Enzyme-Free Colorimetric Detection of DNA by Using Gold

Subscriber access provided by University | of Minnesota Libraries

Article

Enzyme-free colorimetric detection of DNA by using gold nanoparticles and hybridization chain reaction amplification Pei Liu, Xiaohai Yang, Shan Sun, Qing Wang, Kemin Wang, Jin Huang, Jianbo Liu, and Leiliang He Anal. Chem., Just Accepted Manuscript • DOI: 10.1021/ac4001157 • Publication Date (Web): 30 Jul 2013 Downloaded from http://pubs.acs.org on July 31, 2013

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

Analytical Chemistry is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 26

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Analytical Chemistry

Enzyme-free colorimetric detection of DNA by using gold nanoparticles and hybridization chain reaction amplification Pei Liu, Xiaohai Yang, Shan Sun, Qing Wang, Kemin Wang*, Jin Huang, Jianbo Liu, Leiliang He State Key Laboratory of Chemo/Biosensing and Chemometrics, College of Chemistry and Chemical Engineering, Hunan University. Key Laboratory for Bio-Nanotechnology and Molecule Engineering of Hunan Province, Changsha 410082, China

*To whom correspondence should be addressed. E-mail: [email protected]. Phone: +86-73188821566. Fax: +86-731-88821566.

ACS Paragon Plus Environment

1


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 26

ABSTRACT

A novel, high sensitive and specific DNA assay based on gold nanoparticles (AuNP) colorimetric detection and hybridization chain reaction (HCR) amplification has been demonstrated in this article. Two hairpin auxiliary probes were designed with single-stranded DNA (ssDNA) sticky ends which stabilize AuNPs and effectively prevent them from salt-induced aggregation. The target DNA hybridized with the hairpin auxiliary probes and triggered the formation of extended double-stranded DNA (dsDNA) polymers through HCR. As a result, the formed dsDNA polymers provide less stabilization without ssDNA sticky ends, and AuNPs undergo aggregation when salt concentration is increased. Subsequently, a pale purple-to-blue color variation is observed in the colloid solution. The system is simple in design and convenient in operation. The novel strategy eliminates the need of enzymatic reactions, separation processes, chemical modifications, and sophisticated instrumentations. The detection and discrimination process can be seen with the naked eye. The detection limit of this method is lower than or at least comparable to previous AuNP-based methods. Importantly, the protocol offers high selectivity for the determination between perfectly matched target oligonucleotides and targets with single base-pair mismatches.


2

Page 3 of 26

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


DNA detection methods have attracted substantial research efforts due to their broad applications in virus detection, transgenic detection, and early diagnosis of diseases. 1-5 Different optical, 6-8 electronic, 9-12

and microgravimetric

13, 14

sensing platforms for the analysis of DNA were developed. Although

these methods can be used for detection of exceedingly low levels of DNA, some inherent issues still can not be avoided, for example, complex operations, costly polymerase, tedious labels, and dedicated instrumentation. Due to the low cost, simplicity and practicality, gold nanoparticle (AuNP) -based colorimetric assays have been demonstrated to be a highly competitive biosensing technology for oligonucleotide targets.

15-24

For colorimetric detection of DNA sequences, there are two major classes

of AuNP-based assays. The first one is AuNP aggregation induced by an interparticle crosslinking mechanism which utilizes a three-component sandwich assay format.

25

The second one is non-

crosslinking detection that relies on the difference in binding properties of single-stranded DNA (ssDNA) and double-stranded DNA (dsDNA) toward unmodified AuNPs.

15-17

Because ssDNA is

flexible and can partially uncoil its bases, it can be easily adsorbed onto AuNPs and thus prevent saltinduced AuNP aggregation by enhancing the electrostatic repulsion between ssDNA-adsorbed AuNPs. On the other hand, as dsDNA is stiffer and has its negatively charged phosphate backbone exposed, the strong repulsion between dsDNA and negatively charged AuNPs makes their binding negligible, which cannot prevent salt-induced AuNP aggregation. A notable benefit of the second strategy method lies in the elimination of covalent functionalization of particles required in the three-component sandwich assay format. 16, 17 Although AuNP-based colorimetric assays indeed have many advantages as mentioned, a number of constraints associated with conventional prototype designs still exist, such as limited sensitivity and poor detection limit. For example, the limit of colorimetric detection for a short DNA sequence by conventional sandwich assays (using 14 nm nanoparticles) is around 10 nM, which is much higher than the typical detection limit (below 1 nM) required in many diagnostic assays.

