Enzyme-Mediated Conversion of Flavin Adenine Dinucleotide (FAD

Subscriber access provided by University of Newcastle, Australia

Article

Enzyme Mediated Conversion of FAD to 8-formyl FAD in Formate Oxidase Results in Modified Cofactor with Enhanced Catalytic Properties John M. Robbins, Michael G Souffrant, Donald Hamelberg, Giovanni Gadda, and Andreas S Bommarius Biochemistry, Just Accepted Manuscript • DOI: 10.1021/acs.biochem.7b00335 • Publication Date (Web): 22 Jun 2017 Downloaded from http://pubs.acs.org on June 26, 2017

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

Biochemistry is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 37

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Submitted to Biochemistry

Enzyme Mediated Conversion of FAD to 8-formyl FAD in Formate Oxidase Results in Modified Cofactor with Enhanced Catalytic Properties

†This work was supported in part by NSF MCB-1517617 (D.H.), NSF CHE-1506518 (G.G.), and a U.S. Department of Education Graduate Assistance in Areas of National Need (GAANN) Grant (M.G.S.). M.G.S. is a Georgia State University Bio-Bus Fellow.

John M. Robbins a,b, Michael G. Souffrant c,d,e, Donald Hamelberg c,d,e, Giovanni Gadda c,d,f,g,*, and Andreas S. Bommarius a,b,h,* a

School of Chemical and Biomolecular Engineering, Georgia Institute of Technology, Atlanta, GA 30332-0100, United States b Engineered Biosystems Building (EBB), Georgia Institute of Technology, Atlanta, GA 303322000, United States c Department of Chemistry, Georgia State University, Atlanta, Georgia 30302-3965, United States d Center for Diagnostics and Therapeutics, Georgia State University, Atlanta, Georgia 303023965, United States e Molecular Basis of Disease Program, Georgia State University, Atlanta, Georgia 30303 f Center for Biotechnology and Drug Design, Georgia State University, Atlanta, Georgia 303023965, United States g Department of Biology, Georgia State University, Atlanta, Georgia 30302-3965, United States h School of Chemistry and Biochemistry, Georgia Institute of Technology, Atlanta, GA 303320100, United States *

To whom correspondence should be addressed. Andreas S. Bommarius Phone: (404) 385-1334. Fax: (404) 385-4637. Email: [email protected]; Giovanni Gadda Phone: (404) 413-5537. Fax: (404) 413-5505. Email: [email protected].

Running Title: Enzyme Mediated 8-formyl FAD Formation 1 ACS Paragon Plus Environment

Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

1

Page 2 of 37

Abbreviations: FOX, formate oxidase; FAD, flavin adenine dinucleotide; 8-fFAD, 8-formyl

flavin adenine dinucleotide, FMN, flavin mononucleotide; 8-fFMN, 8-formyl flavin mononucleotide; LOX, lactate oxidase; GMC, glucose-methanol-choline.

2 ACS Paragon Plus Environment

Page 3 of 37

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Abstract Flavins, including flavin adenine dinucleotide (FAD), are fundamental catalytic cofactors responsible for the redox functionality of a diverse set of proteins. Alternatively, modified flavin analogues are rarely found in nature as their incorporation typically results in inactivation of flavoproteins, thus leading to the disruption of important cellular pathways. Here, we report that the fungal flavoenzyme formate oxidase (FOX) catalyzes the slow conversion of non-covalently bound FAD to 8-formyl FAD (8-fFAD), and that this conversion results in a nearly 10-fold increase in formate oxidase activity. Although the presence of an enzyme bound 8-formyl FMN has been reported previously as a result of site-directed mutagenesis studies on lactate oxidase (LOX), FOX is the first reported case of 8-formyl FAD presence in a wild-type enzyme. Therefore, the formation of the 8-formyl FAD cofactor in formate oxidase was investigated using steady-state kinetics, site-directed mutagenesis, UV-visible, circular dichroism, and fluorescence spectroscopy, LCMS, and computational analysis. Surprisingly, the results from these studies not only indicate that 8-formyl FAD forms spontaneously and results in the active form of FOX, but that its autocatalytic formation is dependent on a nearby arginine residue, R87. Thus, this work describes a new enzyme cofactor and provides insight into the little understood mechanism of enzyme mediated 8α-flavin modifications.


Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 4 of 37

Introduction Since the elucidation of their structures in the 1930s, biologically relevant flavins have been accepted as occurring primarily in two forms, flavin mononucleotide (FMN) and flavin adenine dinucleotide (FAD), with riboflavin (vitamin B2) as their integral precursor.1 Until recently, nearly all flavoproteins had been shown to depend on at least one of these two flavin forms for their function, although a covalent linkage between FAD or FMN and the protein has been observed in 5-10% of flavoproteins.2 The only other reported instances of an active flavoprotein dependent on a modified, non-covalently bound flavin cofactor are in methanol oxidase (arabinoflavin), Coenzyme F420 (8-hydroxy-5-deazaflavin), and the ubiquinone (coenzyme Q) biosynthetic pathway, in which a prenylated FMN is required to catalyze the reversible decarboxylation of an aromatic substrate.3–8 In all these instances, the modified flavins demonstrate different catalytic properties. Therefore, the presence of an apparent 8-formyl FAD (8-fFAD) in the wild-type form of the recently discovered formate oxidase (FOX; E.C. 1.2.3.1) is of interest, as it establishes the existence of a novel flavin cofactor with different catalytic properties compared to typical FAD and other active flavin analogues. 9–11 Although flavin analogues have been found in nature previously, there are only a few examples where such non-covalently bound analogues result in active enzymes.3–8 Typically, these modified flavins yield inactive complexes or complexes with reduced activity upon incorporation into a flavoprotein.6,12,13 In this regard, roseoflavin has been studied as a natural antibacterial compound because it acts as a competitive inhibitor for flavoenzymes.14 In contrast, flavoproteins whose flavin cofactor is covalently linked through the C6 or C8α position through an amino acid group found on the protein are typically active.15 Found predominantly in oxidases, these covalently linked flavins are often important to enzyme function, but do not


