Esterification of Ginsenoside Rh2 Enhanced Its Cellular Uptake and

Dec 17, 2015 - State Key Laboratory of Food Science and Technology, Institute for Advanced Study, Nanchang University, Nanchang, Jiangxi. 330047, Chin...
2 downloads 0 Views 3MB Size
Download PDF
Article pubs.acs.org/JAFC

Esterification of Ginsenoside Rh2 Enhanced Its Cellular Uptake and Antitumor Activity in Human HepG2 Cells Fang Chen,† Ze-Yuan Deng,†,‡ Bing Zhang,† Zeng-Xing Xiong,‡ Shi-Lian Zheng,‡ Chao-Li Tan,‡ and Jiang-Ning Hu*,†,‡ †

State Key Laboratory of Food Science and Technology, Institute for Advanced Study, Nanchang University, Nanchang, Jiangxi 330047, China ‡ College of Food Science, Nanchang University, Nanchang, Jiangxi 330047, China ABSTRACT: Our previous research had indicated that the octyl ester derivative of ginsenoside Rh2 (Rh2-O) might have a higher bioavailability than Rh2 in the Caco-2 cell line. The aim of this study was to investigate the cellular uptake and antitumor effects of Rh2-O in human HepG2 cells as well as its underlying mechanism compared with Rh2. Results showed that Rh2-O exhibited a higher cellular uptake (63.24%) than Rh2 (36.76%) when incubated with HepG2 cells for 24 h. Rh2-O possessed a dose- and time-dependent inhibitory effect against the proliferation of HepG2 cells. The IC50 value of Rh2-O for inhibition of HepG2 cell proliferation was 20.15 μM, which was roughly half the value of Rh2. Rh2-O induced apoptosis of HepG2 cells through a mitochondrial-mediated intrinsic pathway. In addition, the accumulation of ROS was detected in Rh2-O-treated HepG2 cells, which participated in the apoptosis of HepG2 cells. Conclusively, the findings above all suggested that Rh2-O as well as Rh2 inducing HepG2 cells apoptosis might involve similar mechanisms; however, Rh2-O had better antitumor activities than Rh2, probably due to its higher cellular uptake. KEYWORDS: ginsenosides, Rh2, octyl ester derivative, cellular uptake, apoptosis, ROS, mitochondria

■

INTRODUCTION Panax ginseng C.A. Meyer (Araliaceae) has been used as a functional food and a nutritional supplement for thousands of years.1 It has been reported that the health benefits of ginseng have a wide spectrum, including antitumor, anti-inflammation, and antiallergic activities.2−5 Ginsenoside Rh2, a protopanaxadiol type of steroidal saponin, is one of the major effective metabolites of ginseng.6 Rh2 has been the focus of extensive studies for its beneficial impacts on anticancer activities.7−10 Kim et al. reported that the growth inhibitory effects of Rh2 in cervical carcinoma (HeLa), hepatoma (HepG2), prostate carcinoma (DU145), and colon cancer (HCT116) cell lines were significantly dose-dependent with low IC50.9 In addition, Choi et al. reported that oral gavage of 5 mg Rh2/kg of mouse (three times a week) caused significant apoptosis of MDA-MB231 human breast cells xenografts.11 Although possessing many health-promoting benefits and strong antitumor activities, Rh2 has limited application in the food industry and medical supplies due to its low oral bioavailability and high toxicity to normal cells. It has been reported that Rh2 was slowly absorbed through the digestive tract, and the oral bioavailability of Rh2 was only about 5% in rats and 16% in dogs, which was attributed to its high hydrophilic polarity.12,13 In addition, Rh2 exhibited cytotoxicity to human hepatocyte cell line QSG-7701 with an IC50 value of 37.3 μM.14 The biological activities of polyhydroxylated compounds seem to depend not only on their chemical structure but also on their degree of lipophilicity, which could enhance their uptake into cells or influence their interaction with proteins and enzymes.15 Rational structure modifications of Rh2 might enhance its cellular uptake and hence further improve its antitumor activities. © 2015 American Chemical Society

In recent years, structural modifications of ginsenosides have been evaluated for their biological activities.16 Rh1, a metabolite of Rg1, reaction with octanoyl chloride formed Rh1−monofatty acid ester (ORh1).17 Such ORh1 with less polarity has a higher membrane permeability than Rh1. Similarly, the butyl and octyl esters of ginsenoside compound K (CK-B and CK-O) are more lipophilic and have 3-fold more bioavailability than the parent compound.18 In our previous study, Zhang et al. reported that the absorption of ginsenoside Rh2 in vitro was significantly enhanced by synthesis of its mono-octanoyl ester derivative (Rh2-O).19 Meanwhile, no significant discrepancy between Rh2 and Rh2-O on their bioactivities against the oxidative damage induced by H2O2 was observed. However, it is still unclear whether Rh2-O has higher cellular uptake and more potent antitumor effects in human tumor cell lines. Induction of apoptosis is the possible reason for the inhibition of the proliferation of cancer cells. Park et al. reported that Rh2 might induce apoptosis of human hepatocellular carcinoma cells (Hep3B) by direct activation of the mitochondria pathway.7 Rh2 has the ability to decrease mitochondria membrane potential, stimulate the release of cytochrome c, inhibit the level of Bcl-2 protein, and activate the expression of Bax and caspase-3. It is well-known that mitochondria play a crucial role in apoptosis occurrence resulting from many chemotherapeutic agents including ginsenosides. The generation of intracellular ROS can directly or indirectly cause the mitochondrial permeability transition Received: Revised: Accepted: Published: 253

November 14, 2015 December 15, 2015 December 17, 2015 December 17, 2015 DOI: 10.1021/acs.jafc.5b05450 J. Agric. Food Chem. 2016, 64, 253−261

Article

Journal of Agricultural and Food Chemistry and induce apoptosis by releasing apoptotic proteins.20,21 Previous pharmacokinetic studies have demonstrated that the metabolites of ginsenosides in ginseng were esterified by fatty acids as ginsenoside fatty acid esters in human liver.22,23 Referring to these reports, we hypothesized the action mechanisms and the underlying signaling pathways in the inhibition of the proliferation of cancer cells by Rh2-O similar to by Rh2. In the present study, to examine the antitumor activities of Rh2-O and its possible signaling pathways, Rh2-O was synthesized by Rh2 and octanoyl chloride. Subsequently, the cytotoxicity and cellular uptake of Rh2-O to HepG2 cells and the expression levels of proteins involving mitochondrialmediated intrinsic pathway in Rh2-O-induced HepG2 cell apoptosis were systematically investigated compared with Rh2.