18

To meet these

challenges, some efforts have turned to enzyme-assisted nanoparticle amplification. Many kinds of


3


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 4 of 26

AuNP-based colorimetric assays for nucleic acid detection were reported, based on different types of enzymes, including endonucleases, ligases, and polymerases.

25-31

However, these enzyme-based DNA

biosensors suffered from the complexity of the experimental system. Moreover, false-positives may happen during the amplification process sometimes. Therefore, it is highly demanded to develop a more sensitive AuNP colorimetric biosensing technology, without the introduction of protein enzyme. In 2004, Dirks and Pierce first introduced the concept of hybridization chain reaction (HCR) for DNA detection with PCR-like sensitivity, but not need protein enzyme. 32 HCR is a triggered self-assembly and enzyme-free process, where two stable species of DNA hairpins coexist in solution, and will not fabricate a long nicked dsDNA molecule until an initiator target is introduced. Nowadays, many other studies combined the amplification capability of HCR with various sensing platforms and showed promising results. 33-38 Ma and co-workers reported an elegant approach for colorimetric DNA detection based on hairpin assembly reaction and target-catalytic circuits.39 This method, using a interparticle crosslinking mechanism, however, suffer from time-consuming (20-40 h of assembly) and relatively poor (low nanomolar) detection limits, respectively. In order to develop a more simple, rapider and sensitive method, a self-assembled DNA nanostructure is worth a try for non-crosslinking AuNPs-based colorimetric biosensing of DNA, since there are dramatic difference between brick DNA hairpins and the long nicked dsDNA in configuration and length. In this study, we have developed a detection system that combines AuNP-based colorimetric detection and DNA HCR amplification. As shown in Scheme 1, we design two hairpin auxiliary probes, H1 and H2, and both H1 and H2 included two fragments. The fragment I (blue line) at the 3′ end of H1 is complementary to the fragment I′ (blue line) of H2. The fragment II′ (red line) at the 5′ end of H2 can hybridize with the fragment II (red line) of H1. In addition, the fragment I at the 5′ end of H1 can also hybridize with the target DNA (green line). The target pairs with the sticky end of H1, which undergoes an unbiased strand-displacement interaction to open the hairpin (step 1). The newly exposed sticky end of H1, fragment II, nucleates at the sticky end of H2 and opens the hairpin to expose a sticky end,


4

Page 5 of 26

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


fragment I′, on H2 (step 2). This sticky end is identical to the target in sequence and hybridizes with hairpin H1 (step 3). In this way, each copy of the target can propagate a chain reaction of hybridization events between alternating H1 and H2 hairpins to form a nicked double-helix (repeat step 2 and step 3). The formed nicked double-helix dsDNA is stiffer and its negatively charged phosphate backbone exposed. Subsequently, the strong repulsion between dsDNA and negatively charged AuNPs makes their binding negligible, which cannot prevent salt-induced AuNP aggregation. As a result, a pale purple-to-blue color variation is observed in the colloid solution. The sensitivity of this detection platform is comparable to that of the enzyme-mediated AuNP-based colorimetric assays.


