of BGLs.

337 338

Abbreviations Used

339

Ki, inhibition constant; IC50, half maximal inhibitory concentration; WT, wild type; E.

340

coli, Escherichia coli; epPCR, error-prone PCR; IPTG,

341

Isopropyl-β-D-1-thiogalactopyranoside; SDS-PAGE, Sodium dodecyl 15



342

sulfate-polyacrylamide gel electrophoresis; pNPG, p-Nitrophenyl-β-D-

343

glucopyranoside; SCB, Sugarcane bagasse; HPLC, High-Performance Liquid

344

Chromatography; TLC, thin-layer chromatography.

345 346

Funding sources

347

This research was supported by National Natural Science Foundation of China

348

(31770075, 31170117, and 31870782), Science & Technology Projects of Guangzhou

349

(201804010285), and China Postdoctoral Science Foundation (2017M622859).

350 351

Author contributions

352

Yh.L. designed the research and revised the manuscript; Lc.C. designed the research,

353

performed the experiments, analyzed the data and wrote the manuscript. Sf.L. and

354

X.H. performed the experiments, and revised the manuscript; Zm.Q. and W.K.

355

participated in performing the experiments and helped in revising the manuscript.

356

W.X. performed the structural analysis and revised the manuscript. All authors have

357

read and approved the final manuscript.

358 359

Additional Information

360

Competing financial interests: we filed a provisional Chinese patent disclosure for the

361

Ks5A7 mutants.

362 363

Supporting Information description

364

DNA alignment of the original sequence and the optimized sequence of gene Ks5A7;

365

Re-screening of mutants with improved thermostability; SDS-PAGE analysis of the

366

supernatants of cell lysate (A) and the purified recombinant protein of the mutants (B); 16


Page 16 of 34

Page 17 of 34


367

TLC analysis of the hydrolysis products from SCB. This material is available free of

368

charge via the Internet at http://pubs.acs.org.

17



References 1.

Zhang, Q.; Hu, J.; Lee, D.-J. Pretreatment of biomass using ionic liquids:

Research updates. Renewable Energy 2017, 111, 77-84. 2.

Hu, J.; Zhang, Q.; Jing, Y.; Lee, D.-J. Photosynthetic hydrogen production from

enzyme-hydrolyzed micro-grinded maize straws. Int. J. Hydrogen Energy 2016, 41, 21665-21669. 3.

Guo, H.; Chang, Y.; Lee, D.-J., Enzymatic saccharification of lignocellulosic

biorefinery: Research focuses. Bioresour. Technol. 2018, 252, 198-215. 4.

Singhania, R. R.; Patel, A. K.; Sukumaran, R. K.; Larroche, C.; Pandey, A. Role

and significance of β-glucosidases in the hydrolysis of cellulose for bioethanol production. Bioresour. Technol. 2013, 127, 500-507. 5.

Singhania, R. R.; Patel, A. K.; Pandey, A.; Ganansounou, E. Genetic

modification: A tool for enhancing β-glucosidase production for biofuel application. Bioresour. Technol. 2017, 245, 1352-1361. 6.

Teugjas, H.; Väljamäe, P. Selecting β-glucosidases to support cellulases in

cellulose saccharification. Biotechnol. Biofuels 2013, 6, 105. 7.

Salgado, J. C. S.; Meleiro, L. P.; Carli, S.; Ward, R. J. Glucose tolerant and

glucose stimulated β-glucosidases – A review. Bioresour. Technol. 2018, 267, 704-713. 8.

Mariano, D. C. B.; Leite, C.; Santos, L. H. S.; Marins, L. F.; Machado, K. S.;

Werhli, A. V.; Lima, L. H. F.; de Melo-Minardi, R. C. Characterization of glucose-tolerant β-glucosidases used in biofuel production under the bioinformatics perspective: a systematic review. GMR, Genet. Mol. Res. 2017, 16, 1-19. 9.