■

Figure 1. Chemical structure of ginsenosides Rh2 and Rh2-O. penicillin (100 U/mL), and streptomycin (0.1 mg/mL). Cultures were maintained at 37 °C in a humidified atmosphere of 5% CO2 in air. The medium was replaced every 2 days, and the cells were passaged at about 90% confluence using a trypsin/EDTA solution (0.25%/0.02%) at a split ratio of 1:4. Cytotoxicity Assay. The cytotoxicity of Rh2-O and Rh2 to HepG2 and HL-02 cells was quantified using MTT assays.24,25 Briefly, 0.2 mL of cells was seeded onto 96-well microplates with a density of 1 × 104 cells/well. Following incubation for 12 h, Rh2-O at different concentrations was added. After treatment, 0.2 mL of MTT solution (2 mg/mL in culture media) was added to each well and incubated for 4 h in the dark. The supernatant was then removed, and the MTT− formazan crystals were dissolved by incubation with 0.15 mL of DMSO with gentle shaking for 10 min; the absorbance was determined at 490 nm in a microplate reader. Cells incubated with 0.1% DMSO were used as controls. In each MTT assay, every sample was tested in five replicates. The IC50 value, the drug concentration that reduced the absorbance by 50%, was interpolated from dose− response data. Annexin V-FITC/Propidium Iodide (PI) Assay. Apoptosis in cell populations was determined by flow cytometric analysis.26,27 After treatment with different concentrations of Rh2-O or Rh2, HepG2 cells were collected and washed in cold PBS and resuspended in 100 μL of binding buffer. Then, 5 μL of annexin V-FITC and 5 μL of PI then were added to the samples in the dark for 15 min at room temperature. Finally, samples were analyzed by flow cytometry (FACSCalibur; Becton Dickinson Biosciences, San Jose, CA, USA). Cellular Uptake of Rh2 and Rh2-O. Cellular uptake of compounds Rh2 and Rh2-O in HepG2 cells was measured according to the methods of Li28 and Pereira-Caro’s29 studies with a slight modification. Around 105 cells was cultured in 100 mm diameter plates. After incubation for 12 h, 17.5 μM Rh2 or Rh2-O was added (final volume = 10 mL), respectively, and further incubated in the medium for 6, 12, or 24 h. After that, both the cell culture broth and the PBS were washed, and the attached cells were collected into a 25 mL tube. The sample was centrifuged at 12000g for 10 min, and the supernatant was collected. The obtained supernatant was extracted twice with 10 mL of ethyl acetate. After vortexing for 2 min, the sample was centrifuged at 6500g for 15 min, and the organic layer was collected and evaporated to dryness with nitrogen. The residue was dissolved in 400 μL of mobile phase and filtered with a 0.45 μm micropore filter. Twenty microliters of the filtrate was injected into the HPLC. The cellular uptake ratios were calculated using the following equations:

MATERIALS AND METHODS

Chemicals and Reagents. Rh2-O was first dissolved in DMSO at a concentration of 50 mM and then freshly diluted in culture medium with 5% FBS. 2,7′-Dichlorodihydrofluorescin diacetate (DCFH-DA), 4′,6-diamidino-2-phenylindole (DAPI), 5,5′,6,6′-tetrachloro-1,1′,3,3′tetraethylbenzimidazolyl carbocyanine iodide (JC-1), and 3-(4,5dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) were purchased from Enzo Life Sciences (Plymouth Meeting, PA, USA). Annexin V-FITC/PI apoptosis assay kits were obtained from Becton, Dickinson and Co. (Franklin Lakes, NJ, USA). Antibodies anti-Bcl-2, anti-Bax, anti-tBid, anti-Cyt C, anti-cleaved caspase 9, anti-cleaved caspase 3, anti-cleaved PARP, and anti-β actin were purchased from Cell Signaling Technology (Beverly, MA, USA). Normal growth media (MEM) medium and fetal calf serum (FBS) were purchased from Gibco Life Technologies (Paisley, UK). All other compounds had a purity of >98%. Synthesis. Fifty milligrams of Rh2 and 40 mg of K2CO3 were dissolved in 40 mL of CH2Cl2, and then 26 mg octanoyl chloride was slowly added. The mixture was reacted under stirring at room temperature for 24 h. Then the solvent was removed by rotary evaporation until dryness. The resulting concentrate was resolved in 25 mL of ethyl acetate and washed two times with 25 mL of ice water. The collected organic layer was dried under rotary evaporation and then dissolved in MeOH. The obtained product was analyzed by HPLC (GL Sciences Inc., Zorbax Eclipse Plus-C18, 2.1 × 100 mm, 1.8 μm) with 100% MeOH as the mobile phase. A semipreparative HPLC was used for further purification. Identification of Synthesized Product. A 6430 QqQ LC-MS system (Agilent Technologies) equipped with an orthogonal ESI was employed for quantitative analysis. The LC-MS system was operated in the positive ion in multiple reaction monitoring (MRM) mode. The 1 H and 13C NMR spectra were measured on a Bruker Avance 600 NMR spectrometer in C5D5N, using TMS as an internal standard. Chemical shifts (δ) are expressed in parts per million (ppm). The obtained product was identified by MS as an octyl ester derivative of Rh2 (Rh2-O) with m/z 771.6 [M + Na]+. Carbon signals of δC 172.85, 34.62, 25.00, 29.01, 28.73, 29.19, 22.58, and 14.01 (C-1″−8″) were identified as the octanoyl group. From the 13C NMR data analysis, we found no significant chemical shifts changes for the main skeleton but a downfield shift of C-12 and an upfield shift of C-13 (from δC 70.79 to δC 73.25, from δC 48.38 to δC 45.49), indicating that the fatty acid ester substituent was connected to the hydroxyl group at C-12 of Rh2. The conclusion can be confirmed by the analysis of 1H NMR spectra. There was a downfield shift of H-12 and an upfield shift of H-13 (from δH 3.567 to δH 5.206, from δH 1.986 to δH 1.740). The structure of Rh2 and Rh2-O is shown in Figure 1. Culture of HepG2 and HL-02 Cells. Human hepatic carcinoma cell line (HepG2) and human hepatocyte cell line (HL-02) were procured from National Centre for Cell Sciences (NCCS), China. HepG2 cells were grown in MEM containing 10% FBS (v/v), sodium pyruvate (1 mM), penicillin (100 U/mL), and streptomycin (0.1 mg/ mL). HL-02 cells were grown in DMEM containing 10% FBS (v/v),