5


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 6 of 26

EXPERIMENTAL SECTION Chemicals. Lyophilized oligonucleotides designed in this study were synthesized by Sangon biotech Co., Ltd. (Shanghai, China) and dissolved in ultrapure water. The sequences of all oligonucleotides are listed in Table 1. Chloroauric acid (HAuCl4 • 4H2O) and trisodium citrate were obtained from Shanghai Reagent Co. (Shanghai, China). Ultrapure water obtained from a Millipore water purification system (≥18 MΩ•cm resistivity, Milli-Q, Millipore) was used in all assays. Concentrated DNA stock solutions were prepared in buffer that was later diluted to reaction conditions: a sodium phosphate-sodium chloride buffer solution (SPSC, 50 mM Na2HPO4 / 1.0 M NaCl, pH 7.5). All other reagents were of analytical grade and used as received. Gel electrophoresis. H1 and H2 were heated to 95 oC for 2 min and then allowed to cool to room temperature for 1 h before use. Different concentrations of target DNA were incubated with 100 nM each H1 and H2 at 25 oC for 2 h. A 1% agarose gel was prepared using 1 × TAE buffer (40 mM Tris AcOH, 2.0 mM Na2EDTA, pH 8.5). The SYBR Gold was used as oligonucleotide dye and mixed with samples. The gel was run at 42 V for 150 min in 1 × TAE buffer, and then was scanned using the gel image analysis system. Preparation of gold nanoparticles. Gold nanoparticles (~14 nm) were first prepared by the citrate reduction of HAuCl4.1 In a typical experiment, a 5 mL aqueous solution of sodium citrate (1 w %) was added to a boiling solution of HAuCl4 (50 mL, 1 mM). After the solution color changed to red, the reaction mixture was allowed to reflux for 20 min. Then the solution was cooled to room temperature and filtered, stored in a refrigerator at 4 oC before use. Measurement procedure. In a typical target DNA assay, H1 and H2 were heated to 95 oC for 2 min and then allowed to cool to room temperature for 1 h before use. Target DNA samples were mixed with H1 (100 nM), H2 (100 nM) in a SPSC buffer solution, and then were incubated at 25 oC for 1 h. Subsequently, 30 µL abovementioned reaction mixture was added into AuNP colloidal solution of 270 µL. After incubation for 2 min, the mixed solution was detection by either visual observation or UV/vis


6

Page 7 of 26

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


characterization. Instrumentation. Absorption spectra were recorded on a Shimadzu UV-1601 UV/vis spectrophotometer (Japan) at room temperature. Transmission electron microscopy (TEM) measurements were made on a JEM-3010 transmission electron microscope. The samples for TEM characterization were prepared by adding a drop of colloidal solution on a carbon-coated copper grid and drying at room temperature. The images of gel electrophoresis were scanned by the Gel Image Analysis System (Tanon 2500R, Shanghai, China).


7


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 8 of 26

RESULTS AND DISCUSSIONS As a proof-of-principle experiment, we first prepared H1/H2/AuNPs detection system as abovementioned procedure, and mixed with buffer or 5 nM target DNA test solution. Figure 1A shows UV/vis absorption spectra and the corresponding photographs of AuNP colloids. As shown, in the absence of target, a surface plasmon resonance absorption band of AuNPs was observed in the spectra at approximate 522 nm (Figure 1A, solid line) and the color of the solution appeared pale purple after the addition of salt (Figure 1A, inset, left centrifuge tube). However, in the presence of 5 nM target, an absorption band at 642 nm appeared and the absorbance at 522 nm decreased (Figure 1A, dashed line). Correspondingly, the color of the solution turned to blue (Figure 1A, inset, right centrifuge tube). The target DNA as an initiator triggers a cascade of hybridization events to yield nicked double helices analogous to alternating copolymers. Hairpin probes H1/H2 bind to unmodified nanoparticles and effectively stabilize them against salt-induced aggregation, but the nicked double helices DNA does not. Therefore, in the presence of the target DNA, the formed nicked double-helix provides little stabilization, and AuNPs undergo aggregation when salt concentrations are increased. As a result, the solution color changes from pale purple to blue due to a bathochromic shift of the localized surface plasmon resonance. The HCR between the target sequence and the designed hairpin auxiliary probes was examined by gel electrophoresis. Electrophoresis gel images (Figure 1B) show the products synthesized by HCR in the presence of various concentrations of target DNA. As shown in Figure 1B, from left to right, it could be observed that there was only one band of hairpin auxiliary probes H1/H2 in first lane when the target DNA was absent, indicating that no HCR occurs. As a comparison, new smears appeared in the second and third lane when target DNA were mixed with H1/H2 in the SPSC buffer solution, suggesting HCR had taken place and formed long nicked DNA polymers. In the HCR system, amplification of the initiator recognition event continues until the supply of H1 or H2 is exhausted, and the molecular weight of the resulting polymers is not a exact numerical value, but only approximate range. Therefore, the


