Ethylene Perception Is Associated with Methyl-Jasmonate-Mediated

Article pubs.acs.org/JAFC

Cite This: J. Agric. Food Chem. 2019, 67, 6725−6735

Ethylene Perception Is Associated with Methyl-Jasmonate-Mediated Immune Response against Botrytis cinerea in Tomato Fruit Wenqing Yu,† Mengmeng Yu,† Ruirui Zhao,† Jiping Sheng,‡ Yujing Li,† and Lin Shen*,† †

College of Food Science and Nutritional Engineering, China Agricultural University, Beijing 100083, People’s Republic of China School of Agricultural Economics and Rural Development, Renmin University of China, Beijing 100872, People’s Republic of China

Downloaded via UNIV FRANKFURT on July 25, 2019 at 08:57:39 (UTC). See https://pubs.acs.org/sharingguidelines for options on how to legitimately share published articles.

‡

ABSTRACT: Jasmonic acid (JA)- and ethylene-mediated signaling pathways are reported to have synergistic effects on inhibiting gray mold. The present study aimed to explain the role of ethylene perception in methyl jasmonate (MeJA)-mediated immune responses. Results showed that exogenous MeJA enhanced disease resistance, accompanied by the induction of endogenous JA biosynthesis and ethylene production, which led to the activation of the phenolic metabolism pathway. Blocking ethylene perception using 1-methylcyclopropene (1-MCP) either before or after MeJA treatment could differently weaken the disease responses induced by MeJA, including suppressing the induction of ethylene production and JA contents and reducing activities of lipoxygenase and allene oxide synthase compared to MeJA treatment alone. Consequently, MeJA-induced elevations in the total phenolic content and the activities of phenylalanine ammonia-lyase, cinnamate 4-hydroxylase, 4coumarate:coenzyme A ligase, and peroxidase were impaired by 1-MCP. These results suggested that ethylene perception participated in MeJA-mediated immune responses in tomato fruit. KEYWORDS: methyl jasmonate, ethylene perception, 1-methylcyclopropene, immune response, Botrytis cinerea, tomato fruit

■

INTRODUCTION Tomato (Solanum lycopersicum) is a horticultural commodity with superior economic value, which was also widely used as a model in the field of fruit postharvest diseases, because it displays great vulnerability to postharvest rot caused by various fungal pathogens.1,2 Botrytis cinerea is one of the most destructive fungi of tomato, which can infect tomato fruit through epicarpic wounds caused during harvesting. With time, the disease progresses and a fuzzy gray mold develops during storage, which lessens shelf life and reduces consumer acceptability, resulting in significant economic loss.3,4 Salicylic acid (SA)-, jasmonic acid (JA)-, and ethylene (ET)mediated signaling pathways are important in response to pathogen attack.5 In general, SA-mediated signaling is mainly required to defend against biotrophic pathogens, whereas defense against necrotrophic pathogens, such as B. cinerea, is mainly dependent upon JA- and/or ET-mediated signaling.6 The plant hormone, JA, and its volatile methyl ester, methyl jasmonate (MeJA), are well-studied activators of plant defense.7,8 Evidence has shown that MeJA could potentially induce immune response against pathogen infection and inhibit various postharvest rots of tomato, such as Alternaria diseases caused by Alternaria alternate and Alternaria porri f. sp. solani,9,10 Fusarium wilt caused by Fusarium oxysporum f. sp. lycopersici,11 and gray mold rot caused by B. cinerea.12−15 MeJA treatment effectively mitigated the disease development of tomato caused by pathogens, by (1) activation of the phenylpropanoid pathway and the accumulation of total phenolics,10,15 (2) induction of defense-related enzymes, such as pathogenesis-related proteins (PRs), and peroxidase (POD),11,15 and (3) inhibition of pathogen-induced oxidative stress by promoting both activities and transcript levels of antioxidant enzymes.12 Moreover, previous studies have © 2019 American Chemical Society