cellular uptake ratio of Rh2 = (Rh2total − Rh2extracellular)/Rh2total × 100%

cellular uptake ratio of Rh2‐O = (Rh2‐Ototal − Rh2extracellular − Rh2‐Oextracellular )/Rh2‐Ototal × 100% The data are expressed as the mean of three experiments and reported as the mean ± SD. 254

DOI: 10.1021/acs.jafc.5b05450 J. Agric. Food Chem. 2016, 64, 253−261

Article

Journal of Agricultural and Food Chemistry Table 1. Primer Sequences Used in Real-Time PCR gene name

forward sequence

reverse sequence

product (bp)

GADPH Bax Bcl-2

GCACCGTCAAGGCTGAGAAC CTTTTGCTTCAGGGTTTCATCCA TGATGGGATCGTTGCCTTAT

TCCACTGGCGTCTTCACCAC TCCATGTTACTGTCCAGTTCGT CACTTGATTCTGGTGTTTC

139 152 112

Content of Rh2-O and Rh2 in Rh2-O-Treated HepG2 Cells. Contents of Rh2-O and Rh2 in Rh2-O-treated HepG2 cells were measured according to the methods in Pereira-Caro29 and Anarjan’s30 studies with a slight modification. Briefly, 105 cells was cultured in 100 mm diameter plates. After incubation with17.5 μM Rh2-O for 24 h, the cell layer was washed twice with PBS and then collected by scraping. Cells from duplicate plates corresponding to a particular condition were collected in PBS and combined in an eppendorf vial. After centrifugation at 2000g for 5 min at 4 °C, the supernatant was removed and the cell pellet resuspended in 10 mL of PBS. An aliquot of the suspension was used for the determination of the cell number. Cells were sonicated for 10 min in an ice−water bath to break down the cell membrane and release the total amount of Rh2 or Rh2-O. This sample was centrifuged at 12000g for 10 min and the supernatant collected. The obtained supernatant was extracted twice with 10 mL of ethyl acetate. After vortexing for 2 min, the sample was centrifuged at 6500g for 15 min, and the organic layer was collected and evaporated to dryness with nitrogen. The residue was dissolved in 200 μL of mobile phase and filtered with a 0.45 μm micropore filter. Twenty microliters of the filtrate was injected into the HPLC. Chromatin Staining with DAPI. Apoptosis was observed by chromatin staining with DAPI. Cells were incubated with different concentrations of Rh2-O or Rh2 onto 6-well plates. After treatment, the medium was discarded. The cells were fixed with 4% formaldehyde (Sigma-Aldrich) for 10 min at room temperature, washed four times with PBS, and later exposed to DAPI staining solution for 5 min at room temperature. Cell preparations were examined under UV illumination with a fluorescence microscope (Olympus Optical Co., Tokyo, Japan). RNA Isolation and Real-Time Quantitative Reverse Transcription PCR. Total RNA of the cells was extracted using total RNA extraction reagent (TaKaRa) according to the manufacturer’s instruction. RNA was confirmed by running on a 1.5% agarose gel. Reverse transcription was performed with 1 μg of total RNA using a TransScript First-Strand cDNA Synthesis Supermix Kit (TaKaRa) according to the supplier’s instruction. The mRNA expression levels of genes were determined by real-time PCR using SYBR premix ex TagTM (TaKaRa) in the ABI 7900HT real-time PCR system (Applied Biosystems, USA). Simultaneously, the quantitative analysis of mRNA levels was normalized to the endogenous reference gene GAPDH. The reaction was carried out under the following conditions: 95 °C for 30 s, 40 cycles at 95 °C for 5 s and 58 °C for 30 s. The primers used are shown in Table 1. Values of each group mRNA level were calculated as 2−ΔΔCt levels and performed in triplicate. Preparation of Cytosolic Extracts. A Cytoplasmic Protein Extraction Kit (Sangon Biotech) was used to extract cytoplasmic proteins. After treatment with different concentrations of Rh2-O or Rh2, cells were washed and scraped with a cell scraper. Then cells were collected by centrifugation at 1000g at 4 °C for 10 min. Then the cell pellets were resuspended in 0.5 mL of cytoplasmic protein extraction buffer, homogenized with a Dounce (40 strokes), and centrifuged at 16000g for 20 min at 4 °C. The supernatants were used as the cytosol fraction. Western Blot Analysis. The concentration of protein in samples was quantified using the BCA method. Protein (40 μg) was mixed with 6× loading buffer and denatured by boiling for 10 min. The proteins were size-separated by 12% SDS-PAGE and then transferred onto a nitrocellulose membrane. After blocking with 5% nonfat milk for 1 h at room temperature, membranes were then incubated with specific primary antibodies overnight at 4 °C, followed by incubation with horseradish peroxidase-conjugated secondary goat anti-rabbit or antimouse antibodies at room temperature for 1 h. Finally, protein bands