8

Page 9 of 26

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


resulting polymers in the gel electrophoresis images appear smears instead of bands. This result is similar to other literatures. 32, 35, 37 The HCR-induced aggregation of AuNPs was further confirmed by TEM images. As shown in Figure 1C, AuNPs were well dispersed in the absence of target DNA though a high salt concentration of 100 mM was introduced (Figure 1C, upper image), which resulted from the protection of the adsorbed hairpin DNA units. While in the presence of target DNA, AuNPs aggregated after the addition of salt (Figure 1C, bottom image). The TEM results (Figure 1C) were consistent with the red-shift of UV/vis absorption spectra as well as the color change of colloid solution in the absence and presence of target, thus the designed H1/H2/AuNPs colorimetric detection system was suitable for DNA detection. In order to investigate the mechanism of hairpin DNA stabilizing AuNPs against salt-induced aggregation, we prepared six different DNA samples and mixed with AuNP colloid: sample 1, blank without salt; sample 2, H1 with salt; sample 3, H2 with salt; sample 4, H1/H2 with salt; sample 5, H2a with salt; sample 6, H1/H2/target DNA with salt. All samples were incubated at 25 oC for 1 hour. As shown in Figure 2 inset, compared with sample 1, the color of sample 2, 3, 4, all had little change, and the color of sample 5, 6 turned to blue. The phenomena indicated that the exposed sticky ends from H1/H2 were capable of stabilizing the gold nanoparticles (Sample 2, 3, 4). When the exposed sticky end was cut, the remained duplex structure could not prevent the AuNPs from aggregation in the presence of salt (Sample 5). As shown in Table 1, the underlined sequences were the exposed sticky end of hairpin oligonucleotides. This result was consistent with the proposed mechanism illustrated in Scheme 1, i.e. the exposed sticky ends of hairpin probes binding to the particle prevented AuNP aggregation. We also studied the influence of the length of the exposed sticky end, and added 3 or 6 thymine deoxynucleotide at end of overhang of H1/H2. As shown in Figure S5 in supporting information, the results showed that the original hairpin auxiliary probes (H1/H2) provided the greatest color changes in the presence of various concentrations of target DNA (Figure S5 in Supporting Information). This result may be attributed that the addition thymine deoxynucleotide at end of overhang of H1/H2 would interfere with


9


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 10 of 26

the HCR event. To evaluate the aggregation state of AuNPs in more detail, we used the ratio of absorbance at 642 and 522 nm (A642/A522) to assess the degree of AuNP aggregation. The ratio is also associated with the color of the solution, with a low ratio corresponding to a pale purple solution and a high ratio corresponding to a blue one. The influences of different concentration of hairpin oligonucleotides H1/H2 were investigated, since oligonucleotides H1/H2 not only constituted important components of HCR, but also functioned in the process of AuNP aggregation. In Figure 3, the absorbance ratios (A642/A522), for 100, 200, 300, 500, 700 nM each H1 and H2, were plotted as functions of the various concentration target DNA in the buffer solution. Obviously, the sensitivity and dynamic range of the colorimetric detection system was influenced by the addition amount of hairpin oligonucleotides. The colorimetric detection system with 100 nM each H1 and H2 obtained a narrow linear range but a high sensitivity. The colorimetric detection system with higher concentration H1/H2 extended the dynamic range but compromised the detection limit, while 700 nM H1/H2 colorimetric detection system owned the widest linear range but the lowest sensitivity. Thus, by varying the concentration of hairpin auxiliary probes in SPSC buffer, the detection range could be tuned. Meanwhile, the color change corresponding to target DNA could also be accordingly tuned and it should be useful for visual determination. In the designed colorimetric detection systems, to tune the detection range needs only the regulation of addition amount of hairpin oligonucleotides while other assay procedures are same. The amount of H1/H2 can be used as a parameter to tune the dynamic range and fit the assay for different detection requirements. It must be noted that, although the reduction of hairpin oligonucleotide concentrations can lead to higher sensitivities, in terms of nanoparticle-based detection system design for oligonucleotides, particle sedimentation must be taken into account. In addition, we also studied the effect of response time, the addition amount of NaCl and the concentration of AuNPs. According to the results, the optimum reaction condition was carefully chosen in subsequential experiments (see Supporting Information, Figure S1-S3).