documented that ethylene biosynthesis could be induced by exogenous MeJA, and 1-aminocyclopropane-1-carboxylic acid oxidase (ACO), which is the key enzyme in ethylene biosynthesis, was associated with MeJA-induced disease resistance in tomato.13,14 The above results revealed that ethylene biosynthesis is important for MeJA-mediated immune responses in tomato; however, whether ethylene perception is required for MeJA-induced disease resistance needs to be investigated. Ethylene, a simple gaseous phytohormone, has long been proposed to play critical roles in plant immune responses.16,17 When infected by B. cinerea, tomato plants activated ethylene biosynthesis and signaling transduction in response to pathogen attack.18 Indeed, not only is ethylene biosynthesis and signaling transduction important, but ethylene perception is also important for plant resistance against necrotrophic pathogens,19,20 as attested by the fact that the impaired perception of ethylene via silencing ethylene receptor (ETR) gene AtETR1 resulted in increased disease resistance.21 Accordingly, tomato Never ripe (Nr) mutant, in which ethylene perception is impaired, showed decreased disease symptoms.20,22 In addition, in the SlETR4-silenced plants, disease incidence and severity were reduced, suggesting that impaired perception of ethylene via the ETR4 receptor resulted in increased disease resistance.22 Although the involvement of ethylene perception in disease resistance has been documented, little is known about the relationship between Received: Revised: Accepted: Published: 6725

April 4, 2019 May 18, 2019 May 20, 2019 May 22, 2019 DOI: 10.1021/acs.jafc.9b02135 J. Agric. Food Chem. 2019, 67, 6725−6735

Article

Journal of Agricultural and Food Chemistry

25 ± 1 °C. (4) MeJA: tomato fruit was prefumigated with distilled water at 25 ± 1 °C for 12 h and then rinsed with distilled water for 1 min. After drying, fruit was fumigated with 0.1 mM MeJA for 12 h at 25 ± 1 °C.15 (5) MeJA + 1-MCP: tomato fruit was prefumigated with 0.1 mM MeJA at 25 ± 1 °C for 12 h and then rinsed with distilled water for 1 min. After drying, fruit was fumigated with 0.5 μL L−1 1MCP for 12 h at 25 ± 1 °C. After treatment, all fruit was rinsed with distilled water for 1 min, air-dried (time 0), and then stored at 25 ± 1 °C with 85−90% relative humidity (RH) for 9 days. A total of 5 fruit from each group were randomly sampled on 0, 0.125, 0.5, 0.75, 1, 3, 6, and 9 days during storage for assay of the JA content, lipoxygenase (LOX) activity, allene oxide synthase (AOS) activity, Solanum lycopersicum coronatineinsensitive 1 (SlCOI1) relative expression, total phenolic content, and activities of phenylalanine ammonia-lyase (PAL), cinnamate 4hydroxylase (C4H), 4-coumarate:coenzyme A ligase (4CL), and POD. Mesocarp tissue from the fruit equator area was cut into small pieces, frozen immediately in liquid nitrogen, and then stored at −80 °C until used. A total of 10 fruit from each group were chosen separately for measurement of disease symptoms. For ethylene production detection, 10 fruit from each group were taken on different days. Three biological replicates were carried out in this experiment. Pathogen Inoculation. The pathogen B. cinerea (ACCC 36028) was purchased from the Agricultural Culture Collection of China (Haidian, Beijing) and cultured according to Zheng et al.31 The spore suspension of B. cinerea was obtained by washing 1 week old fungal cultures with 0.01% Tween 80 solution and then filtered through the sterile gauze. The concentration of spore suspension (2 × 106 spore mL−1) was modified by the aid of a hemocytometer.31 At 24 h after treatment, at each fruit equatorial region, three uniform holes (2 mm wide × 4 mm deep) were gently made with a sterile nail and then 10 μL of B. cinerea spore suspension were inoculated to each wound.15 Each inoculated fruit was placed in a single plastic bag and then incubated at 25 ± 1 °C with 90−95% RH for disease development. Three biological replicates were carried out in this experiment. Determination of Disease Symptoms. On the fourth day after inoculation, disease incidence and lesion diameter were recorded.15 Disease incidence was calculated as the percentage of the inoculated spot showing visible gray mold lesion, and lesion diameter was measured with the cross method.15,32 Determination of the Ethylene Content. Ethylene production was assayed as described by Yu et al.15 A total of 10 tomato fruit from each group were sealed in a 9 L airtight chamber at 25 °C and incubated for 1 h. Triplicate 1 mL of the headspace gas sample was sucked out and injected into the gas chromatograph (GC-14C, Shimadzu, Kyoto, Japan) for ethylene determination. The flow rates used for nitrogen carrier gas, air, and hydrogen were 50, 400, and 45 mL min−1. The temperatures of the column and injector were 50 and 120 °C. The ethylene content was expressed as nanomoles per gram of fresh weight (FW) per hour. All results were replicated 3 times. Determination of the Endogenous JA Content. The JA content was measured using an enzyme-linked immunosorbent assay (ELISA) kit, with the polyclonal anti-JA antibody.13 Frozen tomato tissue (2.0 g, in powder form) was homogenized with 5 mL of extraction buffer [80% methanol, containing 1% (w/v) polyvinylpyrrolidone (PVP) and 0.6% (w/v) benzothiadiazole]. After extraction with ultrasonic at 4 °C overnight, the homogenate was centrifuged at 10000g for 20 min at 4 °C. The supernatant was dried with nitrogen and then dissolved in the extracting solution to a volume of 1.5 mL before ELISA. The JA content was assayed at 490 nm, which was expressed as nanograms per gram of FW. Determination of LOX and AOS Activities. To determine the activities of LOX (EC 1.13.11.12) and AOS (EC 4.2.1.92), frozen tomato tissue (2.0 g, in powder form) was extracted with 5 mL of 50 mM phosphate buffer (pH 7.0) and centrifuged at 10000g for 15 min at 4 °C. The supernatant was collected and used for LOX and AOS enzyme determination. LOX activity was measured as described by Yu et al.,13 by measuring the formation of conjugated diene from