were visualized by an enhanced chemiluminescence (ECL) detection system (GE Healthcare). Mitochondrial Membrane Potential Assessment by JC-1 Staining. Cells were incubated with Rh2-O or Rh2, with or without NAC, in 6-well plates and then stained with 10 μg/mL of JC-1 for 10 min at 37 °C. Then, the cells were observed under a fluorescence microscope (Olympus Optical Co.). The green fluorescence was observed under blue light, and the red fluorescence was observed under green light. Reactive Oxygen Species Measurement by DCPH-DA Staining. After treatment with Rh2-O, with or without NAC, HepG2 cells were collected and then stained with 10 μM DCPH-DA for 30 min at 37 °C. After that, cells were washed four times with serum-free medium. The green fluorescence was observed under blue light with a fluorescence microscope (Olympus Optical Co.). Statistical Analysis. Results are expressed as the mean ± the standard error (SD). The data were analyzed by Student’s t test or analysis of variance (ANOVA) with the Bonferroni post hoc test, as appropriate, using Prism 5.03 (GraphPad Software Inc., San Diego, CA, USA). A P < 0.05 was deemed statistically significant in all experiments.

■

RESULTS Cytotoxicity of Rh2-O and Rh2 toward HL-02 and HepG2 Cells. To compare the cytotoxicities of Rh2-O and Rh2, HL-02 and HepG2 cells were treated with Rh2-O or Rh2 considering the different concentrations or time intervals. The results showed that Rh2-O and Rh2 inhibited the cell viability of HepG2 cells in a concentration- and time-dependent manner (Figure 2A,B), with IC50 values of 20.15 and 42.12 μM for Rh2O and Rh2, respectively, for HepG2 cells at 24 h of incubation. However, both compounds showed no significant cytotoxicity on HL-02 cells (88.37%) at 25 μM on HL-02 cells. Rh2-O Induced Apoptosis in HepG2 Cells. Double staining with annexin V-FITC and PI as well as flow cytometry was performed to examine cell apoptosis.26,27 Four quadrant images were observed: the Q1 area represented damaged cells appearing in the process of cell collection; cells in the Q2 area either were in the end stage of apoptosis, were undergoing necrosis, or already dead; the Q3 area represented normal cells; and the early apoptotic cells were located in the Q4 area. As shown in Figure 3A, the apoptosis rate of HepG2 cells induced by Rh2-O was dose-dependent. The percentage of early and late apoptotic cells in the control cells was 4.75%, which increased to 29.03% with the treatment of 17.5 μM Rh2-O for 24 h. However, the percentage of apoptosis cells was only 12.04% when HepG2 cells were treated with 17.5 μM Rh2. These results indicated that Rh2-O was more effective in inducing apoptosis than Rh2 in HepG2 cells. HepG2 cells treated with or without Rh2-O or Rh2 for 24 h were further investigated by the membrane-permeable DAPI staining. The cell morphologies were observed as shown in Figure 3B. It was found that after treatment with Rh2-O under the concentration gradient, the contours of HepG2 cells became irregular, the nuclei condensed, and the apoptotic bodies appeared. However, cells with smaller nuclei and condensed chromatin were rarely seen in the control group. 255

DOI: 10.1021/acs.jafc.5b05450 J. Agric. Food Chem. 2016, 64, 253−261

Article

Journal of Agricultural and Food Chemistry

Figure 3. Cell apoptosis induced by Rh2-O or Rh2 in HepG2 cells: (A) flow cytometric analysis of Rh2-O or Rh2 induced apoptosis in HepG2 cells using annexin V-FITC/PI; (B) fluorescent staining of nuclei in Rh2-O- or Rh2-treated cells by DAPI. Cells treated with 0− 20 μM Rh2-O or 17.5 μM Rh2 for 24 h were observed by fluorescence microscope. Fragmented nuclei and apoptotic bodies are indicated as circles. Image data are representative of one of three similar experiments.

results indicated that the increasing lipophilicity of Rh2 determined the high extensive cellular uptake by HepG2 cells. To explore the stability of Rh2-O in the cells during the antitumor experiments, the lysates was collected after HepG2 cell incubation with 17.5 μM Rh2-O for 0, 6, 12, and 24 h. The cell counts for the experiments were normalized, and values of Rh2-O and Rh2 residual are reported per 107 cells. As shown in Figure 4B, only a negligible amount of Rh2 (0.582 μM, 3.32% of total Rh2-O concentration) was found in cells at 12 h, which was significantly lower than for Rh2-O found inside cells at 12 h (P < 0.05). The intracellular accumulation of Rh2 in Rh2treated HepG2 cells was also determined (Figure 4B). At each time point, the residual Rh2-O inside Rh2-O-treated HepG2 cells was much higher than the Rh2 inside Rh2-treated HepG2 cells (P < 0.05). These results indicated that Rh2-O was the active ingredients rather than Rh2 in Rh2-O-treated HepG2 cells. Rh2-O Induced Apoptosis with the Involvement of Intrinsic Apoptosis Pathway Activation. HepG2 cell apoptosis induced by Rh2-O has been verified via the above experiments; however, its molecular mechanism was still not clear. From previous studies, it is known that mitochondria play a central role in the regulation of apoptotic signals.31,32 Western blot assay was conducted to further identify the signaling

Figure 2. Cytotoxicity of Rh2-O and Rh2 in HepG2 cells using the MTT assay. (A) HepG2 cells were treated with different doses of Rh2O or Rh2 for 24 h. (B) HepG2 cells were treated with 17.5 μM Rh2-O and Rh2 for different times. Data represent the mean ± SD from five replicates. (C) HL-02 cells were treated with different doses of Rh2-O or Rh2 for 24 h.