10

Page 11 of 26

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


To further characterize the detection range of this assay, a series of samples containing different concentrations of target DNA have been tested. The photo of AuNP colloid, after the addition of target DNA with concentrations ranging from 0 to 6.0 nM, were plotted in Figure 4A. The color of the AuNP colloid is gradually changed from pale purple to blue as the increasing amount of added target DNA. We then studied the system at length by using UV/vis spectroscopy. As shown in Figure 4B, there was only one peak located at 522 nm in absence of target DNA. Along with the increasing of the DNA concentration, a new, broad absorption (550-750 nm) appeared and its coefficient correspondingly increased, while the absorbance at 522 nm gradually shifted and decreased. Accordingly, the absorbance peak ratio at 642 nm and 522 nm was employed to quantitatively scale the DNA concentration. We found a linear dependence of the A642/A522 ratio on the DNA quantity in the range of 0-0.5 nM (Figure 4C). A detection limit of 50 pM (S/N = 3) for instrument detection and 100 pM for naked eyes detection was achieved, which is about 2 order of magnitude lower than that of conventional AuNPbased colorimetric biosensing.18 To validate the sequence-specificity of the detection system, we prepared several different target DNA strands (5 nM) as matched, mismatched, deleted, and inserted targets. We found that mismatched DNA is difficult to initialize the HCR and induce aggregation of AuNPs. Only the matched DNA triggered the reaction obviously, as confirmed by the formation of particle aggregates (Figure 5). The method still showed good specificity at lower concentrations (Figure S4 in Supporting Information). The sequencespecificity of the DNA assay is attributed to the requirement of full complementarity between the trigger DNA and substrate hairpin H1 in the HCR system. Thus, the AuNP colorimetric DNA detection is highly selective for completely complementary DNA. This sensing scheme is able to detect other DNA sequences with careful design of the corresponding hairpin auxiliary probes. The successful detection of DNA sequence specific to Escherichia coli uropathogen with hairpin probe H3/H4 and naked AuNPs was also demonstrated using the same sensor scheme (see the results and discussion in the Supporting Information, Figure S6). The visible color


11


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 12 of 26

change of AuNPs colloids were observed in the absence or presence of target DNA. Results also showed the versatility of the DNA detection that combines AuNP colorimetric with DNA hybridization chain reaction (HCR) amplification.


12

Page 13 of 26

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


CONCLUSIONS In conclusion, we have demonstrated a label-free, homogeneous, and high sensitive colorimetric DNA detection that combines AuNP colorimetric with DNA hybridization chain reaction (HCR) amplification. In addition to the conventional merits of AuNP colorimetric, this detection system also offered several advantages in that (1) this method avoided enzyme introduction, protocol was simple and easy, (2) it offered ultrahigh detection sensitivity and provided a colorimetric detection limit of 50 pM for instrument detection and 100 pM for naked eye detection, and (3) it exhibited a high degree of discrimination between perfectly matched target oligonucleotides and targets with single base-pair mismatches. Moreover, the ability to achieve colorimetric DNA detection in the picomolar range in a relatively quick (60 min) time frame without the need of expensive equipment is a nice addition to the field. Altogether, our approach is convenient, requiring only the mixing of several solutions at room temperature to achieve rapid, semiquantitative detection via visual inspection or quantitative detection via visible light absorbance spectroscopy. It holds promising potential for broad applications in biodetection of diseases, biochemical and biomedical study, environmental monitoring, as well as in clinic applications.