Hodge, D. B.; Karim, M. N.; Schell, D. J.; McMillan, J. D. Model-based

fed-batch for high-solids enzymatic cellulose hydrolysis. Appl. Biochem. Biotechnol. 18


Page 18 of 34

Page 19 of 34


2009, 152, 88-107. 10. Cairns, J. R. K.; Esen, A. β-Glucosidases. Cell. Mol. Life Sci. 2010, 67, 3389-405. 11. Sorensen, A.; Lubeck, M.; Lubeck, P. S.; Ahring, B. K. Fungal β-glucosidases: a bottleneck in industrial use of lignocellulosic materials. Biomolecules 2013, 3, 612-31. 12. Kengen, S. W. M.; LUESINK, E. J.; M, S. A. J.; ZEHNDER, A. J. B. Purification and characterization of an extremely thermostable β‐glucosidase from the hyperthermophilic archaeon Pyrococcus furiosus. Eur. J. Biochem. 1993, 213, 305-312. 13. Sinha, S. K.; Datta, S. β-Glucosidase from the hyperthermophilic archaeon Thermococcus sp. is a salt-tolerant enzyme that is stabilized by its reaction product glucose. Appl. Microbiol. Biotechnol. 2016, 100, 8399-8409. 14. Nascimento, C. V.; Souza, F. H. M.; Masui, D. C.; Leone, F. A.; Peralta, R. M.; Jorge, J. A.; Furriel, R. P. M. Purification and biochemical properties of a glucose-stimulated β-D-glucosidase produced by Humicola grisea var. thermoidea grown on sugarcane bagasse. J. Microbiol. 2010, 48, 53-62. 15. Souza, F. H. M.; Inocentes, R. F.; Ward, R. J.; Jorge, J. A.; Furriel, R. P. M. Glucose and xylose stimulation of a β-glucosidase from the thermophilic fungus Humicola insolens: A kinetic and biophysical study. J. Mol. Catal. B: Enzym. 2013, 94, 119-128. 16. Meleiro, L. P.; Salgado, J. C. S.; Maldonado, R. F.; Alponti, J. S.; Zimbardi, A. L. R. L.; Jorge, J. A.; Ward, R. J.; Furriel, R. P. M. A Neurospora crassa β-glucosidase with potential for lignocellulose hydrolysis shows strong glucose tolerance and stimulation by glucose and xylose. J. Mol. Catal. B: Enzym. 2015, 122, 131-140. 17. Uchiyama, T.; Yaoi, K.; Miyazaki, K. Glucose-tolerant β-glucosidase retrieved 19



from a Kusaya gravy metagenome. Front. Microbiol. 2015, 6, 548. 18. Turner, N. J. Directed evolution drives the next generation of biocatalysts. Nat. Chem. Biol. 2009, 5, 567-73. 19. Packer, M. S.; Liu, D. R. Methods for the directed evolution of proteins. Nat. Rev. Genet. 2015, 16, 379-94. 20. Zeymer, C.; Hilvert, D. Directed Evolution of Protein Catalysts. Annu. Rev. Biochem. 2018, 87, 131-157. 21. Meleiro, L. P.; Salgado, J. C. S.; Maldonado, R. F.; Carli, S.; Moraes, L. A. B.; Ward, R. J.; Jorge, J. A.; Furriel, R. P. M. Engineering the GH1 β-glucosidase from Humicola insolens: Insights on the stimulation of activity by glucose and xylose. PLoS One 2017, 12, e0188254. 22. Matsuzawa, T.; Jo, T.; Uchiyama, T.; Manninen, J. A.; Arakawa, T.; Miyazaki, K.; Fushinobu, S.; Yaoi, K. Crystal structure and identification of a key amino acid for glucose tolerance, substrate specificity, and transglycosylation activity of metagenomic β-glucosidase Td2F2. FEBS J. 2016, 283, 2340-53. 23. McCarthy, J. K.; Uzelac, A.; Davis, D. F.; Eveleigh, D. E. Improved Catalytic Efficiency and Active Site Modification of 1,4-β-d-Glucan Glucohydrolase A from Thermotoga neapolitana by Directed Evolution. J. Biol. Chem. 2004, 279, 11495-11502. 24. Lopez-Camacho, C.; Salgado, J.; Lequerica, J. L.; Madarro, A.; Ballestar, E.; Franco, L.; Polaina, J. Amino acid substitutions enhancing thermostability of Bacillus polymyxa β-glucosidase A. Bioche. J 1996, 314 ( Pt 3), 833-838. 25. Arrizubieta, M. J. Increased Thermal Resistance and Modification of the Catalytic Properties of a β-Glucosidase by Random Mutagenesis and in Vitro Recombination. J. Biol. Chem. 2000, 275, 28843-28848. 20


