Epitope Binning Assay Using an Electron Transfer-Modulated Aptamer

Subscriber access provided by University of Florida | Smathers Libraries

Article

Epitope Binning Assay Using an Electron Transfer-Modulated Aptamer Sensor Min Li, Xudong Guo, Hui Li, Xiaolei Zuo, Rongzhang Hao, Hongbin Song, Ali Aldalbahi, Zhilei Ge, Jiang Li, Qian Li, Shiping Song, Shaohua Li, Ningsheng Shao, Chunhai Fan, and Lihua Wang ACS Appl. Mater. Interfaces, Just Accepted Manuscript • DOI: 10.1021/acsami.7b17324 • Publication Date (Web): 15 Dec 2017 Downloaded from http://pubs.acs.org on December 16, 2017

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

ACS Applied Materials & Interfaces is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 32 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Applied Materials & Interfaces

Epitope

Binning

Assay

Using

an

Electron

Transfer-Modulated Aptamer Sensor Min Li†, ‡ ★, Xudong Guo§ ★, Hui Liǁ ★, Xiaolei Zuo†, ┴, Rongzhang Hao§, Hongbin Song§, Ali Aldalbahi#, Zhilei Ge†, Jiang Li†, Qian Li, † Shiping Song†, Shaohua Liǁ, Ningsheng Shao*, ǁ, Chunhai Fan*, †, and Lihua Wang*, † †

Division of Physical Biology & Bioimaging Center, Shanghai Institute of Applied

Physics, Chinese Academy of Science, Shanghai 201800, China ‡

University of Chinese Academy of Sciences, Beijing 100049, China

§ ǁ

Institute of Disease Control and Prevention, AMMS, Beijing 100071, China

Beijing Institute of Basic Medical Sciences, Beijing 100850, China

┴

Institute of Molecular Medicine, Renji Hospital, School of Medicine and School of

Chemistry and Chemical Engineering, Shanghai Jiao Tong University #

Chemistry Department, King Saud University, Riyadh 11451, Saudi Arabi

*Corresponding author: E-mail: [email protected], [email protected], [email protected] ABSTRACT: Surface plasmon resonance (SPR) and quartz crystal microbalance (QCM) are workhorses of protein-DNA interaction research for over 20 years, providing ways to quantitatively determine the protein-DNA binding. However, the cost, necessary technical expertise and severe non-specific adsorption poses barriers to their use. Convenient and effective techniques for the measurement of protein-DNA binding affinity and the epitope binning between DNA and proteins for developing highly sensitive detection platform remain challenging. Here, we develop a binding-induced alteration in electron transfer kinetics of the redox reporter labeled

1

ACS Paragon Plus Environment

ACS Applied Materials & Interfaces 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 32

(methylene blue) on DNA aptamer to measure the binding affinity between prostate-specific antigen (PSA) and aptamer. We demonstrate that the binding of PSA to aptamer decrease the electron transfer rate of methylene blue for ~45%. Further, we identify the best pairwise selection of aptamers for developing sandwich assay by sorting from ten pairwise modes with the PSA detection limit of 500 ng/mL. Our study provides promising ways to analyze the binding affinity between ligand and receptor and to sort pairwise between aptamers or antibodies for the development of highly sensitive sandwich immunoassays. KEYWORDS: binding affinity, conformation alteration, interfacial electron transfer, epitope binning, pairwise selection

INTRODUCTION The binding-induced electrochemical signaling-whereby the interplay between ligand molecules and receptors can initiate an electrochemical event-is fundamental for regulating the eletrophysiological process in nervous system. Typically, acetylcholine (ACh) released from presynaptic membrane can bind to its ACh membrane receptor and then induce ion channel currents on the postsynaptic membrane,

1-2

transducing a

binding event to an electrochemical output signal. Understanding this binding-induced electrochemical signal transduction mechanism between cells inspires us to design electrochemical sensing platform that can be used to investigate the binding interaction between ligand and receptor. And a large mumber of relavent sensing platform have been developed during the past few decades.3-4 Typically, surface plasmon resonance (SPR),

5-11

quartz crystal microbalance (QCM) 2


Page 3 of 32 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


12-17

and micro-cantilever

18-22

are widely used in ligand-receptor binding affinity

analysis. However, Most of these techniques are based on the property alteration of the sensing interface, and the non-specific adsorption between the interface (not the receptor probe) and target has great influence on the signal response resulting in low reliability and accuracy. Therefore, strict and thorough blockage of the sensing interface is required to obtain a desirable sensing interface. Essentially, the sensing mechanism of these techniques relies on the alteration of the sensing interface instead of the probe receptor itself. Therefore it is not persuasive enough to demonstrate the specific binding between ligand and receptor. Despite of some alternative strategies such as DNase footprinting assay23 and gel shift assays,24 have been explored to confirm the specific binding between ligand and receptor. However, both of them are complicated and unable to quantify the binding affinity between protein and DNA. For example, the DNase footprinting assay needs the process of purification which was time consuming. Therefore, convenient and effective technologies are highly required to develop for the measurement of ligand-receptor binding affinity and the demonstration of specific binding assay between ligand and receptor. Here, inspired by the transduction between ligand-receptor binding event and electrochemical signaling in the nervous system, we develop the binding-induced alteration in electron transfer kinetics to explore the binding event between a new screened PSA aptamer and PSA. Easy to be modified and functionalized, DNA has been widely used in many field such as for sensing application.25-41 Here, we functionalize the PSA aptamer with a 3



Page 4 of 32

redox-reporter MB and covalently attach it to the gold electrode to form a self-assembled monolayer. The binding of PSA to aptamer induces the conformation change of the aptamer which alters the efficiency that the redox-reporter approaches the electrode interface, resulting in electron transfer kinetic changes. When interrogated by electrochemical technique which is widely used for single-step and signal amplifying quantitative bioassays,