Page 5 of 37

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

inherently qualify as independent cofactors as they maintain their identity as either FMN or FAD. Therefore, the discovery of a non-covalently linked flavin analogue capable of serving as an active cofactor challenges our current understanding of known cofactors. The existence of 8-formyl flavin itself is not new: chemical synthesis and subsequent spectral characterization were performed in the early 1970s with the intent to better understand the chemistry of the flavin molecule, as well as its use as a mechanistic probe for various flavoenzyme reactions.16 Prior to the discovery of FOX, only two other examples of an 8-formyl flavin spontaneously occurring within an enzyme had been reported. The first was a mammalian electron transferring flavoprotein, which was identified later through its absorption spectrum and deemed subsequently to be an inactive form of the enzyme.17 Later, an enzyme-bound 8-formyl FMN (8-fFMN) formed as a result of site-directed mutational studies on lactate oxidase (LOX).18 The formation of this 8-fFMN in LOX was shown to result in complete inactivation of the enzyme, therefore dismissing it as an alternative cofactor. FOX was the first reported case of 8fFAD identified in a wild-type enzyme.9–11 Given the negative effects such flavin analogues typically have on catalytic activity, it was proposed that the 8-fFAD identified in FOX by both the crystal structure and previous characterization studies was likely an artifact.9–11 In this study, both the formation and role of the 8-fFAD cofactor in FOX were investigated through the use of steady-state kinetics, site-directed mutagenesis, UV-visible, circular dichroism, and fluorescence spectroscopy, and LCMS. Surprisingly, the results presented herein indicate that 8-fFAD is present in the active form of FOX and that its autocatalytic formation is required for increased activity of the enzyme. As a result, formate oxidase serves as the first wild-type enzyme reported to have an 8-fFAD serving as an active cofactor.


Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 6 of 37

Materials and Methods Materials. Sodium chloride, potassium phosphate (monobasic and dibasic), and ammonium

sulfate

were

purchased

from

BDH/VWR

(West

Chester,

PA).

Ethylenediaminetetraacetic acid (EDTA), citric acid, glucose, glucose oxidase, sodium formated, sodium citrate, and lysozyme were purchased from Sigma (St. Louis, MO). Isopropyl-β-Dthiogalactoside (IPTG) and ampicillin were purchased from Gold Biotechnology (St. Louis, MO). Glycerol was obtained from Fisher Biotech (Pittsburgh, PA). Sodium acetate was purchased from Amresco (Solon, OH). Luria-Bertani (LB) broth was purchased from U.S. Biological (Swampscott, MA). Acetic acid was purchased from EMD Chemicals (Gibbstown, N.J.) Coomassie Protein Assay Reagent, bovine serum albumin standard, and HisPurTM Ni-NTA resin were purchased from Thermo Scientific (Rockford, IL). PD10 desalting columns were purchased from Amersham Biosciences AB (Uppsala, Sweden). Cloning, Expression, and purification of His-Tagged FOX. The synthesized cDNA sequence for FOX from A. oryzae RIB40 was purchased from GeneArt® (Life Technologies, Grand Island, NY). The full sequence of the purchased gene is available in the Supporting Information. The synthesized gene, which included optimized codon usage for expression in Escherichia coli, was inserted into the NdeI-NotI restriction sites of the pET21c(+) expression vector (EMD Bioscience, Darmstadt, Germany). E. coli Novablue cells (EMD Bioscience) were then transformed with the plasmid harboring the cloned gene for FOXAO. After isolating the intact plasmid DNA from the E. coli Novablue and sequencing to verify the presence of the recombinant FOXAO gene, E. coli BL21 (DE3) expression host strain (EMD Bioscience) was transformed with pET21-FOXAO. Expression and purification of His-tagged FOXAO was then


Page 7 of 37

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

performed as previously described10 with the following modifications: harvested cells were suspended in 25 mM phosphate buffer, pH 7.5, supplemented with 20 mM Imidazole, 100 mM NaCl, and 10% glycerol prior to sonication. The supernatant obtained after sonication and centrifugation to separate cellular debris was then applied unto a column of HisPurTM Ni-NTA resin equilibrated with the suspension buffer described above before being washed, eluted, and immediately loaded onto a PD-10 desalting column prepared to exchange desalted enzyme sample into LCMS grade H2O. In total, the amount of time elapsed from initiation of the sonication step to collection of the final drop eluted from the PD-10 column was approximately 50 min. After eluting from the PD10 column, the sample concentration was confirmed by UVvisible absorption spectroscopy (see details below) and diluted to a working concentration of 15 μM of flavin-bound FOX. Samples of the working enzyme solution were immediately aliquoted and either used to initiate spectroscopic and/or FOX activity studies (see details below) or stored on ice until needed. All steps were performed in the absence of light and either at 4 °C in a cold room or on ice. Construction of variant proteins. A recombinant pET21 plasmid containing the FOXAO gene was used to construct R87A FOX and R87K FOX enzymes. Forward and reverse primers for each variant were designed as 33-base oligonucleotides containing the desired mutation. For R87A

FOX,

forward

and

reverse

primers

GAAAAACCGAATACCCGCGGTAAAACCCTGGGT

with

the

sequences and

ACCCAGGGTTTTACCGCGGGTATTCGGTTTTTC, respectively. For R87K FOX, forward and reverse primers with the sequences GAAAAACCGAATACCCAAAGTAAAACCCTGGGT and ACCCAGGGTTTTACTTTGGGTATTCGGTTTTTC, respectively. The CGT codon encoding for R87 in the primers was replaced with GCG (R87A) or AAA (R87K). All mutations


Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 8 of 37

were produced using the QuickChangeTM site-directed mutagenesis kit (Agilent Technologies, Santa Clara, CA). The variant constructs were confirmed by DNA sequencing analysis at MWG Operon (Huntsville, AL). Confirmed variants were transformed into E. coli BL21(DE3) competent cells for protein expression and stored at –80 ˚C. Each FOX variant protein was purified as stated above. Determination of FOX concentrations. The total protein concentration of the purified FOX enzyme stock was determined by Bradford assay using Coomassie Protein Assay Reagent with bovine serum albumin as the standard.19 The molar ratio of 8-fFAD to FOX was determined by extracting 8-fFAD from FOX through heat denaturation at 100°C for 10 min, centrifuging the protein precipitate, and estimating the total 8-fFAD concentration of the lysate using the molar extinction coefficient of 9,000 M-1 cm-1 at 450 nm as previously described.16,20 From these measurements, the molar extinction coefficient of active, flavin bound FOX was determined to be 10,200 M-1 cm-1 at 472 nm.21 Spectroscopic studies. For all spectroscopic studies, enzymes were prepared fresh as described above with time point t = 0 referring to the start of sonication in the purification procedure. Purified WT FOX and R87K FOX samples were diluted to a concentration of 15 μM flavin-bound enzyme using pure LCMS grade water and the UV-visible absorption spectrum was recorded at t = 1, 2, 3, 4, 5, 6, 7, 8, 22, and 48 h at 25 °C. At each of these time points, 200 μL of sample was boiled at 100 °C in the dark for 10 minutes. After centrifuging the boiled sample for 15 min at 14000 g to remove denatured protein, the supernatant was loaded onto an Agilent 1200 series capillary HPLC equipped with 5 µM 150 X 0.5 mm ZORBAX SB-C18 column and an Agilent 6320 ion trap LC/MS. The resulting flow-through was monitored for 8 minutes by ESI in negative ion mode with a 5% methanol, 95% H2O solution serving as the mobile phase. For