Page 20 of 34

Page 21 of 34


26. González-Blasco, G.; Sanz-Aparicio, J.; González, B.; Hermoso, J. A.; Polaina, J. Directed evolution of β-glucosidase A from Paenibacillus polymyxa to thermal resistance. J. Biol. Chem. 2000, 275, 13708-13712. 27. Liu, W.; Hong, J.; Bevan, D. R.; Zhang, Y. H. Fast identification of thermostable β-glucosidase mutants on cellobiose by a novel combinatorial selection/screening approach. Biotechnol. Bioeng. 2009, 103, 1087-94. 28. Pei, X. Q.; Yi, Z. L.; Tang, C. G.; Wu, Z. L. Three amino acid changes contribute markedly to the thermostability of β-glucosidase BglC from Thermobifida fusca. Bioresour. Technol. 2011, 102, 3337-42. 29. Cao, L. C.; Wang, Z. J.; Ren, G. H.; Kong, W.; Li, L.; Xie, W.; Liu, Y. H., Engineering a novel glucose-tolerant β-glucosidase as supplementation to enhance the hydrolysis of sugarcane bagasse at high glucose concentration. Biotechnol. Biofuels 2015, 8, 202. 30. Romero, P. A.; Tran, T. M.; Abate, A. R. Dissecting enzyme function with microfluidic-based deep mutational scanning. Proc. Natl. Acad. Sci. U. S. A. 2015, 112, 7159-7164. 31. Huang, R.; Chen, H.; Zhong, C.; Kim, J. E.; Zhang, Y. H. High-Throughput Screening of Coenzyme Preference Change of Thermophilic 6-Phosphogluconate Dehydrogenase from NADP+ to NAD+. Sci.Rep. 2016, 6, 32644. 32. Huang, R.; Chen, H.; Zhou, W.; Ma, C.; Zhang, Y. P. Engineering a thermostable highly active glucose 6-phosphate dehydrogenase and its application to hydrogen production in vitro. Appl. Microbiol. Biotechnol. 2018, 102, 3203-3215. 33. Zhou, W.; Huang, R.; Zhu, Z.; Zhang, Y.-H. P. J. Coevolution of both Thermostability and Activity of Polyphosphate Glucokinase from Thermobifida fusca YX. Appl. Environ. Microbiol. 2018, 84. 21



34. Pei, J.; Pang, Q.; Zhao, L.; Fan, S.; Shi, H. Thermoanaerobacterium thermosaccharolyticum β-glucosidase: a glucose-tolerant enzyme with high specific activity for cellobiose. Biotechnol. Biofuels 2012, 5, 31. 35. Borges, D. G.; Baraldo Junior, A.; Farinas, C. S.; de Lima Camargo Giordano, R.; Tardioli, P. W. Enhanced saccharification of sugarcane bagasse using soluble cellulase supplemented with immobilized β-glucosidase. Bioresour. Technol. 2014, 167, 206-13. 36. Adney, B.; Baker, J. Measurement of Cellulase Activities. National Renewable Energy Laboratory 1996, NREL, Golden, CO. 37. Li, L.; Li, G.; Cao, L. C.; Ren, G. H.; Kong, W.; Wang, S. D.; Guo, G. S.; Liu, Y. H. Characterization of the cross-linked enzyme aggregates of a novel β-galactosidase, a potential catalyst for the synthesis of galacto-oligosaccharides. J. Agric. Food Chem. 2015, 63, 894-901. 38. Waterhouse, A.; Bertoni, M.; Bienert, S.; Studer, G.; Tauriello, G.; Gumienny, R.; Heer, F. T.; de Beer, T. AP.; Rempfer, C.; Bordoli, L.; Lepore, R.; Schwede, T., SWISS-MODEL: homology modelling of protein structures and complexes. Nucleic Acids Res. 2018, 46, W296-W303. 39. Romero, P. A.; Arnold, F. H. Exploring protein fitness landscapes by directed evolution. Nat. Rev. Mol. Cell Biol. 2009, 10, 866-76. 40. Lopezcamacho, C.; Polaina, J. Random mutagenesis of a plasmid-borne glycosidase gene and phenotypic selection of mutants in Escherichia coli. Mutat. Res. Lett. 1993, 301, 73-77. 41. Giver, L.; Gershenson, A.; Freskgard, P.-O.; Arnold, F. H. Directed evolution of a thermostable esterase. Proc. Natl. Acad. Sci. U. S. A. 1998, 95, 12809-12813. 42. Li, G.; Maria-Solano, M. A.; Romero-Rivera, A.; Osuna, S.; Reetz, M. T. 22