13


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 14 of 26

ASSOCIATED CONTENT Supporting Information Additional information as noted in text. This material is available free of charge via the Internet at http://pubs.acs.org. AUTHOR INFORMATION Corresponding Author *Phone: +86-731-88821566. Fax: +86-731-88821566. E-mail: [email protected]. Pei Liu and Xiaohai Yang contributed equally to this work. Notes The authors declare no competing financial interest. ACKNOWLEDGMENT This work was supported by National Natural Science Foundation of China (21190044, 21175035), National Basic Research Program (2011CB911002), International Science & Technology operation Program of China (2010DFB30300), Program for New Century Excellent Talents in University (NCET09-0338), and Hunan Provincial Natural Science Foundation of China (10JJ7002, 13JJ4032). We thank Dr. Zhiwen Tang for his helpful discussion and suggestions.


14

Page 15 of 26

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


REFERENCES (1) Lubin, A. A.; Plaxco, K. W. Acc. Chem. Res. 2010, 43, 496−505. (2) Li, D.; Song, S.; Fan, C. Acc. Chem. Res. 2010, 43, 631−641. (3) Fan, C.; Plaxco, K. W.; Heeger, A. J. Proc. Natl. Acad. Sci. USA 2003, 100, 9134−9137. (4) Wang, F.; Elbaz, J.; Orbach, R.; Magen, N.; Willner, I. J. Am. Chem. Soc. 2011, 133, 17149−17151. (5) Lu, C. H.; Yang, H. H.; Zhu, C. L; Chen, X.; Chen, G. N. Angew. Chem. Int. Ed. 2009, 48, 4785−4787. (6) Ho, H. A.; Najari, A.; Leclerc, M. Acc. Chem. Res. 2008, 41, 168−178. (7) Duan, X.; Liu, L.; Feng, F.; Wang, S. Acc. Chem. Res. 2009, 43, 260−270. (8) Iliuk, A. B.; Hu, L.; Tao, W. A. Anal. Chem. 2011, 83, 4440−4452. (9) Drummond, T. G.; Hill, M. G.; Barton, J. K. Nat. Biotechnol. 2003, 21, 1192−1199. (10) Wang, J.; Liu, G.; Merkoçi, A. J. Am. Chem. Soc. 2003, 125, 3214−3215. (11) Fojta, M.; Havran, L.; Vojtiskova, M.; Palecek, E. J. Am. Chem. Soc. 2004, 126, 6532−6533. (12) Li, D.; Yan, Y.; Wieckowska, A.; Willner, I. Chem. Commun. 2007, 3544−3546. (13) Weizmann, Y.; Patolsky, F.; Willner, I. Analyst 2001, 126, 1502−1504. (14) Lucarelli, F.; Tombelli, S.; Minunni, M.; Marrazza, G.; Mascini, M. Anal. Chim. Acta 2008, 609, 139−159. (15) (a) Li, H.; Rothberg, L. J. Am. Chem. Soc. 2004, 126, 10958−10961. (b) Li, H.; Rothberg, L. Proc. Natl. Acad. Sci. USA 2004, 101, 14036−14039. (c) Li, H.; Rothberg, L. Anal. Chem. 2005, 77, ACS Paragon Plus Environment