Page 9 of 37

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

fluorescence, WT FOX and R87K FOX samples were diluted to a concentration of either 1 μM enzyme or 10 μM flavin-bound enzyme in 10 mM potassium phosphate buffer, pH 7.5 and 25 °C. All fluorescence spectra were determined using a 1 cm path-length quartz cuvette and an Agilent Cary Eclipse Fluorescence Spectrometer at the slowest scanning rate. For Circular Dichroism, WT FOX and R87K FOX samples were diluted to a concentration of either 1 μM enzyme, 23 μM enzyme, or 23 μM flavin-bound enzyme in 10 mM potassium phosphate buffer, pH 7.5 and 25 °C. Spectra were recorded on a Jasco J-810 Spectropolarimeter (Easton, MD). Measurements were taken using a 0.1 cm path-length cuvette with a bandwidth of 1 nm and a scanning speed of 50 nm/min. Each spectrum is the average of five scans. FOX activity assays. FOX activity assays were conducted using a Hansatech Oxygraph equipped with a DW1 electrode chamber and an S1 electrode to determine the initial rate of O2 consumption in solutions employing 0.2 μM flavin-bound FOX, dissolved atmospheric oxygen (i.e., 0.250 mM), and sodium formate (100 mM) in 50 mM acetate, pH 3.6. For pH-dependence experiments, purified FOX was incubated on ice in either pure LCMS grade water, 50 mM acetate (pH 3.5—5.0), potassium phosphate (pH 6.0—8.0), or 50 mM glycine-NaOH (pH 9.010.0) for 1, 2, 3, 4, 5, 6, 7, 8, 22, or 48 h prior to the initiation of the formate oxidase reaction. As a control, wild-type FOX enzyme was incubated in potassium phosphate, pH 7.5 and at 4 °C, for at least 48 h in order to become fully loaded with 8-fFAD. Once formed, 8-fFAD bound FOX was determined to remain active over the entire experimental pH range, as full activity was restored when FOX that had been preincubated at specific experimental pH values for an additional 48 h was introduced into an activity assay at pH 3.6. All assays were performed at 25 °C and in triplicate.


Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 10 of 37

Computational Analysis. All of the molecular dynamic simulations and Gibbs free energy calculations were carried out using the Amber14 suite of programs,22 as described in the Supporting Information. The initial Cartesian coordinates of the system were obtained from a 2.24 Å X-ray crystal structure of Aspergillus oryzae RIB40 with PDB identification no. 3Q9T,9 using the AMBER ff14SB modified version of the Cornell et al. force field parameters.23,24 Each system was solvated in a periodic octahedron box with explicit TIP3P water models,25 in which case, the edges of the box were at least 10 Å away from the system. The protein system was neutralized using sodium counter ions to attain electrostatic neutrality. The amino acids residues of the model system were capped with N-terminal ACE and C-terminal NME groups using the Xleap module in Amber.22 Using the standard two-step RESP method26 the partial atomic charges of the deprotonated form of the titratable residues were obtained from the electrostatic potential using Gaussian03.27 The force field parameters for the FAD molecule were obtained from the GAFF AMBER force field parameters.28 Data Analysis. For time-dependent 8-fFAD formation studies, the apparent rate constant for the formation (λ) 8-fFAD from FAD was calculated by plotting either spectroscopic or formate oxidase activity data vs. time and best fit to equation 1 using KaleidaGraph software (Abelbeck Software, Reading, PA):

= exp (− ) +

Eq. 1

where t is time elapsed following the start of the sonication step in the FOX purification, A is either the absorbance value at 512 nm, the

app

kcat value, or the ratio of 8-fFAD to total flavin at

time point t, A1 is amplitude of the curve, λ is the apparent rate constant for the formation for 8-


Page 11 of 37

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

fFAD formation, and C represents either the limiting absorbance value at 512 nm, the limiting app

kcat value, or total normalized flavin concentration. For the pH-dependence of 8-fFAD formation, the apparent rate constant for the formation

(λ) 8-fFAD from FAD was plotted vs. pH, and best fit to equation 2 using KaleidaGraph software:

= ∕ 1 +

Eq. 2

where H is [H+], λ is the apparent rate constant for the formation for 8-fFAD formation, C is the pH-independent value of λ, and K1 represents the dissociation constant for a group on the free enzyme or substrate.


Biochemistry

Results Self-Catalytic Conversion of FAD to 8-fFAD. To determine whether the FOX-bound FAD could be self-catalytically converted to 8-fFAD in vitro, the UV-visible absorption spectrum of freshly purified enzyme was monitored over time (Figure 1). A difference absorption spectrum of wild-type FOX after 48 h incubation minus after 1 h incubation revealed a maximal increase in absorbance at 512 nm

∆ Absorbance

0.25

(Figure 1, inset), consistent with conversion 0.2

of FAD to 8-fFAD occurring in the enzyme active site of FOX without addition of exogenous compounds. The time-course of the absorption change at A512 was then investigated,

revealing

an

Absorbance

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 12 of 37

0.04 0.02 0 -0.02 -0.04 300 350 400 450 500 550 600

Wavelength (nm)

0.15

0.1

0.05

exponential 0

process (Figure 2) with an apparent rate

300

350

400

450

500

550

600

Wavelength (nm) constant for 8-fFAD formation of λ = 0.103 ± 0.011 h

-1

(Table 1). The A512 value

increased from 0.046 ± 0.002 to 0.087 ± 0.004 over 48 h incubation under the conditions used. The self-catalytic conversion of FAD to 8-fFAD by FOX was also investigated by

Figure 1. The time dependence of 8-fFAD formation in FOX. Following cell lysis, purified FOX was exchanged into pure LCMS grade water using a PD10 desalting column and incubated on ice over 48 h. Absorbance scans from 300-600 nm at t=1 h (red), t=3 h (orange), t=5 h (light orange), t=7 h (green), t=9 h (blue), t=22 h (purple), and 48 h (black) following cell lysis. Inset: the change in the absorption spectrum for WT FOX at t=1 h and t=48 h following cell lysis. All experiments were performed in triplicate at 4 °C.

liquid chromatography-mass spectrometry upon extraction of the flavin from the enzyme active site with heat treatment at various times of incubation. The HPLC elution profiles of the flavins extracted from FOX revealed two peaks at 2.9 min and 4.0 min (Figure 3, Panel A). The areas


Page 13 of 37

under the peaks progressively changed with

0.09 80

increasing incubation time of the enzyme.