ethylene perception and MeJA-mediated disease resistance against gray mold in postharvest tomato fruit. 1-Methylcyclopropene (1-MCP) is thought to block ethylene perception, retard ethylene responses, and inhibit ethylene-dependent processes, such as ripening and senescence, as a result of its effect on competing with ethylene for a binding site on ethylene receptors.23,24 Extensive studies have proven its inhibition effect on ethylene perception, and some studies also showed that 1-MCP application could effectively improve disease resistance against pathogens in various fruits, including loquat,24 jujube,25 sweet potato,26 strawberry,27 and tomato.28,29 Exogenous 1-MCP treatment significantly improved fruit disease resistance by (1) maintaining fruit natural resistance, such as delaying senescence development, and retaining firmness,24,25,29 (2) inhibiting the increase in electrical conductivity and malondialdehyde content,29 (3) decreasing reactive oxygen species (ROS) accumulation and increasing the activities of some key antioxidant enzymes,24,25 and (4) inducing higher activities of defense-related enzymes, such as chitinase and β-1,3-glucanase.24,29 In addition, it has been reported that 1-MCP pretreatment weakened the disease resistance induced by Cryptococcus laurentii in tomato fruit and downregulated the expression of genes that were related to ethylene perception.28 Moreover, a previous study showed that exogenous MeJA could enhance ester regeneration in 1-MCPpretreated apple fruit, accompanied by the upregulation of genes related to ethylene perception. 30 However, the interaction between MeJA and 1-MCP on disease resistance against gray mold was still not clear. Previous studies have reported that both ethylene biosynthesis and ethylene signaling component Solanum lycopersicum ethylene response factor 2 (SlERF2) played crucial roles in MeJA-mediated disease resistance.14,15 The present study explored the relationship between ethylene perception and MeJA-mediated disease resistance in tomato fruit. This study aims to do the following: (1) determine the effect of exogenous MeJA on endogenous JA biosynthesis, (2) investigate whether there is a positive relationship between endogenous ethylene and JA after MeJA treatment, and (3) evaluate the change in MeJA-mediated disease resistance against gray mold in tomato fruit, either before or after blocking ethylene perception by 1-MCP.