15


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 16 of 26

6229−6233. (16) Zhang, J.; Wang, L.; Pan, D.; Song, S.; Boey; F. Y. C., H. Zhang,; Fan, C. Small 2008, 4, 1196– 1200. (17) Kanjanawarut, R.; Su, X. Anal. Chem. 2009, 81, 6122–6129. (18) Rosi, N. L.; Mirkin, C. A. Chem. Rev. 2005, 105, 1547−1562. (19) Liu, J.; Cao, Z.; Lu, Y. Chem. Rev. 2009, 109, 1948−1998. (20) Zhao, W.; Brook, M. A.; Li, Y. ChemBioChem 2008, 9, 2363−2371. (21) Song, Y.; Wei, W.; Qu, X. Adv. Mater. 2011, 23, 4215−4236. (22) Sassolas, A.; Leca-Bouvier, B. D.; Blum, L. J. Chem. Rev. 2008, 108, 109−139. (23) Saha, K.; Agasti, S. S.; Kim, C.; Li, X.; Rotello, V. M.; Chem. Rev. 2012, 112, 2739−2779. (24) Deng, H.; Zhang, X.; Kumar, A.; Zou, G.; Liang, X. Chem. Commun. 2013, 49, 51−53. (25) Elghanian, R.; Storhoff, J. J.; Mucic, R. C.; Letsinger, R. L.; Mirkin, C. A. Science 1997, 277, 1078−1081. (26) Tan, E.; Wong, J.; Nguyen, D.; Zhang, Y.; Erwin, B.; Van Ness, L. K.; Baker, S. M.; Galas, D. J.; Niemz, A. Anal. Chem. 2005, 77, 7984−7992. (27) Zhao, J.; Liu, T.; Fan, Q.; Li, G. Chem. Commun. 2011, 47, 5262−5264. (28) Xu, W.; Xue, X.; Li, T.; Zeng, H.; Liu, X. Angew. Chem. Int. Ed. 2009, 48, 6849−6852. (29) Xu, W.; Xie, X.; Li, D.; Yang, Z.; Li, T.; Liu, X. Small 2012, 8, 1846–1850. (30) Cui, L.; Ke, G.; Zhang, W.; Yang, C. Biosens. Bioelectron. 2011, 26, 2796–2800.


16

Page 17 of 26

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(31) Li, J.; Fu, H.; Wu, L.; Zheng, A.; Chen, G.; Yang, H. Anal. Chem. 2012, 84, 5309−5315. (32) Dirks, R. M.; Pierce, N. A. Proc. Natl. Acad. Sci. USA 2004, 101, 15275−15278. (33) Venkataraman, S.; Dirks, R. M.; Rothemund, P. W. K.; Winfree, E.; Pierce, N. A. Nat. Nanotechnol. 2007, 2, 490−494. (34) Yin, P.; Choi, H. M. T.; Calvert, C. R.; Pierce, N. A. Nature 2008, 451, 318−322. (35) Huang, J.; Wu, Y.; Chen, Y.; Zhu, Z.; Yang, X.; Yang, C. J.; Wang, K.; Tan, W. Angew. Chem. Int. Ed. 2011, 50, 401−404. (36) Shimron, S.; Wang, F.; Orbach, R.; Willner, I. Anal. Chem. 2012, 84, 1042−1048. (37) Chen, Y.; Xu, J.; Su, J.; Xiang, Y.; Yuan, R.; Chai, Y. Anal. Chem. 2012, 84, 7750−7755. (38) Choi, H. M. T.; Chang, J. Y.; Trinh, L. A.; Padilla, J. E.; Fraser, S. E.; Pierce, N. A. Nat. Biotechnol. 2010, 28, 1208-1212. (39) Ma, C. P.; Wang, W. S.; Li, Z. X.; Cao, L. J.; Wang, Q. Y. Anal. Biochem. 2012, 429, 99−102.


17


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 18 of 26

I'

target I

II H1

II

II'

I'

Step 2 Step 3

H2

Step 3 Step 2

no target

Salt

Salt

Scheme 1. Schematic of high sensitive colorimetric detection of DNA by using gold nanoparticles and hybridization chain reaction amplification.


18

Page 19 of 26

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Table 1. Sequences used in AuNP colorimetric DNA detection Name

Sequence (5'- 3')

H1

TTAACCCACGCCGAATCCTAGACTCAAAGTAGTCTAGGATTCGGCGTG

H2

AGTCTAGGATTCGGCGTGGGTTAACACGCCGAATCCTAGACTACTTTG

H2a* Target DNA

AGTCTAGGATTCGGCGTGGGTTAACACGCCGAATCCTAGACT AGTCTAGGATTCGGCGTGGGTTAA

*The design of the hairpin probes was adapted from the literature (33). In the hairpin sequences, sticky ends are underlined. The H2a was the remnant of H2 on which the exposed sticky end was cut.