42-47

an easily measurable current output

signal was obtained. The signaling that triggered by the conformation alteration of the aptamer confirmed the specific binding between PSA and aptamer. And simultaneously, the non-specific adsorption of PSA to the electrode interface has no effect on the current signal because the signal readout was through methylene blue that modified on aptamer. Further, based on the sandwich design, we explore the overlapping or conflict of bind sites on PSA between relative receptors such as antibodies and PSA aptamers and identify the best receptor pairwise for building the desirable sandwich assay for PSA detection. EXPERIMENTAL SECTION Materials and methods Taq polymerase and dNTPs were purchased from TIANGEN BIOTECH Co Ltd, China. The Stabilized Streptavidin-HRP Conjugate (Prod# 89880D lot#QL225905) were bought from Thermo Fisher Scientific Inc, USA. The Yeat transfer RNA (ytRNA) 、 Salmon sperm DNA(wDNA) Bovine serum albumin (BSA), Tris (2-carboxyethyl) phosphine hydrochloride (TCEP), and 6-Mercaptohexanol (MCH) were purchased from Sigma-Aldrich. The Adenosine 5′-triphosphate-γ-32P-ATP 4


Page 5 of 32 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


were purchased from PerkinElmer, USA. The T4 PKN enzyme (EK0031, lot: 00109069) was purchased from Thermo Fisher Scientific Inc, USA. The HAWP membrane (0.45µm) was purchased from MILLIPORE, USA. The pUC18-T vector system was purchased from TAKARA Biotechnology Co Ltd, China. All other DNA sequences were synthesized and purified by Sangon Biotechnology Inc. (Shanghai, China). Prostate-specific antigen (PSA) was purchased from Lingchao Linc-Bio Science Co. Ltd. (Shanghai, China). PSA monoclonal antibody (MAb1 and MAb2) and PSA polyclonal antibody (PAb) were purchased from Fitzgerald. Human α-fetoprotein (AFP) and carcinoembryonic antigen (CEA) were purchased from Shuangliu Zhenglong Biochem Laboratory (Chengdu, China). The custom TMB substrate (where TMB = 3,3’,5,5’- tetrame- thylbenzidine) was purchased from Neogen in the format of a ready-to-use reagent (H2O2 included). Buffers applied in the experiment were as follows: TM buffer used for aptamer immobilization was 20 mM Tris, 50 mM MgCl2, pH 8.0. The electrodes were rinsed in 0.1 M PBS (pH 7.4). 0.1 M PBS (pH 6.5) containing 1 mM MgCl2 and 1% BSA was used for PSA dilution and electrochemical detection for methylene blue (MB) except other illustration. Other chemicals purchased from Sinopharm Group Chemical Regent Co. Ltd. (Shanghai, China) were of analytical grade. And all the chemicals were used without further purification, and Milli-Q water (18 MΩ·cm resistivity) was used throughout all experiments. Aptamers used in the experiment 5’-3’: Aptamer1: SH-TTTTTAATTAAAGCTCGCCATCAAATAGCTGGGGG 5



Page 6 of 32

Aptamer1-biotin: TTTTTAATTAAAGCTCGCCATCAAATAGCTGGGGG-biotin Aptamer2(P7-26):SH-GCAATGGTACGGTACTTCCTATGGCGATGTGTTGGCT GTGTGTGGGGTGCAAAAGTGCACGCTACTTTGCTAA Aptamer2-biotin: GCAATGGTACGGTACTTCCTATGGCGATGTGTTGGCTGTGTGTGGGGTGCA AAAGTGCACGCTACTTTGCTAA-biotin SH-Aptamer2-MB: SH-GCAATGGTACGGTACTTCCTATGGCGATGTGTTGGCT GTGTGTGGGGTGCAAAAGTGCACGCTACTTTGCTAA-MB Aptamer2-complementary: TTAGCAAAGTAGCGTGCACTTTTGCACCCCACACACAGCCAACACATCGC CATAGGAAGTACCGTACCATTGC Instruments Electrochemical measurements were carried out on a CHI 760E electrochemical workstation (CH Instruments Co., Shanghai, China). A conventional three electrodes system including gold electrode (2 mm in diameter) as working electrode, Ag/AgCl electrode (3 M KCl ) as reference electrode and platinum wire as auxiliary electrode was used for cyclic voltammetry (CV), alternating current voltammetry (ACV), square wave voltammetry (SWV) and amperometric detection (I-t). CV was carried out from 0 V to 0.7 V at a scan rate of 100 mV/s. SWV was carried out from -0.5 V to 0 V at the frequency of 50 Hz with the amplitude of 50 mV. ACV was carried out from -0.45 V to -0.05 V at different frequency. I-t detection of HRP catalyzing TMB 6


Page 7 of 32 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


was carried out at 0 V and the steady state current was obtained within 100 s. Screen printed electrodes electrochemical measurements were carried out on Muti-channel electrochemical biosensing system (Huasenxinke Nanotechnology Co., Ltd, Suzhou).

The procedure of SELEX Random ssDNA library and primers were listed in Supplementary Table S1. Primers Plong-1 and P11 were used for the standard PCR amplification of double-stranded DNA molecules. Primers Plong-1 and Pstem-loop were used to synthesize single-stranded DNA by asymmetry PCR. The SELEX strategy was performed as following procedure. The PSA protein was dissolved in 25 mmol Tris-HCl （pH6.5） at 2 µg/µL and stocked at -70℃. Briefly, the HAWP membrane was pre-incubated with binding buffer (1×PBS-1mmolMgCl2,pH6.5) for 10 min and then incubated with the PSA protein (2 µg) at room temperature for 10 min. The PSA protein immobilized on HAWP membrane was blocked with buffer (1×PBS-0.1 µg/µL ytRNA-0.1 µg/µL wDNA，pH6.5) at room temperature for 30 min before subjected to selection. For the first round of selection,1200pmol of initial library(Gp30) was denatured by heating at 100℃ for 5 min and cooled immediately on ice for 10 min before selection. The denatured library were then added for incubation for 1 h at 37℃ in 100 µL binding buffer (1×PBS-1 mmol MgCl2，pH6.5). The nonspecific unbound single stranded DNAs (ssDNAs) were washed out with 200 µL washing buffer(1× PBS-1 mmol MgCl2，pH6.5) for 4 to 5 times. The specific bond oligonucleotide sequences were collected by heating at 95℃in double distillated water (ddH2O) for 10 7