This was consistent with the results from annexin V-FITC/PI double staining. Cellular Uptake of Rh2 and Rh2-O in HepG2 Cells. The uptake of Rh2 and Rh2-O by HepG2 cells was monitored at different incubation times (0, 6, 12, and 24 h). A comparative plot of uptake for Rh2 and Rh2-O is shown in Figure 4A, indicating that Rh2-O achieved a maximum uptake ratio (63.24%) compared with only 28.06% of uptake ratio for Rh2 at 24 h. The uptake of Rh2-O and Rh2 was not significantly different between 12 and 24 h, respectively (P > 0.05). These 256

DOI: 10.1021/acs.jafc.5b05450 J. Agric. Food Chem. 2016, 64, 253−261

Article

Journal of Agricultural and Food Chemistry

initiators, and caspase-3 acted as the central regulator of apoptosis. Active caspase-9 caused cleavage of caspase-3, and caspase-3 resulted in cleavage of PARP and ultimately led to cell apoptosis.34 As shown in Figure 5E, the cleavages of caspase-9, caspase-3, and PARP were increased after treatment of HepG2 cells with Rh2-O in a dose-dependent manner. These results verified that the activation of intrinsic apoptosis pathway was involved in Rh2-O-treated HepG2 cells. Rh2-O Induced Apoptosis via Generation of Intracellular ROS. Once intracellular ROS levels are imbalanced, the intrinsic apoptotic pathway can be activated due to mitochondrial dysfunction.35 We therefore checked intracellular ROS status in Rh2-O-treated cells. The intracellular ROS levels were investigated by staining with DCPH-DA after treatment with Rh2-O or Rh2 (17.5 μM). As shown in Figure 6A, compared with control group, the green fluorescence intensity increased significantly in Rh2-O-treated (17.5 μM) HepG2 cells, whereas the production of intracellular ROS in Rh2treated (17.5 μM) HepG2 cells was lower than in those treated with Rh2-O at the same concentration. Moreover, NAC is a well-known antioxidant agent that can partially inhibit ROS generation in Rh2-O-treated or Rh2-treated (17.5 μM) HepG2 cells. To further determine the intracellular apoptotic signaling pathways, HepG2 cells were pretreated with NAC for ROS for 1 h, then 17.5 μM Rh2-O was added, and the mixture was coincubated at 37 °C for 24 h. As shown in Figure 6B, compared with the Rh2-O-treated group, cell viability was increased by 9.32% after pretreatment with 1 mM NAC. The results suggested that ROS might be a critical mediator in Rh2-Oinduced HepG2 cells growth inhibition.

Figure 4. Cellular uptake analysis of Rh2-O and Rh2 in HepG2 cells: (A) cellular uptake analysis of Rh2-O and Rh2 (17.5 μM) after treatment of HepG2 cells in different hours; (B) intracellular accumulation of Rh2-O and Rh2 after treatment of HepG2 cells in different hours. Results are presented as the mean ± SD with triplicate measurement. (∗) P < 0.05 and (∗∗) P < 0.001 versus control group. (&) P < 0.05 versus Rh2 in Rh2-O-treated HepG2 cells.

■

DISCUSSION Ginsenoside Rh2 has been reported to exhibit various biological activities. However, the poor intestinal absorption of Rh2 has hindered effective application in the medicine and food industries. In recent years, ginsenoside fatty acid esters, a new class of lipophilic compounds obtained from free ginsenosides by chemical synthesis with different fatty acids, have attracted our attention due to their higher lipophilicity and similar or even higher antitumor activities compared with ginsenoside.16−18,36 In our previous study, Rh2-O, a mono-octanoyl ester derivative of Rh2, exhibited better membrane permeation than Rh2 in Caco-2 cells.19 The difference between Rh2-O and Rh2 on antitumor activity and the mechanisms of Rh2-Oinduced HepG2 cell apoptosis were still unclear. Most of the designed ginsenoside fatty acid esters exhibited much higher cytotoxic potency than that of natural ginsenosides against cancer cell lines.17,36 In the present study, MTT assays showed that Rh2-O inhibited HepG2 cell growth more effectively than Rh2. Our results are consistent with previous studies which showed that three novel monoesters of ginsenoside-M1 exhibited lower IC50 values than ginsenosideM1 on various cancer cells.36 Induction of apoptosis is conceived to be the main molecular mechanism for antitumor with phytochemicals. The apoptosis results demonstrated that Rh2-O produced much higher apoptotic cell population potency than Rh2. It was further proven that esterification of Rh2-O from Rh2 contributed to enhance the antitumor activity. Meanwhile, in the present study, we found that the higher antitumor activity of Rh2-O compared with Rh2 was probably due to the higher cellular uptake of Rh2-O than Rh2 in HepG2 cells because of the increasing lipophilicity for Rh2-O. Our

pathways of HepG2 cell apoptosis induced by Rh2-O or Rh2. The change levels of apoptosis-related proteins were observed in HepG2 cells treated with Rh2-O for 24 h. As shown in Figure 5A, after treatment of HepG2 cells with Rh2-O, the expression levels of anti-apoptosis protein Bcl-2 were decreased, whereas the expression level of pro-apoptosis protein Bax and the activation of Bid were increased. Meanwhile, the increase or decrease of protein levels in Rh2treated (17.5 μM) HepG2 cells was lower than those in HepG2 cells treated with Rh2-O (17.5 μM). The results were similar to the Q-PCR results (Figure 5B), which also found that the mRNA expression levels of Bcl-2 were decreased and the mRNA expression levels of Bax were increased in Rh2-Otreated (17.5 μM) HepG2 cells. Mitochondrial membrane potential was analyzed by JC-1 staining. As shown in Figure 5C, in comparison with the control, treatment of Rh2-O (17.5 μM) led to a marked reduction of red fluorescence and an increase of green fluorescence, whereas treatment of Rh2 (17.5 μM) had little fluorescence variation compared with control cells. This indicated that Rh2-O induced mitochondrial depolarization in HepG2 cells. Next, the release of Cyt C from mitochondria was examined (Figure 5D). The Western blot results showed a significant increase in the release of Cyt C into cytosol induced by Rh2-O in a dose-dependent manner. The release level of Cyt C in Rh2-treated (17.5 μM) HepG2 cells was the same as with Rh2-O (10 μM). The caspase family plays an important role in the intrinsic pathways of cell apoptosis.33 Caspase-9 was one of the 257