0.08 60

2.9 min, corresponding to 8-fFAD, and 784 m/z(-) for the species eluting at 4.0 min, corresponding to FAD (Figure 3, Panels C

0.07 40

0.06

app

k

ions at 798 m/z(-) for the species eluting at

cat

-1

(s )

Mass spectrometric analysis yielded parent

20

0

0.05

0

10

± 0.024 h-1 while the peak at 4.0 min decreased correspondingly (Figure S1). The simultaneous increase and decrease in the amount of each species eluting at 2.9 min and 4.0 min, respectively, was consistent with full conversion of FAD to 8-fFAD within 48 h of FOX incubation under the

30

40

0.04 50

Time (hrs)

and D). The peak at 2.9 min increased over time at an apparent rate constant of λ = 0.106

20

Absorbance @ 512 nm

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Figure 2. Formate oxidase activity (appkcat values) of WT FOX (black circles) and the absorbance of WT FOX at 512 nm (orange circles) as a function of time following cell lysis. The best fit of appkcat and A512 data to Eq. 1 is represented by the solid black line and the broken orange line, respectively. Reactions measuring formate oxidase activity were initiated by the addition of WT FOX (0.2 µM) into a reaction mixture containing dissolved oxygen (0.250 mM), sodium formate (100 mM), and 50 mM acetate (pH 3.6) at 25 °C. All experiments were performed in triplicate, and error bars (fully encompassed within the respective data point) represent SD.

condition used (Table S1). As illustrated in Figure 2, the

app

kcat value determined at atmospheric oxygen (i.e., 0.25

mM) for wild-type FOX increased from 11 ± 2 s-1 to 82 ± 2 s-1 over 48 h incubation of the enzyme, suggesting that the enzyme containing 8-fFAD was more active in the oxidation of formate than that with FAD. The data were fit well with a single exponential process, yielding an apparent first-order rate constant for the increase of enzymatic activity in FOX of λ = 0.097 ± 0.006 h-1. This value matched reasonably well the rate constant for conversion of FAD to 8-


Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 14 of 37

fFAD in the active site of the enzyme as determined spectrophotometrically, i.e., λ = 0.103 ±

Figure 3. Panel A: HPLC chromatographs of cofactor extracted from WT FOX as a function of time. Panel B: HPLC chromatographs of cofactor extracted from R87K FOX as a function of time. Panel C: mass spectrum of species eluted from HPLC around 4 min corresponding to standard FAD. Panel D: mass spectrum of species eluted from HPLC around 3 min corresponding to 8-fFAD. All experiments were performed in triplicate.


Page 15 of 37

0.011 h-1 (see above). Thus, FOX activity increased as the enzyme-bound FAD converted to 8fFAD. pH Effect on 8-fFAD Formation. To gain insight into catalytically relevant ionizable groups governing the conversion of FAD to 8-fFAD within the FOX active site, the apparent rate constant for the change in

app

kcat associated with the conversion of FAD to 8-fFAD was

determined in the pH range from pH 3.5 to 10.0. As shown in Figure 4, the λ value increased with increasing pH, reaching a pH-independent limiting value of 0.14 ± 0.02 h-1 and an apparent

The pH value of enzymes solutions in

-1

LCMS grade water was measured and

-2

app

cat, lim

-1

] (h )

0

k

pKa value of pH 5.5 ± 0.1 for a group that must be unprotonated for FAD conversion to 8-fFAD.

log [ λ ,

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

determined to be around pH 7.5 (the -3

purification buffer pH) despite passage

-4 3

4

5

6

7

8

9

10

11

pH Figure 4. 8-fFAD apparent rate constant for the formation (λ) vs. pH. Reactions were initiated by the addition of fresh WT FOX (0.2 µM) into a reaction mixture containing dissolved oxygen (0.250 mM) and sodium formate (100 mM) at 25 °C after being incubated on ice in either 50 mM acetate (pH 3.5—5.0), potassium phosphate (pH 6.0— 8.0), or 50 mM glycine-NaOH (pH 9.010.0). Each point is the average of at least three separate experiments, and error bars represent SD. The solid line is the best fit of data to Eq. 2

through a PD-10 column to exchange the enzyme into pure LCMS grade water. Therefore,

pure

“LCMS

grade

water

solutions” were determined to have trace amounts

of

buffering

salts

present

(potassium phosphate, pH 7.5), enough to maintain a pH value around 7.5.

Dependence of Conversion of FAD to 8-fFAD on R87. As a first step toward the elucidation of the mechanism for the formation of 8-fFAD from FAD in the active site of FOX, R87 was mutated to alanine and lysine and the properties of the resulting mutant enzymes were investigated and compared and contrasted with wild-type FOX. The residue was selected due to


Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 16 of 37

its proximity to the C8 methyl of FAD in the active site of FOX, and the hypothesis that it may act as a general base initiating the four-electron oxidation of FAD. The R87A variant did not show any detectable formate oxidase activity while the R87K variant showed an 11 ± 1 s-1, which was identical to the

app

app

kcat value of

kcat value of the wild-type enzyme with FAD bound

(Table 1). However, and in contrast to the wild-type enzyme, the R87A and R87K variants of FOX contained only FAD, as indicated by the presence of only the species eluting at 4.0 min in the LCMS chromatogram (Figure 3, Panel B). Moreover, FAD bound to the R87K enzyme did not convert to 8-fFAD upon prolonged incubation of FOX, as indicated by the LCMS analysis of the extracted flavin over 48 h incubation of the enzyme (Figure 3, Panel B). Since the reaction mechanism governing formate oxidation is independent of that governing the formation of 8fFAD formation, R87A FOX was not investigated further for this study as any structural data obtained would serve primarily to clarify the role of R87 in the formate oxidation reaction but not necessarily 8-fFAD formation. CD and fluorescence spectroscopy were used to further investigate whether the overall fold and local environment of FOX around the flavin were perturbed due to the replacement of R87 with lysine. As shown in Figure S2, Panel A, the farUV circular dichroic spectra for the wild-type and R87K FOX were practically identical, indicating no perturbations in secondary structure of the enzyme due to replacement of R87 with lysine. Small but notable differences were observed in the 265-290 nm region of the near-UV dichroic spectrum of the enzyme (Figure S2, Panel B), protein fluorescence with emission at 328 nm upon excitation at 280 nm as compared to wild-type FOX (Figure S2, Panel D), and the visible circular dichroic spectra of the enzyme-bound flavin (Figure S3). Taken together, the kinetic, spectroscopic, and chromatographic data are consistent with the R87K enzyme having