Page 8 of 32

min and used as a template in the unequal length PCR amplification reaction for the generation of enriched ssDNA pool. The ssDNAs were separated on 8% denatured polyacrylamide-7 M urea gel and recycled from the gel. After seven rounds of selection, the enrichment of the pool was monitored by binding assays. The highest enriched pool was amplified into dsDNA with primer Plong-1 and P11, and then cloned into E.coli DH5α using the pUC18-T vector system. Separated colonies were picked out randomly and their sequences were determined by Autolab Biotechnology Co. Ltd.(Beijing, China)

Identification of the enriched selection pool and candidate aptamers to the PSA protein by EMSA The enriched pools of each selection round and candidate aptamers were labeled with γ-32P-ATP using T4 PNK enzyme. Theγ-32P labeled pools or theγ-32P labeled aptamers(1 ng) were incubated with PSA protein(2~4 µg) or BSA control protein(10 µg) in 10 µL of binding buffer at 37℃ for 1 h .In competition reaction, both the γ -32P labeled pools(1 ng) and no labeled pools(30 ng) of each selection round were incubated with PSA protein(3 µg) in 10 µL of binding buffer at 37℃ for 1 h. The products were subjected on 6% natural gel electrophoresis for 1.5 h(60 V) and visualized on phosphor screen by Cyclone Plus (C431200, PerkinElmer, USA).For the determination of dissociation constants (Kd) of candidate aptamer to the PSA protein, varying concentrations of PSA protein were incubated with 1ngγ-32P-P7-26 aptamer and the complex were subjected to EMSA as described above. The relative

8


Page 9 of 32 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


level of retardation band of PSA protein- γ -32P-P7-26 aptamer complex was determined using Chemi analysis software. The equilibrium dissociation constant (Kd) of the aptamer-PSA interaction was calculated via the equation Y=BmaxX/(Kd+X), using GraphPad Prism4 software. The results of this part was exhibited in S1. Preparation of self-assembly aptamer monolayer on gold electrode Prior to prepare the self-assemble aptamer monolayer, the gold electrodes were first electrochemically cleaned in 0.5 M NaOH. Then, the gold electrodes were polished on microcloth with 0.3 µm and 0.05 µm gamma alumina for 2 min, respectively. Then the polished electrodes were sonicated in ethanol and Milli-Q water for 3 min respectively. The electrodes were next electrochemical cleaned in 0.5 M H2SO4 by scanning the potential between the oxidation and reduction of gold, -0.35 V and 1.5 V, and finally the electrodes were cycled in 0.5 M H2SO4/0.01 M KCl. To determine the effective active surface area, the electrodes were scanned in 0.05 M H2SO4. After the cleaning of electrode, 3 µL of 1 µM thiolate modified Apt2 which was annealed in TM buffer with 3 mM TCEP was incubated on the fresh cleaned gold electrodes at room temperature overnight to form a self-assemble monolayer. The gold electrodes were rinsed with 0.1 M PBS (pH 7.4) before the reaction with PSA. Procedures for aptamer-PSA binding affinity measurement The thiolate and methylene blue modified Aptamer2 (MB-Apt2) was used to form a self-assemble monolayer on the electrode. Then the modified electrodes were exposed to a 2 mM MCH solution (in PBS, pH 6.5, 1 mM MgCl2) at room temperature for 1 hour to avert the interference from oxygen which shows similar reduction potential to 9



Page 10 of 32

that of methylene blue. After the blockage, the electrodes were rinsed by PBS (pH 7.4). Next the electrodes were incubated with 3 µL of PSA (in PBS pH 6.5,1 mM MgCl2, 1% BSA) of various concentrations at 37 °C for 1.5 hours. For the urea denaturation reaction, the electrodes which have bound with PSA were immersed in 6 M urea (dissolved in Milli-Q water) at room temperature for 30 minutes. For complementary strand replacement reaction, 1 µM complementary strand was dropped on the electrodes which have bound with PSA at 37 °C for 1 h. The current signal response was interrogated by SWV. Procedures for epitopes assays Firstly, the thiolate modified aptamer was used to form a self-assemble monolayer on the electrodes. For Apt2, the pH of all buffer were controlled at pH 6.5 (1 mM MgCl2). For Apt1, the pH of all buffers was controlled at pH 7.4. Before incubate with PSA, the modified gold electrodes were blocked by 2 mM MCH at room temperature for 1 hour. Then the modified electrodes were incubated with PSA at 37 °C for 1.5 hours. After that 1 µM biotin modified aptamers which were applied for reporters were incubated with the electrodes at 37 °C for another 1.5 hours. At last, the Avidin-HRP was dropped on the electrodes and incubated for 15 minutes at room temperature. After rinsed with PBS, the electrode was scanned in custom TMB solution by CV and I-t. For the immobilization of antibody probes (MAb1, MAb2 and PAb), the antibodies were adsorbed on the screen printed electrodes (carbon electrode) at 4 °C overnight. Then the screen printed electrodes were blocked by 1% BSA at 37 °C for 1.5 hours. 10


Page 11 of 32 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Then PSA was dropped on the screen printed electrodes at 37 °C for 1 hour. After that 1 µM biotin modified report aptamers were dropped on the electrodes and incubated at 37 °C for 1.5 hours. Finally, the Avidin-HRP was dropped on the electrodes and incubated for 15 minutes at room temperature and then CV and I-t was detected in custom TMB solution. Procedures for PSA detection Firstly, the thiolate modified Apt2 (SH-Apt2) was used to form a self-assemble monolayer. After the electrodes were blocked by 2 mM MCH, PSA (in PBS pH 6.5, 1 mM MgCl2, 1% BSA) of different concentration were incubated with the modified electrodes at 37 °C for 1.5 hours. After rinsed with PBS, 1 µM Apt2-biotin was dropped on the electrodes and incubated at 37 °C for 1.5 hours. Finally, the Avidin-HRP was dropped on the electrodes and incubated at room temperature for 15 minutes and then CV and I-t was detected in custom TMB solution. RESULTS AND DISCUSSION The binding-induced interfacial electron transfer kinetics alteration The mechanism of binding-induced interfacial electron transfer kinetics alteration was shown in Figure 1a. In the unbound state of MB-Apt2, the intrinsically flexible conformation of MB-Apt2 increased the possibility that the redox MB collided with the electrode interface resulting in fast electron transfer kinetics. Similar to some small molecule detection,48 when the PSA bound to MB-Apt2, the binding between them induced the conformation change of MB-Apt2, which finally lowered the

11



Page 12 of 32

kinetics with which the MB exchanged electrons with the electrode. This electron transfer kinetics alterations would produce an easily measurable current output signal when interrogated by SWV (Figure 1b). And the conformation-linked signaling indicated the binding interaction between PSA and MB-Apt2.