■

MATERIALS AND METHODS

Fruit Materials and Treatments. Green mature tomato fruit (S. lycopersicum cv. Lichun) was harvested from a local commercial greenhouse in Beijing, China, and then transported to our laboratory within 2 h. The selected fruit of uniform shape, ripeness, size, and without calyxes and visible blemishes were used for the following experiments. At 18 h after harvesting, fruit was surface-sterilized with 2% (v/v) sodium hypochlorite aqueous solution for 2 min, then rinsed thoroughly with tap water, and air-dried. All tomato fruit was randomly assigned to five groups containing 70 fruit each, and all treatments were applied in 50 L airtight containers. 1-MCP can block ethylene perception by interacting with ethylene receptors. The fumigation treatments were applied as follows: (1) Control: tomato fruit was fumigated with distilled water at 25 ± 1 °C for 12 h and then rinsed with distilled water for 1 min. After drying, fruit was fumigated with distilled water for 12 h at 25 ± 1 °C. (2) 1MCP: tomato fruit was prefumigated with distilled water at 25 ± 1 °C for 12 h and then rinsed with distilled water for 1 min. After drying, fruit was fumigated with 0.5 μL L−1 1-MCP at 25 ± 1 °C for 12 h.29 (3) 1-MCP + MeJA: tomato fruit was prefumigated with 0.5 μL L−1 1-MCP at 25 ± 1 °C for 12 h and then rinsed with distilled water for 1 min. After drying, fruit was fumigated with 0.1 mM MeJA for 12 h at 6726

DOI: 10.1021/acs.jafc.9b02135 J. Agric. Food Chem. 2019, 67, 6725−6735

Article

Journal of Agricultural and Food Chemistry Table 1. Sequences of Specific Primers Used for qPCR Analysis name

accession number

forward primer (5′ → 3′)

reverse primer (5′ → 3′)

SlCOI1 SlUbi3

NM_001247535.1 NM_001346406.1

TGGGAGTGTGTGATTCCGTA TCCATCTCGTGCTCCGTCT

AACTGCTCTGGTTTCGCTGT CTGAACCTTTCCAGTGTCATCAA

Figure 1. Effects of 1-MCP, MeJA, (1-MCP + MeJA), and (MeJA + 1-MCP) treatments on (A) disease incidence and (B) lesion diameter in tomato fruit. 1-MCP indicated tomato fruit fumigated with 0.5 μL L−1 1-MCP alone. (1-MCP + MeJA) indicated tomato fruit prefumigated with 0.5 μL L−1 1-MCP and then followed by fumigating with 0.1 mM MeJA. MeJA indicated tomato fruit fumigated with 0.1 mM MeJA alone. (MeJA + 1-MCP) indicated tomato fruit prefumigated with 0.1 mM MeJA and then followed by fumigating with 0.5 μL L−1 1-MCP. At 24 h after treatments, all fruit was inoculated with 10 μL of B. cinerea (2 × 106 conidia/mL) and then stored at 25 °C with 90−95% RH for disease development. Data are the mean values of three biological replicates ± SD. Values followed by different letters for each treatment were significantly different according to Duncan’s multiple range test at p < 0.05. was defined as the 0.01 increase in absorbance at 270 nm per hour.31 C4H activity was assayed from the generation of p-coumaric acid from trans-cinnamic acid, and 1 unit of C4H activity was defined as the 0.01 increase in absorbance at 340 nm per hour.34 4CL activity was assayed from the generation of p-coumaroyl-CoA from p-coumaric acid, and 1 unit of 4CL activity was defined as the 0.01 increase in absorbance at 334 nm per hour.34 POD activity was assayed from the oxidation of guaiacol, and 1 unit of POD activity was defined as the 0.1 increase in absorbance at 470 nm per minute.1 Quantitative Real-Time Polymerase Chain Reaction (qRTPCR) Analysis. Total RNA was extracted from frozen tomato tissue (0.15 g, in powder form) using an EasyPure Plant RNA Kit (Beijing Transgen Biotech Co., Ltd., Beijing, China). The total RNA was quantified by a NanoDrop 2000 Photometer spectrophotometer (Thermo Fisher Scientific, Waltham, MA, U.S.A.) and then stored at −80 °C. A total of 2 μg of RNA was used for first-strand cDNA synthesis, using the TransScript One-Step gDNA Removal and cDNA Synthesis SuperMix Kit (Beijing Transgen Biotech Co., Ltd., Beijing, China). The cDNA was stored at −20 °C until use.15 qRT-PCR was performed using the TransStrat Top Green qPCR SuperMix (Beijing TransGen Biotech Co., Ltd., Beijing, China) on a Bio-Rad CFX96 real-time PCR system (Bio-Rad, Hercules, CA, U.S.A.). The qRT-PCR reaction mixture (in a total volume of 10 μL per reaction) was as follows: 5 μL of 2× SuperMix, 0.3 μL of specific primers (Table 1), 1 μL of cDNA, and 3.4 μL of RNase-free water. The qRT-PCR thermal cycling condition was as follows: initial denaturation for 30 s at 94 °C, followed by 40 cycles of 5 s at 94 °C, 15 s at 60 °C, and 15 s at 72 °C, and a melt cycle from 65 to 95 °C.15 SlUbi3 was served as an endogenous reference gene, and the relative expression was normalized to the SlUbi3 Ct value using the 2−ΔΔCt method. Statistical Analysis. All data were obtained from three independent replicates, and the data were expressed as the mean ± standard deviation (SD). Statistical evaluations were conducted by one-way analysis of variance and Duncan’s multiple range tests with