Page 22 of 34

Page 23 of 34


Inducing high activity of a thermophilic enzyme at ambient temperatures by directed evolution. Chem. Commun. (Cambridge, U. K.) 2017, 53, 9454-9457. 43. Johannes, T. W.; Woodyer, R. D.; Zhao, H. Directed Evolution of a Thermostable Phosphite Dehydrogenase for NAD(P)H Regeneration. Appl. Environ. Microbiol. 2005, 71, 5728-5734. 44. Cao, L. C.; Chen, R.; Xie, W.; Liu, Y. H. Enhancing the Thermostability of Feruloyl Esterase EstF27 by Directed Evolution and the Underlying Structural Basis. J. Agric. Food Chem. 2015, 63, 8225-33. 45. Miller, S. R. An appraisal of the enzyme stability-activity trade-off. Evolution 2017, 71, 1876-1887. 46. Nguyen, V.; Wilson, C.; Hoemberger, M.; Stiller, J. B.; Agafonov, R. V.; Kutter, S.; English, J.; Theobald, D. L.; Kern, D. Evolutionary drivers of thermoadaptation in enzyme catalysis. Science 2016, 355, 289. 47. Pang, P.; Cao, L.-c.; Liu, Y.-h.; Xie, W.; Wang, Z., Structures of a glucose-tolerant β-glucosidase provide insights into its mechanism. J. Struct. Biol. 2017, 198, 154-162. 48. Yang, Y.; Zhang, X.; Yin, Q.; Fang, W.; Fang, Z.; Wang, X.; Zhang, X.; Xiao, Y., A mechanism of glucose tolerance and stimulation of GH1 β-glucosidases. Sci. Rep. 2015, 5, 17296. 49. Lee, H. L.; Chang, C. K.; Jeng, W. Y.; Wang, A. H.; Liang, P. H., Mutations in the substrate entrance region of β-glucosidase from Trichoderma reesei improve enzyme activity and thermostability. Protein Eng. Des. Sel. 2012, 25, 733-40. 50. Guo, B.; Amano, Y.; Nozaki, K. Improvements in Glucose Sensitivity and Stability of Trichoderma reesei β-Glucosidase Using Site-Directed Mutagenesis. PloS one 2016, 11, e0147301. 23



51. Goswami, S.; Das, S.; Datta, S. Understanding the role of residues around the active site tunnel towards generating a glucose-tolerant β-glucosidase from Agrobacterium tumefaciens 5A. Protein Eng. Des. Sel. 2017, 30, 523-530. 52. Raghava, G. APSSP2: A combination method for protein secondary structure prediction based on neural network and example based learning. CASP5 A-132 2002. 53. Percival Zhang, Y. H.; Himmel, M. E.; Mielenz, J. R. Outlook for cellulase improvement: screening and selection strategies. Biotechnol. Adv. 2006, 24, 452-81. 54. Himmel, M. E.; Ding, S. Y.; Johnson, D. K.; Adney, W. S.; Nimlos, M. R.; Brady, J. W.; Foust, T. D. Biomass Recalcitrance: Engineering Plants and Enzymes for Biofuels Production. Science 2007, 315, 804-807. 55. Lynd, L. R.; Laser, M. S.; Bransby, D.; Dale, B. E.; Davison, B.; Hamilton, R.; Himmel, M.; Keller, M.; McMillan, J. D.; Sheehan, J. How biotech can transform biofuels. Nat.Biotechnol. 2008, 26, 169-172. 56. Manisha; Yadav, S. K. Technological advances and applications of hydrolytic enzymes for valorization of lignocellulosic biomass. Bioresour. Technol. 2017, 245, 1727-1739. 57. Prajapati, A. S.; Panchal, K. J.; Pawar, V. A.; Noronha, M. J.; Patel, D. H.; Subramanian, R. B. Review on Cellulase and Xylanase Engineering for Biofuel Production. Ind. Biotechnol. 2018, 14, 38-44.