Figure 1. Schematic illustration of PSA-Apt2 binding interaction measurement by electrochemical method. (a) Interfacial electron transfer platform was comprised of a redox reporter-modified aptamer that underwent a binding-induced conformational change when bound with target PSA. Signal generation occurred when the target bound to aptamer, reducing the kinetics with which MB exchanges electrons with the electrode interface. And this in turn, led to a distinctive decrease in peak current as 12


Page 13 of 32 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


measured here using SWV (b). (c) Semi-logarithmic plot showed current signal response of MB-Apt2 when challenged with varying PSA concentration (blue). BSA detected with the identical condition was as reference (red). The error bars here reflected standard deviation of at least three independent measurements. To further compare the differences of the electron transfer kinetics between the unbound and bound states of MB-Apt2, we quantified the electron transfer rate constants of MB-Apt2 by ACV which was widely used during the past decades49,50. According to Figure 2a, a signal-off behavior was obtained (Figure 1b) and the ACV results of the two different states of the MB-Apt2 showed similar curves with peaks centered at -0.23 V (Figure 2a) indicating that the binding of PSA to MB-Apt2 had no effect on the electroactivity of MB. Then the electron transfer rate constant was obtained by plotting the Ip/Ib (ACV peak current to the background current) versus variable ACV frequency (Figure 2b). After analyzing the plots, the calculated rate constants were kunbound=14.9±0.36 s- and kbound=8.2±0.23 s-, respectively. Clearly, the binding of 100 µg/mL PSA to MB-Apt2 decreased the rate constant for ~45%. And this distinct difference quantificationally indicated that the binding-induced conformation change of the MB-Apt2 lowered the probability that MB approached the electrode interface and resulted in decreased electron transfer kinetics.

13



Page 14 of 32

Figure 2. Quantificationally measurement of binding-induced alterations in interfacial electron transfer kinetics. (a) Redox signal of the unbound (blue) and bound state (red) of MB-Apt2 measured by alternating current voltammetry (ACV) at the frequency of 5 Hz. (b) Plots of Ip/Ib vs log (frequency) for the unbound (blue) and bound state (red) of MB-Apt2 The rate constant k was 14.9±0.36 s- and 8.2±0.23 s- for the unbound (blue) and bound state (red) of MB-Apt2, respectively. To further verify the decrease behavior of electron transfer rate was indeed contributed to the specific binding between PSA and MB-Apt2, we then explored the current signal changing process including the unbound state of MB-Apt2, bound state of MB-Apt2, and the bound state of the MB-Apt2 treated by Milli-Q water rinsing, urea denaturation and complementary replacement (S3), respectively. All these experiments indicated that the interplay between aptamer and PSA was strong enough to alter the conformation of MB-Apt2 and the decreased rate constant was indeed due to the specific binding between PSA and MB-Apt2. Stability, specificity and robustness of the interfacial electron transfer platform To evaluate the stability of our interfacial electron transfer platform, the gold electrodes modified with MB-Apt2 under either bound or unbound state were scanned 14


Page 15 of 32 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


by SWV for multiple cycles repeatedly. Curves obtained from 30 cycles was strongly coincident with each other for both unbound state and bound state of the MB-Apt2 (S4, S5), and the stability was maintained even for 90 minutes. (Figure 3a). After analyzing the peak current oscillation of the MB-Apt2 (Figure 3b), we demonstrated that the peak current exhibited a less than 2% loss over 90 min for both states of MB-Apt2. The high consistence and stability of the scanning curves and peak currents demonstrated the high stability of the interfacial electron transfer platform and the feasibility in target binding affinity analysis. Furthermore, the specificity and binding regeneration were analyzed. To demonstrate that the electron transfer kinetics change is specifically caused by target protein PSA, we challenged the platform with two other interference proteins ( carcinoembryonic antigen (CEA) and α-fetoprotein (AFP)) As shown in Figure 3c, in each group the signal change analysis was conducted under identical experimental conditions., In the interference group (CEA and AFP), the current changes were less than 16% decrease which was less than ~2-folds of that in the blank (in the absence of PSA). While in the target group (PSA), the current changes were over 8-folds of that in the blank group. These sharply distinguishing current changes clearly suggested that our interfacial electron transfer platform was specifically responsive to target protein PSA and the specificity of the assay was satisfactory. Next, to further substantiate the conformation change of aptamer in the target-aptamer binding process, a serious of elution methods were applied on the target bound electrode and the signal changes were analyzed. As shown in Figure 3d, firstly, the 15



Page 16 of 32

binding between PSA and MB-Apt2 induced conformation alteration of the aptamer for the first round which decreased the current signal for ~35%. When the complementary ssDNA of the aptamer was added on the electrode, the bound PSA was replaced by the complementary strand which hybridized with MB-Apt2 on the electrode. This subsequent conformation alteration of MB-Apt2 further decreased the current signal for ~50%. Then when the hybridized dsDNA was rinsed by Milli-Q water, the complementary strand was eluted which recovered the primary conformation of MB-Apt2 and regained the current signal for ~99%. When the recovered MB-Apt2 was subsequently analyzed for the second cycled binding and eluting process, we found that the current signal changes of two identical elution processes showed similar current signal changes, suggesting that our interfacial electron transfer platform possessed excellent reproducibility and was capable of regeneration.