hydroxyl fatty acids at 234 nm and using linoleic acid sodium as the substrate. AOS activity was measured as described by Sivasankar et al.,33 with slight modifications, by monitoring the decrease in absorbance at 234 nm as a result of the degradation of the substrate. The activities of LOX and AOS were calculated on the basis of FW, which were expressed as units per gram of FW. All results were replicated 3 times. Determination of the Total Phenolic Content. Frozen tomato tissue (2.0 g, in powder form) was extracted with 10 mL of 1% HCl− methanol (v/v) and then centrifuged at 10000g for 10 min at 4 °C. The supernatant was collected and used for the total phenolic content assay.15 The total phenolic content was calculated on the basis of a standard curve of gallic acid, and the results was expressed as micrograms per gram of FW. Determination of Enzyme Activities in the Phenolic Metabolism Pathway. The activities of PAL (EC 4.3.1.5), C4H (EC 1.14.13.11), 4CL (EC 6.2.1.12), and POD (EC 1.11.1.7) were calculated on the basis of FW, which were expressed as units per gram of FW. For analysis of PAL activity, frozen tomato tissue (2.0 g) was extracted with 5 mL of 0.2 mM boric acid buffer [pH 8.8, containing 10% (w/v) PVP, 1 mM EDTA, and 5 μM β-mercaptoethanol].31 For analysis of C4H activity, frozen tomato tissue (2.0 g) was extracted with 5 mL of 50 mM Tris−HCl buffer [pH 8.9, containing 15 mM βmercaptoethanol, 4 mM MgCl2, 5 mM ascorbic acid, 10 μM leupeptin, 1 mM phenylmethylsulfonyl fluoride (PMSF), 0.15% (w/ v) polyvinylpyrrolidone (PVP), and 10% (v/v) glycerol].34 For analysis of 4CL activity, frozen tomato tissue (2.0 g) was extracted with 5 mL of 0.2 mM Tris−HCl buffer [pH 7.5, containing 8 mM MgCl2, 2% (w/v) PVP, 5 mM dithiothreitol (DTT), 0.1% (v/v) Triton X-100, and 1 mM PMSF].34 For analysis of POD activity, frozen tomato tissue (2.0 g) was extracted with 5 mL of 0.1 M phosphate-buffered saline (pH 7.0).1 After centrifugation at 10000g for 10 min at 4 °C, the supernatants were collected and used for the enzyme activity assay. PAL activity was assayed from the generation of trans-cinnamic acid from L-phenylalanine, and 1 unit of PAL activity 6727


Article

Journal of Agricultural and Food Chemistry the aid of SPSS20.0 (IBM Corp., Armonk, NY, U.S.A.). Differences at p < 0.05 were considered as statistical significance. Pearson’s correlation analysis was used to evaluate the relationships among the ethylene content, JA biosynthesis, total phenolic content, and enzyme activities related to the phenolic metabolism pathway.