24


Page 24 of 34

Page 25 of 34


Figure Captions Figure 1 Petri dish-based double-layer high-throughput screening of mutants with improved thermostability. (A) Optimization of the cultivation temperature of strains containing Ks5A7 and IPTG concentration in the agar-plates. (B) Optimization of the heat-treatment condition for the first round screening. (C). Flow scheme for the Petri dish-based double-layer high-throughput screening. A positive clone was marked by a red arrow. Figure 2. The amino acids changes in the mutants of Ks5A7 and the corresponding screening conditions. The mutants selected as the starting points for the next round of evolution are marked with asterisk. Newly introduced mutations in each generation are underlined. Figure 3. Optimal temperatures and optimal pHs of the Ks5A7 mutants. (A) Optimal temperature was determined a pH-6.0 buffer. (B) Optimal pH was determined at 50 °C except for wild type Ks5A7 (45 °C). Data points are the average of triplicate measurements, and error bars represent standard deviation. Figure 4. Thermostability of Ks5A7 mutants. (A) Half-lives of Ks5A7 mutants at 50 °C. The values are 1 min (Ks5A7), 15 min (1R2), 285 min (2R1), 4800 min (3R1) and 8640 min (4R1). (B) Thermal inactivation curves of Ks5A7 mutants. The T50 values are 40.9 °C (Ks5A7), 49.5 °C (1R2), 55.7 °C (2R1), 63.1°C (3R1) and 66.4 °C (4R1). Data points are the average of triplicate measurements, and error bars represent standard deviation. Figure 5. Specific activities (A) and glucose-tolerance (B) of the Ks5A7 and the mutants. (A) The specific activities were determined by using 2-150 mM cellobiose as substrates. The values were 243.18 (Ks5A7) and 374.26 U/mg (4R1) for 50 mM cellobiose. (B) The IC50 values were determined by using 5 mM pNPG as substrates. 25



The values are 1.5 M for WT Ks5A7 and all the mutants. The maximal stimulation levels are 1.25-fold (Ks5A7), 1.2-fold (1R2), 1.15-fold (2R1), 1.2-fold (3R1) and 1.1-fold (4R1). All the reactions were performed at 50 °C and pH 6.0 except for wild type Ks5A7 (45 °C). Data points are the average of triplicate measurements, and error bars represent standard deviation. Figure 6. Structural analysis of the mutational effects to Ks5A7 thermostability. The structure was modeled by the SWISS-MODEL webserver, based on the structure of the Thermotoga neapolitana ortholog (PDB 5IDI). (A) The multiple sequence alignment of Ks5A7 with its orthologs with known structures. Listed sequences are Ks5A7, BGLs from Thermotoga neapolitana (PDB 5IDI), Ruminiclostridium Thermocellum (PDB 5OGZ) and Thermotoga maritima (PDB 1OD0) respectively. The mutated residues were shown by the red arrows. (B) Distribution of the mutations in the modeled structure. The protein was shown in ribbon representation and the residues at the mutational sites were shown as spheres. (C) The local environment of the K186T mutant. The possible hydrogen bonds or salt bridges were shown by the red dashed lines with the distances shown in blue (units: Å). (D) The local environment around the A298G mutant and the potential hydrophobic interactions were indicated by the red dashed lines with the distances shown in blue (units: Å). Figure 7. Hydrolysis of pre-treated SCB by Ks5A7 and 4R1. Supplementation of Ks5A7 or 4R1 to Celluclast 1.5L (■) showed different effects on the glucose production from SCB. Data points are the average of two experiments, and error bars represent standard deviation.