16


Page 17 of 32 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 3. Characterization of the stability, specificity and robustness of the MB-Apt2 probe. (a) SWV peak current signal of the unbound (blue) and bound state (red) of MB-Apt2 measured consecutively for 90 min. (b) Deviation analysis of SWV peak currents of the unbound (blue) and bound state (red) of MB-Apt2. The signal oscillation of both states was less than 2%, and the stability could maintain for 90 min. (c) The redox signal changes of MB-Apt2 when challenged with different proteins of identical concentration (50 µg/mL CEA, 50 µg/mL AFP, and 50 µg/mL PSA respectively). The decreases of SWV peak current were 12.8±1.2%, 15.5±3% and 60.5 ± 4.7% for CEA, AFP and PSA respectively. (d) Robustness analysis of MB-Apt2 probe by circulating detection of redox signal during the two cyclic 17



Page 18 of 32

processes of PSA incubation, complementary replacement and Milli-Q water rinsing. The measurement of binding affinity between PSA and Apt2 After the signaling mechanism investigation and the property identification of the interfacial electron transfer platform, we next applied the platform to explore the binding affinity between PSA and MB-Apt2. Firstly, we challenged the platform to various concentrations of PSA and the effect of PSA concentration on signal decrease was summarized in Figure 1c. We found that the electrochemical signal response of PSA featured an S-shaped curve, with a steep rise, and then a plateau until the MBApt2 receptors approached saturation with current signal decreasing for 75%. To represent the binding affinity between PSA and MB-Apt2, we then fitted the data in Figure 1c and obtained the equilibrium dissociation constant (Kd): 0.36±0.08 µM indicating the strong binding affinity between PSA and MB-Apt2. The reference BSA group, as expected, failed to generate any electrochemical responsive signals, indicating the high selectivity of the proposed platform to achieve the quantification of binding affinity. Epitope binning assay and pairwise screening of receptors for PSA detection Multiple and diverse epitopes are expressed on the surface of the antigen.

51-54

And

Different epitope bins distributed on the surface of antigen (Figure 4a). Receptors that bind to identical epitope bin, are mutually repulsive and the receptor which possesses stronger binding affinity to PSA is the prior candidate. On the contrary, receptors that bind to spatially separate epitope bins can bind to the PSA simultaneously, which can be developed for sensitive sandwich immunoassays. To explore the binding sites of 18


Page 19 of 32 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


different receptors on PSA, electrochemical sandwich assay in which two different aptamers (Apt1 and Apt2) and three different antibodies (MAb1, MAb2 and PAb) were chosen as capture probes, two biotin-labeled aptamers (Apt1 and Apt2) were used as reporters was built. As shown in Figure 4b-c, when Apt1 was used as reporter, the signal-noise ratios of all pairwises were greater than 1 except for that of PAb-Apt1 pairwise (signal-noise ratio ~0.3), indicating that Apt1 and PAb mapped to the identical epitope bin (Bin1#). Further, under the identical condition, we analyzed the signal-noise ratios obtained by the pairwise where Apt2 was chosen as reporter. Based on the fact that MAb1 and MAb2 mapped to two different bins, we finally obtained two bins where Bin2# contained Apt2, PAb and MAb1, Bin3# contained Apt2, PAb MAb2. And according to the result that Apt2 mapped to two different bins we further inferred that Apt2 possessed multiple and diverse epitopes on PSA which be designed for sandwich assays.

19



Page 20 of 32

Figure 4. Epitope binning assays of PSA for developing sandwich assays. (a) Multiple and diverse epitope bins distributed on the PSA surface. Receptors such as MAb, PAb, Apt1 and Apt2 were used as capture probes for epitope binning (b) Heat map that depicted the signal-noise ratios of 10 pairwise modes obtained by electrochemical sandwich. (c) Three bins circled in red (Bin#1)，green(Bin#2) and yellow (Bin#3), emerged among the 5 receptors tested based on the signal-noise ratios analysis of 10 pairwise modes.

20


Page 21 of 32 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 5. Pairwise for sandwich design and results of PSA detection (a) Schematic representation of the strategy to build Apt2-Apt2 sandwich for PSA detection. SH-Apt2 was used as capture probe and Apt2 modified with biotin was used as reporter. (b) Cyclic voltammetry for the electrochemical detection of PSA. An obvious enzymatic catalytic signal was obtained at ~0.3 V when the concentration of PSA was 100 µg/mL. (c) Titration curve for PSA detection using the sandwich assay. The detection limit was 500 ng/mL. Based on the overall results of the epitope binning, then we chose the optimal pairwise mode, Apt2-Apt2 pairwise (signal-noise ratio ~15), to develop a sandwich to examine the analytical performance of the design. As shown in Figure 5a, the capture Apt2 was first immobilized on the gold surface interface through the well-established gold-thiol bond. After the capture of PSA, biotin-Apt2 was employed as reporter 21



Page 22 of 32

which combined with Avidin-HRP subsequently to produce an enzymatic catalytic signal in the solution with TMB substrates (H2O2 included). We observed distinguishing electrochemical enzymatic catalytic signal from the CV curves (Figure 5b) at ~0.3 V when the concentration of PSA was 100 µg/mL. Then the sandwich was challenged with various concentrations of PSA under optical conditions. According to Figure 5c, one can observed that for the entire range of PSA concentration examined the current signal increased with increasing PSA concentration until the capture probe approached saturation and the detection limit for PSA was 500 ng/mL, achieving excellent sensing capability examination. CONCLUSIONS In summary, we developed a binding-induced interfacial electron transfer kinetics alteration electrochemical sensing platform to quantify the binding affinity between PSA and aptamer. As demonstrated in our case, our sensing platform which could realize label-free and one step detection possessed excellent stability, high specificity and strong robustness for binding affinity measurement. And the binding event between PSA and Apt2 could induce the interfacial electron transfer rate to decrease for ~45%. And equilibrium dissociation constant (Kd) of PSA-Apt2 quantified by our platform was: 0.36±0.08 µM. Based on the binding sites assays, we sorted the optimal pairwise mode from ten pairwise fashions and applied the best receptor pairwise for building the ideal sandwich for PSA detection. It is anticipated that this research can provide a promising avenue for binding affinity assays and analytical sensing applications. 22


Page 23 of 32 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


ASSOCIATED CONTENT Supporting Information Identification of the binding of the 7th pool and the P7-26 aptamer to PSA; Redox electrochemical signal changes of MB-Apt2 after incubation with PSA of varying concentration; Verification of the specific binding between Apt2 and PSA; The stability of redox electrochemical signal of the unbound MB-Apt2; The stability of redox electrochemical signal of the bound MB-Apt2 after PSA binding; Random ssDNA library, primers and six candidate sequences. This material is available free of charge via the Internet at http://pubs.acs.org. AUTHOR INFORMATION Corresponding authors *E-mail: [email protected] *E-mail: [email protected] *E-mail: [email protected]. Author Contributions ★

These authors contributed equally to this work.