■

RESULTS Effects of 1-MCP, MeJA, (1-MCP + MeJA), and (MeJA + 1-MCP) Treatments on Disease Incidence and Lesion Diameter. On the fourth day after inoculation with B. cinerea, 1-MCP treatment decreased disease incidence and lesion diameter, which were 40.4 and 45.6% lower than those in the control (p < 0.05; Figure 1). Consistent with our previous report,15 in comparison to the control, disease incidence and lesion diameter were significantly decreased by 35.1 and 37.7% after single MeJA treatment (p < 0.05; Figure 1). However, either before or after fumigation with 1-MCP exerted a negative influence on the MeJA-induced disease symptoms. By prefumigation with 1-MCP, the MeJA-induced decrease in disease symptoms was impaired and the disease incidence and lesion diameter in (1-MCP + MeJA)-treated fruit were 1.16 and 1.41 times higher than those in single MeJA-treated fruit (p < 0.05; Figure 1). In addition, MeJA-induced disease resistance could also be abolished after 1-MCP fumigation, and disease incidence in (MeJA + 1-MCP)-treated fruit was inhibited by 8.8% compared to the control, whose inhibitory effect was 75.0% lower than that in single MeJA-treated fruit (p < 0.05; Figure 1A). Contrastingly, as for lesion diameter, no significant difference was observed between single MeJAtreated and (MeJA + 1-MCP)-treated fruit (p > 0.05; Figure 1B). These results suggested that ethylene perception could be associated with MeJA-mediated disease resistance in tomato fruit. Effects of 1-MCP, MeJA, (1-MCP + MeJA), and (MeJA + 1-MCP) Treatments on Ethylene Production. In single 1-MCP-treated fruit, ethylene levels remained nearly unchanged throughout the experiment period, which were significantly lower than those in the control (p < 0.05; Figure 2A). In single MeJA-treated fruit, ethylene began to increase at the beginning of 0.5 day and one peak was exhibited on the first day, which was 3.17 times higher than that in the control (p < 0.05; Figure 2A). However, blocking ethylene perception, either before or after fumigation with 1-MCP weakened the effect of MeJA on ethylene production. In 1-MCP prefumigated and MeJA-treated fruit, ethylene production increased gradually and reached a maximum on the third day (p < 0.05; Figure 2B). In fruit treated with MeJA followed by 1-MCP fumigation, ethylene production shared a trend similar to the single MeJA-treated fruit, while the peak value was 15.0% lower than that in single MeJA-treated fruit on the first day (p < 0.05; Figure 2B). Effects of 1-MCP, MeJA, (1-MCP + MeJA), and (MeJA + 1-MCP) Treatments on the JA Pathway. MeJA treatment induced endogenous JA biosynthesis and then upregulated SlCOI1 expression. Moreover, blocking ethylene perception either before or after treatment with MeJA suppressed the activation of the JA pathway (Figure 3). JA contents in single MeJA-treated fruit were drastically elevated, which retained significantly higher levels than those in the control (p < 0.05; Figure 3A). Blocking ethylene perception with 1-MCP influenced the effect of MeJAimproved content of JA. 1-MCP prefumigation inhibited the increase in JA contents induced by MeJA, and JA contents in

Figure 2. Effects of (A) 1-MCP and MeJA and (B) (1-MCP + MeJA) and (MeJA + 1-MCP) treatments on ethylene production in tomato fruit. 1-MCP indicated tomato fruit fumigated with 0.5 μL L−1 1-MCP alone. MeJA indicated tomato fruit fumigated with 0.1 mM MeJA alone. (1-MCP + MeJA) indicated tomato fruit prefumigated with 0.5 μL L−1 1-MCP and then followed by fumigating with 0.1 mM MeJA. (MeJA + 1-MCP) indicated tomato fruit prefumigated with 0.1 mM MeJA and then followed by fumigating with 0.5 μL L−1 1-MCP. Data are the mean values of three biological replicates ± SD. Values followed by different letters for each treatment were significantly different according to Duncan’s multiple range test at p < 0.05.