DOI: 10.1021/acs.jafc.5b05450 J. Agric. Food Chem. 2016, 64, 253−261

Article

Journal of Agricultural and Food Chemistry

Figure 5. Apoptosis of HepG2 cells induced by Rh2-O or Rh2 through mitochondrial pathway: (A) Western blot analysis for detecting Bcl-2, Bax, and tBid protein levels after indicated treatment; (B) Q-PCR analysis for detecting Bcl-2, Bax, and tBid mRNA levels after indicated treatment; (C) decline of mitochondrial membrane potential (Δφm) stimulated by Rh2-O or Rh2 exposure in HepG2 cells (after Rh2-O or Rh2 treatment for 24 h, the level of Δφm was detected by a fluorescence microscope; experiments were performed three times with similar results); (D) Western blot analysis for detecting Cyt C translocation after Rh2-O or Rh2 treatment; (E) Western blot assays of active fragments of caspase-3 and -9 and PARP (results from one representative experiment are shown; histogram represents quantification of protein expression levels in Rh2-O- or Rh2-stimulated HepG2 cell samples using ImageJ64 software (levels of control cells/β-actin defined as 1); results are presented as the mean ± SD with triplicate measurement; (∗) P < 0.05 and (∗∗) P < 0.001 versus control group; (&) P < 0.05 versus Rh2-treated group). 258

DOI: 10.1021/acs.jafc.5b05450 J. Agric. Food Chem. 2016, 64, 253−261

Article

Journal of Agricultural and Food Chemistry

Figure 6. ROS generation involved in Rh2-O- or Rh2-induced apoptosis in HepG2 cells: (A) ROS generation in HepG2 cells treated with Rh2-O; (B) cell growth after treatment with Rh2-O determined in the absence or presence of different concentrations of NAC by the MTT method. (∗) P < 0.05 significantly different from cells treated with only Rh2-O.

generation has lost balance, cell proliferation, even apoptosis, will occur by ROS-mediated mitochondrial dysfunction and p53 activation.35 Our results also indicated that ROS played a critical role in mediating Rh2-O-induced HepG2 cell growth inhibition. In conclusion, Rh2-O exhibited dose- and time-dependent inhibitory effects against the proliferation of HepG2 cells, which was caused by apoptosis. The possible molecular mechanisms of Rh2-O-induced HepG2 cell growth inhibition are given in Figure 7, which reveals that the apoptosis was induced by

results were in accordance with previous results which showed that the butyl and octyl fatty acid esters of ginsenoside compound K had a highly extensive cellular uptake in Caco-2 cells and significant bioactivities.18 Mitochondrial dysfunction plays a central role in the activation of intrinsic apoptotic signal pathways.37 As we know, mitochondrial dysfunction is regulated by Bcl-2 family proteins, which are mostly located on the mitochondrial outer membrane or which transfer to the mitochondria in response to stimuli.38 Previous studies have shown that the intrinsic pathway was interrelated in Rh2-induced apoptosis in cancer cells.7,39 The results in the present study showed that Rh2-O induced the loss of mitochondrial membrane potential, which subsequently led to the release of Cyt C to the cell cytoplasm. Rh2-O played a role in the activation of apoptotic pathways by regulating the expression level of Bcl-2 family members. The expression levels of pro-apoptotic protein Bax increased while the expression level of anti-apoptotic proteins Bcl-2 decreased. It was indicated that the Bcl-2/Bax expression ratio was downregulated, which can trigger the mitochondria-mediated intrinsic apoptosis pathway. Besides, the activation of proapoptotic protein Bid was observed in Rh2-O-treated HepG2 cells, which can promote the intrinsic apoptotic signal pathways. The activation of caspase-3/-9 and PARP cleavage increased followed by the intrinsic apoptotic pathway involved in Rh2-O-induced HepG2 cell apoptosis. ROS including superoxides, peroxides, and free radicals are byproducts in the process of cell aerobic respiration. ROS have been regarded as important cellular events participating in signal transduction, immune response, regulation of gene expression, and other processes.21,22 Once intracellular ROS

Figure 7. Schematic form of the proposed mechanisms for Rh2-Oinduced apoptosis in HepG2 cells. 259