Notes The authors declare no competing financial interest. ACKNOWLEDGEMENTS This work was financially supported by the National Key R&D Program of China (2016YFA0201200, 2016YFA0400900), National Natural Science Foundation of China (21422508, 31470960, U1532119, 21675167, 21373260, 31571014, 21505148). 23



The Key Research Program NO.QYZDJ-SSW-SLH031

of

Frontier

Sciences,

Page 24 of 32

CAS,

Grant

REFERENCES (1) Sargent, P. B. The Diversity of Neuronal Nicotinic Acetylcholine Receptors. Annu.

Rev. Neurosci. 1993, 16, 403-443. (2) Hamill, O. P.; Sakmann, B. Multiple Conductance States of Single Acetylcholine Receptor Channels in Embryonic Muscle Cells. Nature 1981, 294, 462-464. (3) Arroyo,C. N.; Somerson, J.; Vieira, P. A.; Ploense, K. L.; Kippin, T. E.; Plaxco, K. W. Real-Time Measurement of Small Molecules Directly in Awake, Ambulatory Animals. Proc. Natl. Acad. Sci. U. S. A. 2017, 114 , 645-650. (4) Ferguson, B. S.; Hoggarth, D. A.; Maliniak, D.; Ploense, K.; White, R. J.; Woodward, N.; Hsieh, K.; Bonham, A. J.; Eisenstein, M.; Kippin, T. E.; Plaxco, K. W.; Soh, H. T. Real-Time, Aptamer-Based Tracking of Circulating Therapeutic Agents in Living Animals. Sci. Transl. Med. 2013, 5, 213ra165-213ra165. (5) Pattnaik, P. Surface Plasmon Resonance Application in Understanding Receptor-Ligand Interaction. Appl. Biochem. Biotechnol. 2005, 126, 79-92. (6) Scarano, S.; Mascini, M.; Turner, A. P. F.; Minunni, M. Surface Plasmon Resonance Imaging for Affinity-Based Biosensors. Biosens. Bioelectron. 2010, 25, 957-966. (7) McDonnell, J. M. Surface Plasmon Resonance: towards an Understanding of the Mechanisms of Biological Molecular Recognition. Curr. Opin. Chem. Biol. 2001, 5, 572-577.

24


Page 25 of 32 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(8) He, X.; Guo, L.; He, J.; Xu, H.; Xie, J. Stepping Library-Based Post-SELEX Strategy Approaching to the Minimized Aptamer in SPR. Anal.Chem. 2017, 89, 6559-6566. (9) Zhu, Z.; Feng, M.; Zuo, L.; Zhu, Z.; Wang, F.; Chen, L.; Li, J.; Shan, G.; Luo, S. Z. An Aptamer Based Surface Plasmon Resonance Biosensor for the Detection of Ochratoxin A in Wine and Peanut Oil. Biosens. Bioelectron. 2015, 65, 320-326. (10) Sun, L.; Wu, L.; Zhao, Q. Aptamer Based Surface Plasmon Resonance Sensor for Aflatoxin B1. Microchim. Acta 2017, 184, 2605-2610. (11) Bianco, M.; Sonato, A.; De Girolamo, A.; Pascale, M.; Romanato, F.; Rinaldi, R.; Arima, V. An Aptamer-Based SPR-Polarization Platform for High Sensitive OTA Detection. Sensor. Actuat. B-Chem. 2017, 241, 314-320. (12) Liss, M.; Petersen, B.; Wolf, H.; Prohaska, E. An Aptamer-Based Quartz Crystal Protein Biosensor. Anal.Chem. 2002, 74, 4488-4495. (13) Lu, C. H.; Zhang, Y.; Tang, S. F.; Fang, Z. B.; Yang, H. H.; Chen, X.; Chen, G. N. Sensing HIV Related Protein Using Epitope Imprinted Hydrophilic Polymer Coated Quartz Crystal Microbalance. Biosens. Bioelectron. 2012, 31, 439-444. (14) Tamerler, C.; Duman, M.; Oren, E. E.; Gungormus, M.; Xiong, X.; Kacar, T.; Parviz, B. A.; Sarikaya, M. Materials Specificity and Directed Assembly of a Gold-Binding Peptide. Small 2006, 2, 1372-1378. (15) Vogt, S.; Su, Q.; Gutiérrez-Sánchez, C.; Nöll, G. Critical View on Electrochemical Impedance Spectroscopy Using the Ferri/Ferrocyanide Redox Couple at Gold Electrodes. Anal.Chem. 2016, 88, 4383-4390. 25



Page 26 of 32

(16) Hao, D.; Hu, C.; Grant, J.; Glidle, A.; Cumming, D. R. S. Hybrid Localized Surface Plasmon Resonance and Quartz Crystal Microbalance Sensor for Label Free Biosensing. Biosens. Bioelectron. 2018, 100, 23-27. (17) Sun, L.; Frykholm, K.; Fornander, L. H.; Svedhem, S.; Westerlund, F.; Akerman, B. Sensing Conformational Changes in DNA upon Ligand Binding Using QCM-D. Polyamine Condensation and Rad51 Extension of DNA Layers. J. Phys. Chem. B. 2014, 118, 11895-11904. (18) Puiggalí-Jou, A.; del Valle, L. J.; Alemán, C.; Pérez-Madrigal, M. M. Weighing Biointeractions

between

Fibrin(ogen)

and

Clot-Binding

Peptides

Using

Microcantilever Sensors. J. Pept. Sci. 2017, 23, 162-171. (19) Backmann, N.; Zahnd, C.; Huber, F.; Bietsch, A.; Plückthun, A.; Lang, H. P.; Güntherodt, H. J.; Hegner, M.; Gerber, C. A Label-Free Immunosensor Array Using Single-Chain Antibody Fragments. Proc. Natl. Acad. Sci. U. S. A. 2005, 102, 14587-14592. (20) Wang, B.; Huang, F.; Nguyen, T.; Xu, Y.; Lin, Q. Microcantilever-Based Label-Free Characterization of Temperature-Dependent Biomolecular Affinity Binding. Sensor. Actuat. B-Chem. 2013, 176, 653-659. (21) Yin, T. I.; Zhao, Y.; Horak, J.; Bakirci, H.; Liao, H. H.; Tsai, H. H.; Juang, Y. Z.; Urban, G. A Micro-Cantilever Sensor Chip Based on Contact Angle Analysis for a Label-Free Troponin I Immunoassay. Lab Chip 2013, 13, 834-842. (22) Patil, S. B.; Vögtli, M.; Webb, B.; Mazza, G.; Pinzani, M.; Soh, Y. A.; McKendry, R. A.; Ndieyira, J. W. Decoupling Competing Surface Binding Kinetics 26