Page 17 of 37

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

lost the ability to convert FAD to 8-fFAD, while still maintaining the fold and the enzymatic activity of the wild-type form of FOX. Computational Analysis. To determine whether R87 was contributing the pKa value at pH 5.5 ± 0.1 shown to be governing the FOX mediated conversion of FAD to 8-fFAD (Figure 4), molecular dynamics was performed. Molecular dynamic simulations demonstrated that deprotonation of HH21 (Figure S4) and HH11 (Figure S5) protons at the eta position on the guanidinium group of R87 within the FOX-FAD complex yielded an average Gibbs free energy of -76 kcal/mol and -73 kcal/mol, respectively. Since such quantities were lower in magnitude when compared to the average Gibbs free energy value of -90 kcal/mol for the residues of formate oxidase in water (model system) as opposed to in the environmental compartment of the protein, the ∆pKa,shift’s were assessed to have positive values of ~10 and ~12 for HH21 and HH11, respectively (Table S2). These positive values indicated favorability towards protonation. Deprotonation of the proton at the epsilon position on the guanidinium group of R87 generated an average Gibbs free energy of -127 kcal/mol in the formate oxidase-FAD complex (Figure S6). This resulted into a lower magnitude than the average Gibbs free energy value of -145 kcal/mol for the model system. Thus, the ∆pKa,shift of the epsilon proton of R87 was a positive value of ~14, indicating a favorability towards protonation (Table S2). Deprotonation of the proton on the hydroxyl group of S94 within the formate oxidase-FAD complex produced a positive average Gibbs free energy of 32 kcal/mol (Figure S7). Since the model system had a negative average Gibbs free energy of -8 kcal/mol, the pKa,shift was generated to be ~29, showing a high favorability towards being protonated (Table S2). These results indicate that neither R87 nor S94 directly contribute to the pKa value seen with a value of 5.5 ± 0.1.


Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 18 of 37

Discussion The spontaneous formation of 8-fFAD within the active site of a wild-type enzyme adds to the growing list of active flavin cofactors that are not FAD or FMN; by demonstrating that FOX utilizes 8-fFAD as an active cofactor, this study unequivocally establishes a new class of holoenzyme-mediated modified cofactor evolved by nature, as all reported FOX enzymes have been shown to possess an 8-fFAD in their respective active sites. Both UV-visible absorption and LCMS analyses support that the 8-fFAD forms slowly in wild-type FOX purified to high levels with an approximate λ of 0.08 h-1 (Table 1). The ability to detect this slow apparent rate constant of conversion in vitro is likely an artifact that is due to the enzyme being expressed recombinantly in E. coli as opposed to in its native A. oryzae which encompasses eukaryotic compartmentalization of cellular environments. In E. coli, the overexpressed FOX is contained in the predominantly reducing environment of the cytoplasm; lysis of the cell is required to oxidize the bound FAD cofactor and permit conversion to 8-fFAD (Scheme 1, III). Interestingly, concurrent

analysis

of

FOX

activity

demonstrates that formate oxidase activity increases by nearly 10-fold as 8-fFAD is formed, thus supporting 8-fFAD, and not FAD, as the active cofactor for FOX. Additionally, the y-intercept value for the wild-type FOX

app

kcat value vs. time plot is

identical to the R87K Scheme 1. Conversion of FAD to 8-fFAD by enzyme mediated four-electron oxidation reaction

that

while

app

kcat value, confirming

FAD-loaded

FOX

possesses

formate oxidase activity, 8-fFAD loaded FOX


Page 19 of 37

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

is nearly 10-fold more active. Together, these results represent the first example of a flavoenzyme utilizing 8-fFAD as an active flavin cofactor. The catalytic formation of 8-fFAD by FOX is intriguing in that the enzyme acts as both a four-electron (unusual) oxidase in terms of FAD to 8-fFAD conversion as well as a two-electron oxidase in terms of formate to CO2 conversion. Catalyzing a four-electron oxidation is not a trivial reaction, so the mechanism by which it occurs is of interest given the proposed intermediates involved. Studies on other FAD-dependent enzymes in which a covalent linkage is formed at the 8α position have proposed a mechanism in which a nearby active site base initiates formation of a quinone-methide tautomer (Scheme 1).15 In the case of lactate oxidase (LOX), an unprotonated ε-amino residue of an introduced lysine in the R268L LOX variant was proposed to act as the active site base.18 Analysis of the spatial orientation of R87 in the three-dimensional structures for FOX suggested that the conserved arginine residue possibly serves a similar role to the introduced lysine residue in R268L LOX (Figure 5).11 Additionally, substitution of R87 in FOX with an alanine or lysine residue did not result in the formation of 8-fFAD despite circular dichroism and fluorescence spectroscopic studies demonstrating that wild-type and R87K FOX are each capable of binding flavin and share similar overall protein folds; the absence of 8-fFAD formation in the properly folded FOX variant appears to be consistent with R87 acting as an active-site base in the conversion of FAD to 8-fFAD. However, computational analysis indicated that R87 has a pKa value of at least 22 prior to conversion to 8-fFAD, indicating R87 cannot contribute the pKa value at pH 5.5 ± 0.1 that corresponds to a catalytic group that must be unprotonated for 8-fFAD formation as revealed by the λ vs. pH plot (Figure 4). Since computation analysis has ruled out any nearby amino acid contributing this pKa value, the value likely corresponds to either a conformational change or the N1 atom of the fully reduced flavin


Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 20 of 37

hydroquinone, which has been shown previously to exhibit a pKa range of 5.4—6.2 in enzymes containing an 8α-histidylflavin.29 If this pKa value does correspond to the N1 atom of the fully reduced flavin hydroquinone, then the pHprofile results would support the involvement of the reduced flavin in the rate-limiting step of 8-fFAD formation as its protonation state S94

limits

the

overall

rate

of

conversion.