DOI: 10.1021/acs.jafc.5b05450 J. Agric. Food Chem. 2016, 64, 253−261

Article

Journal of Agricultural and Food Chemistry

ginsenoside Rh2, an anticancer nutrient from ginseng, in rats and dogs. Food Chem. Toxicol. 2009, 47, 2257−2268. (13) Liu, H.; Yang, J.; Du, F.; Gao, X.; Ma, X.; Huang, Y.; Xu, F.; Niu, W.; Wang, F.; Mao, Y. Absorption and disposition of ginsenosides after oral administration of Panax notoginseng extract to rats. Drug Metab. Dispos. 2009, 37, 2290−2298. (14) Wei, G. Q.; Zheng, Y. N.; Li, W.; Liu, W. C.; Lin, T.; Zhang, W. Y.; Chen, H. F.; Zeng, J. Z.; Zhang, X. K.; Chen, Q. C. Structural modification of ginsenoside Rh2 by fatty acid esterification and its detoxification property in antitumor. Bioorg. Med. Chem. Lett. 2012, 22, 1082−1085. (15) Soumyajit, M.; Sridhar, D.; Ashim, K. M. Membrane transporter/receptor-targeted prodrug design: strategies for human and veterinary drug development. Adv. Drug Delivery Rev. 2004, 56, 1437−1452. (16) Wong, A. S. T.; Che, C. M.; Leung, K. W. Recent advances in ginseng as cancer therapeutics: a functional and mechanistic overview. Nat. Prod. Rep. 2015, 32, 256−272. (17) Han, M.; Hou, J. G.; Dong, C. M.; Li, W.; Yu, H. L.; Zheng, Y. N.; Chen, L. Isolation, synthesis and structures of ginsenoside derivatives and their anti-tumor bioactivity. Molecules 2010, 15, 399−406. (18) Zhang, B.; Zhu, X. M.; Hu, J. N.; Ye, H.; Luo, T.; Liu, X. R.; Li, H. Y.; Li, W.; Zheng, Y. N.; Deng, Z. Y. Absorption mechanism of ginsenoside compound K and its butyl and octyl ester prodrugs in Caco-2 cells. J. Agric. Food Chem. 2012, 60, 10278−10284. (19) Zhang, B.; Ye, H.; Zhu, X. M.; Hu, J. N.; Li, H. Y.; Tsao, R.; Deng, Z. Y.; Zheng, Y. N.; Li, W. Esterification enhanced intestinal absorption of ginsenoside Rh2 in Caco-2 cells without impacts on its protective effects against H2O2-induced cell injury in human umbilical vein endothelial cells (HUVECs). J. Agric. Food Chem. 2014, 62, 2096−2103. (20) Gupta, S. C.; Hevia, D.; Patchva, S.; Park, B.; Koh, W.; Aggarwal, B. B. Upsides and downsides of reactive oxygen species for cancer: the roles of reactive oxygen species in tumorigenesis, prevention, and therapy. Antioxid. Redox Signaling 2012, 16, 1295− 1322. (21) Martindale, J. L.; Holbrook, N. J. Cellular response to oxidative stress: signaling for suicide and survival. J. Cell. Physiol. 2002, 192, 1− 15. (22) Hasegawa, H.; Lee, K. S.; Nagaoka, T.; Tezuka, Y.; Uchiyama, M.; Kadota, S.; Saiki, I. Pharmacokinetics of ginsenoside deglycosylated by intestinal bacteria and its transformation to biologically active fatty acid esters. Biol. Pharm. Bull. 2000, 23, 298−304. (23) Bae, E. A.; Han, M. J.; Kim, E. J.; Kim, D. H. Transformation of ginseng saponins to ginsenoside Rh2 by acids and human intestinal bacteria and biological activities of their transformants. Arch. Pharmacal Res. 2004, 27, 61−67. (24) Fischer, D.; Li, Y.; Krieglstein, J.; Kissel, T. In vitro cytotoxicity testing of polycations: influence of polymer structure on cell viability and hemolysis. Biomaterials 2003, 24, 1121−1131. (25) Liu, J. W.; Yang, F.; Zhang, Y.; Li, J. Y. Studies on the cellimmunosuppressive mechanism of oridonin from Isodon serra. Int. Immunopharmacol. 2007, 7, 945−954. (26) Vermes, I.; Haanen, C.; Steffens-Nakken, H.; Reutellingsperger, C. A novel assay for apoptosis flow cytometric detection of phosphatidylserine expression on early apoptotic cells using fluorescein labelled Annexin V. J. Immunol. Methods 1995, 184, 39−51. (27) Riccardi, C.; Nicoletti, I. Analysis of apoptosis by propidium iodide staining and flow cytometry. Nat. Protoc. 2006, 1, 1458−1461. (28) Li, J. L.; Zhao, W.; Zhou, C.; Zhang, Y. X.; Li, H. M.; Tang, Y. L.; Liang, X. H.; Chen, T.; Tang, Y. J. Comparison of carbon-sulfur and carbon-amine bond in therapeutic drug: 4β-S-aromatic heterocyclic podophyllum derivatives display antitumor activity. Sci. Rep. DOI: 201551481410.1038/srep14814. (29) Pereira-Caro, G.; Bravo, L.; Madrona, A.; Espartero, J. L.; Mateos, R. Uptake and metabolism of new synthetic lipophilic derivatives, hydroxytyrosyl ethers, by human hepatoma HepG2 cells. J. Agric. Food Chem. 2010, 58, 798−806.

modulation of Bcl-2 family proteins, disruption of mitochondrial membrane stability, release of Cyt C, and activation of caspase cascades. In addition, intracellular ROS overproduction acted as a mediator in Rh2-O-induced HepG2 cell apoptosis. The findings above all suggested that Rh2-O- and Rh2-induced HepG2 cell apoptosis may involve similar mechanisms. The better antitumor activity of Rh2-O than of Rh2 was probably due to its higher cellular uptake.

■

AUTHOR INFORMATION

Corresponding Author

*(J.-N.H.) Phone: + 86 88304449-8226. E-mail: [email protected]. Funding

This work was supported by the National Natural Science Foundation of China (Grant 31360370, the Foundation of Jiangxi Educational Committee (Grant GJJ14092), the Research Program of State Key Laboratory of Food Science and Technology, Nanchang University (No. SKLF-ZZA201303), and the Research Foundation for Young Scientists of State Key Laboratory of Food Science and Technology, Nanchang University, China (No. SKLF-QN-201515). Notes

The authors declare no competing financial interest.