19


(A) 0.7

522 nm

642 nm

0 nM

5 nM

0.6

Absorbance

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 20 of 26

0.5 0.4 0.3 0.2

0 nM Target DNA 5 nM Target DNA

0.1 0.0 300

400

500

600

700

800

900

Wavelength (nm) (B)

(C)

0 nM 0.5 nM 5 nM Ladder

20000 5000

1500

0 nM

500

5 nM Figure 1. (A) UV/vis absorption spectra of H1/H2/AuNPs colorimetric detection system in the absence target DNA and in the presence of 5 nM target DNA. Inset: photographs. (B) The gel electrophoresis images for different concentration of target DNA. From left to right, lanes: (1) 100 nM H1+ 100 nM H2; (2) 100 nM H1+ 100 nM H2+ 0.5 nM target DNA; (3) 100 nM H1+ 100 nM H2 + 5 nM target DNA; (4) DNA ladder. (C) TEM images of H1/H2/AuNPs colorimetric detection system in the absence of target DNA and in the presence of 5 nM target DNA. Scale bar: 50nm.


20

Page 21 of 26

1.4 1.2

1

2

3

4

5

6

1.0 A522/642 A642/A522

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


0.8 0.6 0.4 0.2 0.0 1

2

3

4

5

6

Figure 2. Absorbance ratio (A642/A522) and photograph (inset) showing colorimetric responses of AuNPs solution after addition various oligonucleotides: (1) blank, ultrapure water without salt; (2) H1 with salt; (3) H2 with salt; (4) H1 + H2 with salt; (5) H2a with salt; (6) nicked double-helix with salt (error bars were deduced from N=3 experiments).


21


1.2

1.0 A642/A522

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 22 of 26

0.8

0.6 100 nM H1+H2 200 nM H1+H2 300 nM H1+H2 500 nM H1+H2 700 nM H1+H2

0.4

0.2 0

10

20

30

40

50

60

Concentration of target DNA (nM) Figure 3. The influence of different concentrations of hairpin auxiliary probes H1 and H2 on AuNPs color response.


22

Page 23 of 26

A)

0

0.05

0.10

0.20

0.30 0.50 1.0 Concentration of target DNA

2.0

4.0

6.0 nM

B)

0.7

0.6

0 nM

0.5

6 nM Absorbance

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


6 nM

0.4

0.3

0.2

0.1

0 nM 0.0 300

400

500

600

700

800

900

Wavelength (nm)


23


C) 1.1 1.0 0.9

0.8 A642/A522

A642/A522

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 24 of 26

0.8 0.7

0.7

0.6

0.6

0.0

0.2

0.4

0.6

Concentration of target DNA (nM)

0.5 0

1

2

3

4

5

6

7

Concentration of target DNA (nM)

Figure 4. A) Photograph showing colorimetric responses of detection system in the presence of various concentrations of target DNA. From left to right are 0, 0.05, 0.10, 0.20, 0.30, 0.50, 1.0, 2.0, 4.0, 6.0 nM target DNA. B) UV/vis absorption spectra for AuNP-based detection of DNA. C) Plot of DNA concentration vs. absorbance ratio (A642/A522) for the target DNA assay. Inset is the calibration curve for concentrations ranging from 0.05 to 0.50 nM.


24

Page 25 of 26

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


1

2

3

4

Mismatched target

Deleted target

Inserted target

Matched target

Mismatched target Deleted target Inserted target Matched target

5'- AGTCTAGGATTCAGCGTGGGTTAA- 3' 5'- AGTCTAGGATTC GCGTGGGTTAA- 3' 5'- AGTCTAGGATTCTGGCGTGGGTTAA- 3' 5'- AGTCTAGGATTCGGCGTGGGTTAA- 3'

Figure 5. Photographs showing colorimetric detection of various target DNA strands. The matched, mismatched, deleted and inserted bases are highlighted in blue, red, underline and italic, respectively.


25


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 26 of 26

For TOC only


26

Enzyme-Free Colorimetric Detection of DNA by Using Gold

Recommend Documents