R87

Ultimately, the results suggest that it is L95

unlikely that R87 is serving as the active-site base for the formation of the quinone-methide tautomer. Alternatively, R87 is likely serving to stabilize the charge(s) of important intermediates

during

8-fFAD

formation,

though it is unclear why the lysine substituted variant would be incapable of stabilizing these same charges.

Figure 5. Three-dimensional structure of FOX solved from a single crystal to a resolution of 2.4 Å as previously reported (PDB: 3Q9T).11 L97 occupies a similar spacial orientation as a histidine residue in choline oxidase that is covalently bound through the 8α-position of the isoalloxazine ring of FAD. An 8-formylFAD has been identified in the active-site of FOX, and a conserved R87 (Arg89 in choline oxidase) has been proposed to serve directly in conversion of FAD to 8-formyl FAD. L97, R87, and S94 are 4.87 Å, 3.82 Å, and 3.93 Å away from the 8α-position of 8-fFAD, respectively.

Although incomplete, some details of the mechanism for the enzyme-mediated conversion of FAD to 8-fFAD can be realized from the current study. Previous studies on other FAD-dependent enzymes permit the proposal of the first two steps in mechanism for the autocatalytic formation of 8-formyl FAD to require a general base to deprotonate the C8α methyl group on the isoalloxazine ring of FAD to form the quinone-methide tautomer intermediate (Scheme 1, I). Once formed, a nearby amino acid residue is proposed to perform a nucleophilic attack on this quinone-methide tautomer resulting in the fully reduced flavin intermediate


Page 21 of 37

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

covalently linked to the enzyme through C8α position (Scheme 1, II). S94 has been proposed to serve as the residue involved in forming the covalent linkage between FAD and FOX and will be the subject of future studies. Following formation of the covalent intermediate, the FAD intermediate would be fully reduced; an electron acceptor, presumably molecular oxygen, must oxidize this fully reduced flavin intermediate species to continue with the oxygenation reaction (Scheme 1, III). This step is supported by the current study in that 8-fFAD formation only occurs following lysis of E. coli cells containing expressed FOX (see discussion above). After oxidation, a general base is required again to remove a second proton on the C8α carbon to generate an additional quinone-methide flavin tautomer covalently linked to the enzyme (Scheme 1, IV). Identifying the base responsible for removing this second proton is of particular interest, especially since removal of this proton would seemingly be energetically unfavorable. Nevertheless, removal of this proton would be required to form 8-fFAD. Finally, a nucleophilic attack by water leads to an intermolecular rearrangement that displaces the covalent linkage with the enzyme and results in fully reduced 8-fFAD (Scheme 1, V-VII). Overall, this study demonstrates that the established list of known cofactors is incomplete, and that 8-fFAD is likely one of many cofactors yet to be discovered. Although holoenzyme cofactor modification of flavin cofactors is known, rarely do such modifications result in an enzyme exhibiting enhanced function with a non-covalently bound modified flavin. FOX appears to be the only flavin oxidase discovered thus far capable of utilizing 8-fFAD for catalysis. Fully elucidating details of the mechanism of 8-fFAD formation in FOX will further our understanding of holoenzyme cofactor modifications in general, especially those which augment enzyme catalytic activity. Future studies will focus on elucidation of this mechanism along with a better understanding of how 8-fFAD enhances the rate of formate oxidation when


Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 22 of 37

compared to FAD. It has been established previously by others that the reduction potential for an 8-formyl flavin is much higher than that of a typical flavin (typically ~ 60 mV higher 9,16); since it is likely that FOX harnesses this increased redox potential for oxidative catalysis, direct measurement of the redox potential for wild-type FOX and its variants will be of interest. The present study demonstrates that R87 promotes an environment around the FAD cofactor that is integral for the FOX-mediated four-electron oxidation of FAD to 8-fFAD (Scheme 1) but is likely not serving as the putative catalytic base. Thus, wild-type unmodified FOX promotes two separate reactions via two different mechanisms: the four-electron oxidation of FAD and the two-electron oxidation of formate. The dual mechanisms of FOX will serve as a model for development of dual functionality biocatalysts; such dual functionality will prove valuable to a future where chemicals from renewable raw materials are of increasing relevance. Conclusion Riboflavin (vitamin B2) derivatives other than FAD or FMN are rarely found in biological systems, as their incorporation typically results in inactivation of essential flavoproteins and leads to the disruption of important cellular pathways. Previous reports established the presence of 8-fFAD in FOX, but did not establish the origin of the modified cofactor nor its impact on formate oxidase activity. We demonstrated that formate oxidase catalyzes the conversion of bound FAD to 8-fFAD via a four-electron oxidation reaction, and that this conversion is necessary for optimal formate oxidase activity. As a result, a conserved arginine residue near the 8α position of FOX bound FAD was investigated and shown to be important for 8-fFAD formation. 8-formyl FAD is a new addition to the growing list of modified flavin cofactors with complex chemistries recently discovered in nature. This work broadens our current understanding of flavoprotein chemistry by demonstrating the existence of a new class of


Page 23 of 37

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

holoenzyme-mediated modified cofactors. Additionally, it also provides insight into the poorly understood mechanism of enzyme-mediated 8α-flavin modifications: although the occurrence of the quinone-methide tautomer intermediate in these reactions is accepted, the identity of the catalytic group(s) responsible for initiating and/or stabilizing its formation in these enzymes remains unclear. The elucidation and exploitation of such a mechanism in related flavoenzymes will serve the development of novel biocatalysts with enhanced redox properties.


Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 24 of 37

ACKNOWLEDGMENTS We wish to acknowledge Dr. Ryan M. Clairmont for his helpful discussions regarding analysis of LCMS data as well as the core facilities at the Parker H. Petit Institute for Bioengineering and Bioscience at the Georgia Institute of Technology for the use of their shared equipment, services and expertise.

Supporting Information Available The Supporting Information includes the following: additional experimental method details, including a list of materials used; a plot of the conversion of FAD to 8-fFAD in wild-type FOX following cell lysis as a function of time; circular dichroism spectra for WT FOX and R87K FOX, flavin fluorescence emission and excitation spectra of WT FOX and R87K FOX; and the thermodynamic cycle involving the deprotonation of protons on arginine 87 and serine 94 in FOX. The representative data was included to correlate with the values provided in the text. This material is available free of charge via the Internet at http://pubs.acs.org.