■

REFERENCES

(1) Yuan, C. S.; Wang, C. Z.; Wicks, S. M.; Qi, L. W. Chemical and pharmacological studies of saponins with a focus on American ginseng. J. Ginseng Res. 2010, 34, 160−167. (2) Chung, K. S.; Cho, S. H.; Shin, J. S.; Kim, D. H.; Choi, J. H.; Choi, S. Y.; Rhee, Y. K.; Hong, H. D.; Lee, K. T. Ginsenoside Rh2 induces cell cycle arrest and differentiation in human leukemia cells by upregulating TGF-β expression. Carcinogenesis 2013, 34, 331−340. (3) Li, Q. Y.; Chen, L.; Fu, W. H.; Li, Z. D.; Wang, B.; Shi, X. J.; Zhong, M. K. Ginsenoside Rb1 inhibits proliferation and inflammatory responses in rat aortic smooth muscle cells. J. Agric. Food Chem. 2011, 59, 6312−6318. (4) Lee, K. Y.; Park, J. A.; Chung, E.; Lee, Y. H.; Kim, S.; Lee, S. K. Ginsenoside-Rh2 blocks the cell cycle of SK-HEP- 1 cells at the Gl/S boundary by selectively inducing the protein expression of p27Kip1. Cancer Lett. 1996, 110, 193−200. (5) Choo, M. K.; Park, E. K.; Han, M. J.; Kim, D. H. Antiallergic activity of ginseng and its ginsenoside. Planta Med. 2003, 69, 518−522. (6) Bae, E. A.; Han, M. J.; Choo, M. K.; Park, S. Y.; Kim, D. H. Metabolism of 20(S)- and 20(R)-ginsenoside Rg3 by human intestinal bacteria and its relation to in vitro biological activities. Biol. Pharm. Bull. 2002, 25, 58−63. (7) Park, H. M.; Kim, S. J.; Kim, J. S.; Kang, H. S. Reactive oxygen species mediated ginsenoside Rg3- and Rh2-induced apoptosis in hepatoma cells through mitochondrial signaling pathways. Food Chem. Toxicol. 2012, 50, 2736−2741. (8) Wu, N.; Wu, G. C.; Hu, R.; Li, M.; Feng, H. Ginsenoside Rh2 inhibits glioma cell proliferation by targeting microRNA-128. Acta Pharmacol. Sin. 2011, 32, 345−353. (9) Kim, M. J.; Yun, H.; Kim, D. H. AMP-activated protein kinase determines apoptotic sensitivity of cancer cells to ginsenoside-Rh2. J. Ginseng Res. 2014, 38, 16−21. (10) Zhang, C.; Yu, H.; Hou, J. Effects of 20(S)-ginsenoside Rh2 and 20(R)-ginsenoside Rh2 on proliferation and apoptosis of human lung adenocarcinoma A549 cells. Zhongguo Zhongyao Zazhi 2011, 36, 1670−1674. (11) Choi, S.; Oh, J. Y.; Kim, S. J. Ginsenoside Rh2 induces Bcl-2 family proteins-mediated apoptosis in vitro and in xenografts in vivo models. J. Cell. Biochem. 2011, 112, 330−340. (12) Gu, Y.; Wang, G. J.; Sun, J. G.; Jia, Y. W.; Wang, W.; Xu, M. J.; Lv, T.; Zheng, Y. T.; Sai, Y. Pharmacokinetic characterization of 260

DOI: 10.1021/acs.jafc.5b05450 J. Agric. Food Chem. 2016, 64, 253−261

Article

Journal of Agricultural and Food Chemistry (30) Anarjan, N.; Tan, C. P.; Ling, T. C.; Lye, K. L.; Malmiri, H. J.; Nehdi, I. A.; Cheah, Y. K.; Mirhosseini, H.; Baharin, B. S. Effect of organic-phase solvents on physicochemical properties and cellular uptake of astaxanthin nanodispersions. J. Agric. Food Chem. 2011, 59, 8733−8741. (31) Liang, W. Z.; Chou, C. T.; Hsu, S. S.; Liao, W. C.; Shieh, P.; Kuo, D. H.; Tseng, H. W.; Kuo, C. C.; Jan, C. R. The involvement of mitochondrial apoptotic pathway in eugenol-induced cell death in human glioblastoma cells. Toxicol. Lett. 2015, 232, 122−132. (32) Jiang, G. B.; Zheng, X.; Yao, J. H.; Han, B. J.; Li, W.; Wang, J.; Huang, H. L.; Liu, Y. J. Ruthenium(II) polypyridyl complexes induce BEL-7402 cell apoptosis by ROS-mediated mitochondrial pathway. J. Inorg. Biochem. 2014, 141, 170−179. (33) Shalini, S.; Dorstyn, L.; Dawar, S.; Kumar, S. Old, new and emerging functions of caspases. Cell Death Differ. 2015, 22, 526−539. (34) Zermati, Y.; Garrido, C.; Amsellem, S.; Fishelson, S.; Bouscary, D.; Valensi, F.; Varet, B.; Solary, E.; Hermine, O. Caspase activation is required for terminal erythroid differentiation. J. Exp. Med. 2001, 193, 247−254. (35) Simon, H. U.; Yehia, A. H.; Schaffer, F. L. Role of reactive oxygen species (ROS) in apoptosis induction. Apoptosis 2000, 5, 415− 418. (36) Lei, J.; Li, X.; Gong, X. J.; Zheng, Y. N. Isolotion, synthesis and structures of cytotoxic ginsenoside derivatives. Molecules 2007, 12, 2140−2150. (37) Lopez, J.; Tait, S. W. G. Mitochondrial apoptosis: killing cancer using the enemy within. Br. J. Cancer 2015, 112, 957−962. (38) Cory, S.; Adams, J. M. The Bcl-2 family: regulators of the cellular life-or-death switch. Nat. Rev. Cancer 2002, 2, 647−656. (39) Xia, T.; Wang, J. C.; Xu, W.; Xu, L. H.; Lao, C. H.; Ye, Q. X.; Fang, J. P. 20(S)-Ginsenoside Rh2 induces apoptosis in human leukaemia Reh cells through mitochondrial signaling pathways. Biol. Pharm. Bull. 2014, 37, 248−254.

261

DOI: 10.1021/acs.jafc.5b05450 J. Agric. Food Chem. 2016, 64, 253−261