Page 27 of 32 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


and Reconfiguration of Receptor Footprint for Ultrasensitive Stress Assays. Nature

Nanotechnol. 2015, 10, 899-907. (23) Diamond, M. I.; Miner, J. N.; Yoshinaga, S. K.; Yamamoto, K. R. Transcription Factor Interactions: Selectors of Positive or Negative Regulation from A Single DNA Element. Science 1990, 249, 1266-1272. (24) Garner, M. M.; Revzin, A. A Gel Electrophoresis Method for Quantifying the Binding of Proteins to Specific DNA Regions: Application to Components of the Escherichia Coli Lactose Operon Regulatory System. Nucleic Acids Res. 1981, 9, 3047-3060. (25) Pei, H.; Liang, L.; Yao, G.; Li, J.; Huang, Q.; Fan, C. Reconfigurable Three-Dimensional DNA Nanostructures for the Construction of Intracellular Logic Sensors. Angew. Chem. Int. Ed. 2012, 51, 9020-9024. (26) Yao, G.; Li, J.; Chao, J.; Pei, H.; Liu, H.; Zhao, Y.; Shi, J.; Huang, Q.; Wang, L.; Huang, W.; Fan, C. Gold-Nanoparticle-Mediated Jigsaw-Puzzle-like Assembly of Supersized Plasmonic DNA Origami. Angew. Chem. Int. Ed. 2015, 54, 2966-2969. (27) Chen, P.; Pan, D.; Fan, C.; Chen, J.; Huang, K.; Wang, D.; Zhang, H.; Li, Y.; Feng, G.; Liang, P.; He, L.; Shi, Y. Gold Nanoparticles for High-Throughput Genotyping of Long-Range Haplotypes. Nature Nanotechnol. 2011, 6, 639-644. (28) Ye, D.; Zuo, X.; Fan, C. Nanostructure-Based Engineering of the Biosensing Interface for Biomolecular Detection. Prog. Chem. 2017, 29, 36-46. (29) Ge, Z.; Pei, H.; Wang, L.; Song, S.; Fan, C. Electrochemical Single Nucleotide Polymorphisms Genotyping on Surface Immobilized Three-Dimensional Branched 27



Page 28 of 32

DNA Nanostructure. Sci.Chi.Chem. 2011, 54, 1273-1276. (30) He, Y.; Xie, S.; Yang, X.; Yuan, R.; Chai, Y. Electrochemical Peptide Biosensor Based on in Situ Silver Deposition for Detection of Prostate Specific Antigen. ACS

Appl. Mater. Interfaces 2015, 7, 13360-13366. (31) Dong, S.; Zhao, R.; Zhu, J.; Lu, X.; Li, Y.; Qiu, S.; Jia, L.; Jiao, X.; Song, S.; Fan, C.; Hao, R.; Song, H. Electrochemical DNA Biosensor Based on a Tetrahedral Nanostructure Probe for the Detection of Avian Influenza A (H7N9) Virus. ACS Appl.

Mater. Interfaces 2015, 7, 8834-8842. (32) Kang, Z.; Yan, X.; Zhang, Y.; Pan, J.; Shi, J.; Zhang, X.; Liu, Y.; Choi, J. H.; Porterfield, D. M. Single-Stranded DNA Functionalized Single-Walled Carbon Nanotubes for Microbiosensors via Layer-by-Layer Electrostatic Self-Assembly. ACS

Appl. Mater. Interfaces 2014, 6, 3784-3789. (33) Zeng, D.; Wang, Z.; Meng, Z.; Wang, P.; San, L.; Wang, W.; Aldalbahi, A.; Li, L.; Shen, J.; Mi, X. DNA Tetrahedral Nanostructure-Based Electrochemical miRNA Biosensor for Simultaneous Detection of Multiple miRNAs in Pancreatic Carcinoma.

ACS Appl. Mater. Interfaces 2017, 9, 24118-24125. (34) Yan, J.; Hu, C.; Wang, P.; Liu, R.; Zuo, X.; Liu, X.; Song, S.; Fan, C.; He, D.; Sun, G. Novel Rolling Circle Amplification and DNA Origami-Based DNA Belt-Involved Signal Amplification Assay for Highly Sensitive Detection of Prostate-Specific Antigen (PSA). ACS Appl. Mater. Interfaces 2014, 6, 20372-20377. (35) Yang, Y.; Li, C.; Yin, L.; Liu, M.; Wang, Z.; Shu, Y.; Li, G. Enhanced Charge Transfer by Gold Nanoparticle at DNA Modified Electrode and Its Application to 28


Page 29 of 32 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Label-Free DNA Detection. ACS Appl. Mater. Interfaces 2014, 6, 7579-7584. (36) Zhu, D.; Liu, W.; Zhao, D.; Hao, Q.; Li, J.; Huang, J.; Shi, J.; Chao, J.; Su, S.; Wang, L. Label-Free Electrochemical Sensing Platform for MicroRNA-21 Detection Using Thionine and Gold Nanoparticles Co-Functionalized MoS2 Nanosheet. ACS