Page 25 of 37

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

REFERENCES (1) Massey, V. (2000) The chemical and biological versatility of riboflavin. Biochem. Soc. Trans. 28, 283–296. (2) Kim, H. J., and Winge, D. R. (2013) Emerging concepts in the flavinylation of succinate dehydrogenase. Biochim. Biophys. Acta BBA - Bioenerg. 1827, 627–636. (3) Payne, K. A. P., White, M. D., Fisher, K., Khara, B., Bailey, S. S., Parker, D., Rattray, N. J. W., Trivedi, D. K., Goodacre, R., Beveridge, R., Barran, P., Rigby, S. E. J., Scrutton, N. S., Hay, S., and Leys, D. (2015) New cofactor supports α,β-unsaturated acid decarboxylation via 1,3-dipolar cycloaddition. Nature 522, 497–501. (4) White, M. D., Payne, K. A. P., Fisher, K., Marshall, S. A., Parker, D., Rattray, N. J. W., Trivedi, D. K., Goodacre, R., Rigby, S. E. J., Scrutton, N. S., Hay, S., and Leys, D. (2015) UbiX is a flavin prenyltransferase required for bacterial ubiquinone biosynthesis. Nature 522, 502–506. (5) Ferguson, K. L., Arunrattanamook, N., and Marsh, E. N. G. (2016) Mechanism of the novel prenylated flavin-containing enzyme ferulic acid decarboxylase probed by isotope effects and linear free-energy relationships. Biochemistry 55, 2857–2863. (6) Van Berkel, W. J. H., Eppink, M. H. M., and Schreuder, H. A. (1994) Crystal structure of phydroxybenzoate hydroxylase reconstituted with the modified fad present in alcohol oxidase from methylotrophic yeasts: Evidence for an arabinoflavin. Protein Sci. 3, 2245– 2253. (7) Koch, C., Neumann, P., Valerius, O., Feussner, I., and Ficner, R. (2016) Crystal structure of alcohol oxidase from Pichia pastoris. PLOS ONE (Silman, I., Ed.) 11, e0149846.


Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 26 of 37

(8) Philmus, B., Decamps, L., Berteau, O., and Begley, T. P. (2015) Biosynthetic versatility and coordinated action of 5′-deoxyadenosyl radicals in deazaflavin biosynthesis. J. Am. Chem. Soc. 137, 5406–5413. (9) Doubayashi, D., Ootake, T., Maeda, Y., Oki, M., Tokunaga, Y., Sakurai, A., Nagaosa, Y., Mikami, B., and Uchida, H. (2011) Formate oxidase, an enzyme of the glucose-methanolcholine oxidoreductase family, has a His-Arg pair and 8-formyl-FAD at the catalytic site. Biosci. Biotechnol. Biochem. 75, 1662–1667. (10) Maeda, Y., Doubayashi, D., Oki, M., Nose, H., Sakurai, A., Isa, K., Fujii, Y., and Uchida, H. (2009) Expression in Escherichia coli of an unnamed protein gene from Aspergillus oryzae rib40 and cofactor analyses of the gene product as formate oxidase. Biosci. Biotechnol. Biochem. 73, 2645–2649. (11) Maeda, Y., Doubayashi, D., Ootake, T., Oki, M., Mikami, B., and Uchida, H. (2010) Crystallization and preliminary X-ray analysis of formate oxidase, an enzyme of the glucose–methanol–choline oxidoreductase family. Acta Crystallograph. Sect. F Struct. Biol. Cryst. Commun. 66, 1064–1066. (12) Pedrolli, D. B., Jankowitsch, F., Schwarz, J., Langer, S., Nakanishi, S., and Mack, M. (2014) Natural riboflavin analogs. Methods Mol. Biol. Clifton NJ 1146, 41–63. (13) Hefti, M. H., Vervoort, J., and Van Berkel, W. J. H. (2003) Deflavination and reconstitution of flavoproteins: Tackling fold and function. Eur. J. Biochem. 270, 4227–4242. (14) Pedrolli, D., Langer, S., Hobl, B., Schwarz, J., Hashimoto, M., and Mack, M. (2015) The ribB FMN riboswitch from Escherichia coli operates at the transcriptional and translational level and regulates riboflavin biosynthesis. FEBS J. 282, 3230–3242.


Page 27 of 37

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

(15) Heuts, D. P. H. M., Scrutton, N. S., McIntire, W. S., and Fraaije, M. W. (2009) What’s in a covalent bond?: On the role and formation of covalently bound flavin cofactors. FEBS J. 276, 3405–3427. (16) Edmondson, D. E. (1974) Intramolecular hemiacetal formation in 8-formylriboflavine. Biochemistry 13, 2817–2821. (17) Lehman, T. C., and Thorpe, C. (1992) A new form of mammalian electron-transferring flavoprotein. Arch. Biochem. Biophys. 292, 594–599. (18) Yorita, K., Matsuoka, T., Misaki, H., and Massey, V. (2000) Interaction of two arginine residues in lactate oxidase with the enzyme flavin: conversion of FMN to 8-formyl-FMN. Proc. Natl. Acad. Sci. U. S. A. 97, 13039–13044. (19) Bradford, M. M. (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72, 248–254. (20) Salach, J., Walker, W. H., Singer, T. P., Ehrenberg, A., Hemmerich, P., Ghisla, S., and Hartmann, U. (1972) Studies on Succinate Dehydrogenase. Site of Attachment of the Covalently-Bound Flavin to the Peptide Chain. Eur. J. Biochem. 26, 267–278. (21) Chapman, S. K., and Reid, G. A. (Eds.). (1999) Flavoprotein protocols. Humana Press, Totowa, N.J. (22) Case, D. A., Babin, V., Berryman, J. T., Betz, R. M., Cai, Q., Cerutti, D. ., Cheatham, III, T. E., Darden, T. A., Duke, R. E., Gohlke, H., Goetz, A. W., Gusarov, S., Homeyer, N., Janowski, P., Kaus, J., Kolossváry, I., Kovalenko, A., Lee, T. S., LeGrand, S., Luchko, T., Luo, R., Madej, B., Merz, K. M., Paesani, F., Roe, D. R., Roitberg, A., Sagui, C., Salomon-Ferrer, R., Seabra, G., Simmerling, C. L., Smith, W., Swails, J., Walker, R. C.,


Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 28 of 37

Wang, J., Wolf, R. M., Wu, X., and Kollman, P. A. (2014) Amber 14. University of California, San Francisco. (23) Hornak, V., Abel, R., Okur, A., Strockbine, B., Roitberg, A., and Simmerling, C. (2006) Comparison of multiple Amber force fields and development of improved protein backbone parameters. Proteins Struct. Funct. Bioinforma. 65, 712–725. (24) Cornell, W. D., Cieplak, P., Bayly, C. I., Gould, I. R., Merz, K. M., Ferguson, D. M., Spellmeyer, D. C., Fox, T., Caldwell, J. W., and Kollman, P. A. (1995) A second generation force field for the simulation of proteins, nucleic acids, and organic molecules. J. Am. Chem. Soc. 117, 5179–5197. (25) Jorgensen, W. L., Chandrasekhar, J., Madura, J. D., Impey, R. W., and Klein, M. L. (1983) Comparison of simple potential functions for simulating liquid water. J. Chem. Phys. 79, 926. (26) Bayly, C. I., Cieplak, P., Cornell, W., and Kollman, P. A. (1993) A well-behaved electrostatic potential based method using charge restraints for deriving atomic charges: the RESP model. J. Phys. Chem. 97, 10269–10280. (27) Frisch, M. J., Trucks, G. W., Schlegel, H. B., Scuseria, G. E., Robb, M. A., Cheeseman, J. R., Montgomery, J. J. A., Vreven, T., Kudin, K. N., and Burant, J. C. (2004) Gaussian 03. Gaussian, Inc., Wallingford, CT. (28) Wang, J., Wolf, R. M., Caldwell, J. W., Kollman, P. A., and Case, D. A. (2004) Development and testing of a general amber force field. J. Comput. Chem. 25, 1157– 1174.


Page 29 of 37

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

(29) De Francesco, R., and Edmondson, D. E. (1988) pKa values of the 8α-imidazole substituents in selected flavoenzymes containing 8α-histidylflavins. Arch. Biochem. Biophys. 264, 281–287.


Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 30 of 37

TABLES Table 1. Characterization of FOX mediated conversion of FAD to 8-fFAD FAD 8-fFAD

λ (h-1)*

Absorbance maxima (nm, free solution)

370, 450

350, 460

ND†

Absorbance maxima (nm, FOX-bound)

372, 458

360, 472

0.103 ± 0.011

11 ± 2‡

82 ± 2

0.097 ± 0.006

1.38 ± 0.30

10.25 ± 1.31

0.097 ± 0.006§

4.0 ± 0.2

2.9 ± 0.2

0.106 ± 0.024

FOX appkcat (s-1) FOX app(kcat/KM,formate) (mM-1s-1) LC Retention Time (min) *

Formation constants were determined from the respective change in absorbance † The conversion of FAD to 8-fFAD was not detectable in free solution ‡ Determined from the appkcat y-intercept in Figure 2, which is equal to the app kcat value for FOX with FAD bound § A change in KM,formate (mM) was not detected


Page 31 of 37

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

For Table of Contents Use Only Enzyme Mediated Conversion of Flavin to 8-formyl Flavin in Formate Oxidase Results in Modified Cofactor with Enhanced Catalytic Properties. John M. Robbins, Michael G. Souffrant, Donald Hamelberg, Giovanni Gadda, and Andreas S. Bommarius


Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Scheme 1. Conversion of FAD to 8-fFAD by enzyme mediated four-electron oxidation reaction 152x130mm (300 x 300 DPI)

ACS Paragon Plus Environment

Page 32 of 37

Page 33 of 37

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Figure 1. The time dependence of 8-fFAD formation in FOX. Following cell lysis, purified FOX was exchanged into pure LCMS grade water using a PD10 desalting column and incubated on ice over 48 h. Absorbance scans from 300-600 nm at t=1 h (red), t=3 h (orange), t=5 h (light orange), t=7 h (green), t=9 h (blue), t=22 h (purple), and 48 h (black) following cell lysis. Inset: the change in the absorption spectrum for WT FOX at t=1 h and t=48 h following cell lysis. All experiments were performed in triplicate at 4 °C. 76x70mm (600 x 600 DPI)


Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Figure 2. Formate oxidase activity (appkcat values) of WT FOX (black circles) and the absorbance of WT FOX at 512 nm (orange circles) as a function of time following cell lysis. The best fit of appkcat and A512 data to Eq. 1 is represented by the solid black line and the broken orange line, respectively. Reactions measuring formate oxidase activity were initiated by the addition of WT FOX (0.2 µM) into a reaction mixture containing dissolved oxygen (0.250 mM), sodium formate (100 mM), and 50 mM acetate (pH 3.6) at 25 °C. All experiments were performed in triplicate, and error bars (fully encompassed within the respective data point) represent SD. 71x61mm (600 x 600 DPI)


Page 34 of 37

Page 35 of 37

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Figure 3. Panel A: HPLC chromatographs of cofactor extracted from WT FOX as a function of time. Panel B: HPLC chromatographs of cofactor extracted from R87K FOX as a function of time. Panel C: mass spectrum of species eluted from HPLC around 4 min corresponding to standard FAD. Panel D: mass spectrum of species eluted from HPLC around 3 min corresponding to 8-fFAD. All experiments were performed in triplicate. 174x258mm (300 x 300 DPI)


Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Figure 4. 8-fFAD apparent rate constant for the formation (λ) vs. pH. Reactions were initiated by the addition of fresh WT FOX (0.2 µM) into a reaction mixture containing dissolved oxygen (0.250 mM) and sodium formate (100 mM) at 25 °C after being incubated on ice in either 50 mM acetate (pH 3.5—5.0), potassium phosphate (pH 6.0—8.0), or 50 mM glycine-NaOH (pH 9.0-10.0). Each point is the average of at least three separate experiments, and error bars represent SD. The solid line is the best fit of data to Eq. 2 49x28mm (600 x 600 DPI)


Page 36 of 37

Page 37 of 37

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Three-dimensional structure of FOX solved from a single crystal to a resolution of 2.4 Å as previously reported (PDB: 3Q9T).11 L97 occupies a similar spacial orientation as a histidine residue in choline oxidase that is covalently bound through the 8α-position of the isoalloxazine ring of FAD. An 8-formyl-FAD has been identified in the active-site of FOX, and a conserved R87 (Arg89 in choline oxidase) has been proposed to serve directly in conversion of FAD to 8-formyl FAD. L97, R87, and S94 are 4.87 Å, 3.82 Å, and 3.93 Å away from the 8α-position of 8-fFAD, respectively. 59x43mm (600 x 600 DPI)


Enzyme-Mediated Conversion of Flavin Adenine Dinucleotide (FAD

Recommend Documents