26


Page 26 of 34

Page 27 of 34


Figure 1. Petri dish-based double-layer high-throughput screening of mutants with improved thermostability. (A) Optimization of the cultivation temperature of strains containing Ks5A7 and IPTG concentration in the agar-plates. (B) Optimization of the heat-treatment condition for the first round screening. (C). Flow scheme for the Petri dish-based double-layer high-throughput screening. A positive clone was marked by a red arrow.



Figure 2. The amino acids changes in the mutants of Ks5A7 and the corresponding screening conditions. The mutants selected as the starting points for the next round of evolution are marked with asterisk. Newly introduced mutations in each generation are underlined.


Page 28 of 34

Page 29 of 34


Figure 3. Optimal temperatures and optimal pHs of the Ks5A7 mutants. (A) Optimal temperature was determined a pH-6.0 buffer. (B) Optimal pH was determined at 50 °C except for wild type Ks5A7 (45 °C). Data points are the average of triplicate measurements, and error bars represent standard deviation. 252x395mm (300 x 300 DPI)



Figure 4. Thermostability of Ks5A7 mutants. (A) Half-lives of Ks5A7 mutants at 50 °C. The values are 1 min (Ks5A7), 15 min (1R2), 285 min (2R1), 4800 min (3R1) and 8640 min (4R1). (B) Thermal inactivation curves of Ks5A7 mutants. The T50 values are 40.9 °C (Ks5A7), 49.5 °C (1R2), 55.7 °C (2R1), 63.1°C (3R1) and 66.4 °C (4R1). Data points are the average of triplicate measurements, and error bars represent standard deviation.


Page 30 of 34

Page 31 of 34


Figure 5. Specific activities (A) and glucose-tolerance (B) of the Ks5A7 and the mutants. (A) The specific activities were determined by using 2-150 mM cellobiose as substrates. The values were 243.18 (Ks5A7) and 374.26 U/mg (4R1) for 50 mM cellobiose. (B) The IC50 values were determined by using mM pNPG as substrates. The values are 1.5 M for WT Ks5A7 and all the mutants. The maximal stimulation levels are 1.25-fold (Ks5A7), 1.2-fold (1R2), 1.15-fold (2R1), 1.2-fold (3R1) and 1.1-fold (4R1). All the reactions were performed at 50 °C and pH 6.0 except for wild type Ks5A7 (45 °C). Data points are the average of triplicate measurements, and error bars represent standard deviation.



Figure 6. Structural analysis of the mutational effects to Ks5A7 thermostability. The structure was modeled by the SWISS-MODEL webserver, based on the structure of the Thermotoga neapolitana ortholog (PDB 5IDI). (A) The multiple sequence alignment of Ks5A7 with its orthologs with known structures. Listed sequences are Ks5A7, BGLs from Thermotoga neapolitana (PDB 5IDI), Ruminiclostridium Thermocellum (PDB 5OGZ) and Thermotoga maritima (PDB 1OD0) respectively. The mutated residues were shown by the red arrows. (B) Distribution of the mutations in the modeled structure. The protein was shown in ribbon representation and the residues at the mutational sites were shown as spheres. (C) The local environment of the K186T mutant. The possible hydrogen bonds or salt bridges were shown by the red dashed lines with the distances shown in blue (units: Å). (D) The local environment around the A298G mutant and the potential hydrophobic interactions were indicated by the red dashed lines with the distances shown in blue (units: Å).


Page 32 of 34

Page 33 of 34


Figure 7. Hydrolysis of pre-treated SCB by Ks5A7 and 4R1. Supplementation of Ks5A7 or 4R1 to Celluclast 1.5 L (■) showed different effects on the glucose production from SCB. Data points are the average of two experiments, and error bars represent standard deviation. 135x104mm (300 x 300 DPI)



Table of contents graphics


Page 34 of 34

Enhancing the Thermostability of Highly Active and Glucose-Tolerant

Recommend Documents