Appl. Mater. Interfaces 2017, 9, 35597-35603. (37) Qu, X.; Zhu, D.; Yao, G.; Su, S.; Chao, J.; Liu, H.; Zuo, X.; Wang, L.; Shi, J.; Wang, L.; Huang, W.; Pei, H.; Fan, C. An Exonuclease III-Powered, On-Particle Stochastic DNA Walker. Angew. Chem. Int. Ed. 2017, 56, 1855-1858. (38) Qu, X.; Wang, S.; Ge, Z.; Wang, J.; Yao, G.; Li, J.; Zuo, X.; Shi, J.; Song, S.; Wang, L.; Li, L.; Pei, H.; Fan, C. Programming Cell Adhesion for On-Chip Sequential Boolean Logic Functions. J. Am. Chem. Soc. 2017, 139, 10176-10179. (39) Chen, L.; Chao, J.; Qu, X.; Zhang, H.; Zhu, D.; Su, S.; Aldalbahi, A.; Wang, L.; Pei, H. Probing Cellular Molecules with PolyA-Based Engineered Aptamer Nanobeacon. ACS Appl. Mater. Interfaces 2017, 9, 8014-8020. (40) Qu, X.; Zhang, H.; Chen, H.; Aldalbahi, A.; Li, L.; Tian, Y.; Weitz, D. A.; Pei, H. Convection-Driven Pull-Down Assays in Nanoliter Droplets Using Scaffolded Aptamers. Anal.Chem. 2017, 89, 3468-3473. (41) Zhu, D.; Song, P.; Shen, J.; Su, S.; Chao, J.; Aldalbahi, A.; Zhou, Z.; Song, S.; Fan, C.; Zuo, X.; Tian, Y.; Wang, L.; Pei, H. PolyA-Mediated DNA Assembly on Gold Nanoparticles for Thermodynamically Favorable and Rapid Hybridization Analysis.

Anal.Chem. 2016, 88, 4949-4954. (42) Yang, F.; Zuo, X.; Li, Z.; Deng, W.; Shi, J.; Zhang, G.; Huang, Q.; Song, S.; Fan, 29



Page 30 of 32

C. A Bubble-Mediated Intelligent Microscale Electrochemical Device for Single-Step Quantitative Bioassays. Adv. Mater. 2014, 26, 4671-4676. (43) Wang, Y.; Bai, X.; Wen, W.; Zhang, X.; Wang, S. Ultrasensitive Electrochemical Biosensor for HIV Gene Detection Based on Graphene Stabilized Gold Nanoclusters with Exonuclease Amplification. ACS Appl. Mater. Interfaces 2015, 7, 18872-18879. (44) Wu, X.; Chai, Y.; Zhang, P.; Yuan, R. An Electrochemical Biosensor for Sensitive Detection of MicroRNA-155: Combining Target Recycling with Cascade Catalysis for Signal Amplification. ACS Appl. Mater. Interfaces 2015, 7, 713-720. (45) Zang, Y.; Lei, J.; Hao, Q.; Ju, H. “Signal-On” Photoelectrochemical Sensing Strategy Based on Target-Dependent Aptamer Conformational Conversion for Selective Detection of Lead(II) Ion. ACS Appl. Mater. Interfaces 2014, 6, 15991-15997. (46) Zhu, Y.; Wang, H.; Wang, L.; Zhu, J.; Jiang, W. Cascade Signal Amplification Based on Copper Nanoparticle-Reported Rolling Circle Amplification for Ultrasensitive Electrochemical Detection of the Prostate Cancer Biomarker. ACS Appl.

Mater. Interfaces 2016, 8, 2573-2581. (47) Yang, C.; Shi, K.; Dou, B.; Xiang, Y.; Chai, Y.; Yuan, R. In Situ DNA-Templated Synthesis of Silver Nanoclusters for Ultrasensitive and Label-Free Electrochemical Detection of MicroRNA. ACS Appl. Mater. Interfaces 2015, 7, 1188-1193. (48) Li, H.; Dauphin-Ducharme, P.; Arroyo-Currás, N.; Tran, C. H.; Vieira, P. A.; Li, S.; Shin, C.; Somerson, J.; Kippin, T. E.; Plaxco, K. W. A Biomimetic Phosphatidylcholine-Terminated

Monolayer

Greatly

Improves

the

In

Vivo 30


Page 31 of 32 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Performance of Electrochemical Aptamer-Based Sensors. Angew. Chem. Int. Ed. 2017,

56, 7492-9495. (49) Hoaglund, C. S.; Valentine, S. J.; Sporleder, C. R.; Reilly, J. P.; Clemmer, D. E. Three-Dimensional Ion Mobility/TOFMS Analysis of Electrosprayed Biomolecules.

Anal.Chem. 1998, 70, 2236-2242. (50) Lu, N.; Pei, H.; Ge, Z.; Simmons, C. R.; Yan, H.; Fan, C. Charge Transport within a Three-Dimensional DNA Nanostructure Framework. J. Am. Chem. Soc. 2012,

134, 13148-13151. (51) Ditto, N. T.; Brooks, B. D. The Emerging Role of Biosensor-Based Epitope Binning and Mapping in Antibody-Based Drug Discovery. Expert Opin. Drug Discov. 2016, 11, 925-937. (52) Miller, P. L.; Wolfert, R. L.; Diedrich, G. Epitope Binning of Murine Monoclonal Antibodies by A Multiplexed Pairing Assay. J. Immunol. Methods 2011,

365, 118-125. (53) Abdiche, Y. N.; Miles, A.; Eckman, J.; Foletti, D.; Van Blarcom, T. J.; Yeung, Y. A.; Pons, J.; Rajpal, A. High-Throughput Epitope Binning Assays on Label-Free Array-Based Biosensors Can Yield Exquisite Epitope Discrimination That Facilitates the Selection of Monoclonal Antibodies with Functional Activity. PLoS One 2014, 9, e92451. (54) Estep, P.; Reid, F.; Nauman, C.; Liu, Y.; Sun, T.; Sun, J.; Xu, Y. High Throughput Solution-Based Measurement of Antibody-Antigen Affinity and Epitope Binning. MAbs 2013, 5, 270-278 31



Table Of Comtents

PSA blank

PSA

PSA

Potential

Signal Change

Current

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 32 of 32

Kd

Concentration

32


Epitope Binning Assay Using an Electron Transfer-Modulated Aptamer

Recommend Documents