(1-MCP + MeJA)-treated fruit were 13.4, 21.4, 38.4, 31.7, and 32.4% lower than those in single MeJA-treated fruit (p < 0.05; Figure 3A). In contrast, 1-MCP fumigation after MeJA treatment had less effect on JA contents, which had no significant difference with the single MeJA-treated fruit, except for days 1 and 3 (p > 0.05; Figure 3A). LOX activity in single MeJA-treated fruit increased rapidly, peaked on day 0.5 at 11.28 units g−1 of FW, and then gradually declined during the remaining time (p < 0.05; Figure 3B). Treatment with 1-MCP suppressed MeJA-induced elevation in LOX activity. In 1-MCP prefumigated and MeJA-treated fruit, LOX activity increased gradually and reached a maximum of 7.40 units g−1 of FW on the first day (Figure 3B). Moreover, LOX activities in fruit treated with MeJA followed by 1-MCP fumigation were 29.2 and 20.5% lower than those in single MeJA-treated fruit on days 0.5 and 9 (p < 0.05; Figure 3B). After the first day, single MeJA-treated fruit maintained remarkably higher AOS activities, which was 54.4, 49.3, and 6728


Article


Figure 3. Effects of 1-MCP, MeJA, (1-MCP + MeJA), and (MeJA + 1-MCP) treatments on the (A) JA content, (B) LOX activity, (C) AOS activity, and (D) SlCOI1 relative expression in tomato fruit. 1-MCP indicated tomato fruit fumigated with 0.5 μL L−1 1-MCP alone. (1-MCP + MeJA) indicated tomato fruit prefumigated with 0.5 μL L−1 1-MCP and then followed by fumigating with 0.1 mM MeJA. MeJA indicated tomato fruit fumigated with 0.1 mM MeJA alone. (MeJA + 1-MCP) indicated tomato fruit prefumigated with 0.1 mM MeJA and then followed by fumigating with 0.5 μL L−1 1-MCP. Data are the mean values of three biological replicates ± SD. Values followed by different letters for each treatment were significantly different according to Duncan’s multiple range test at p < 0.05.

Pathway. In comparison to the control, MeJA treatment maintained higher total phenolic content and elevated activities of four key enzymes related to the phenolic metabolism pathway. Moreover, either before or after blocking ethylene perception by 1-MCP could weaken the effect of MeJA on the phenolic metabolism pathway (Figure 4). Total phenolic contents were 16.2, 19.5, 24.1, and 21.5% higher after MeJA treatment than those in the control on days 0.5, 1, 3, and 6, but the elevated effect decreased differently either before or after fumigation with 1-MCP (p < 0.05; Figure 4A). By prefumigation with 1-MCP, the MeJA-induced increase in total phenolic contents was significantly lower than that in single MeJA-treated fruit during storage, except for days 0.5 and 9 (p < 0.05; Figure 4A). 1-MCP fumigation after MeJA treatment could also significantly decrease total phenolic contents, which led to 10.5, 13.2, and 13.8% reductions in (MeJA + 1-MCP)-treated fruit on days 1, 3, and 6 compared to single MeJA-treated fruit (p < 0.05; Figure 4A). PAL activity gradually increased in all groups during the entire assay period (Figure 4B). Single MeJA-treated fruit had the highest PAL activities, which was 1.34, 1.73, 1.27, 3.66, and 1.86 times higher than those in the control (p < 0.05; Figure

14.3% higher than those in the control on days 3, 6, and 9 (p < 0.05; Figure 3C). However, fumigation with 1-MCP weakened the effect of MeJA. AOS activities in (1-MCP + MeJA)-treated fruit were 19.2, 21.0, and 26.5% lower than those in single MeJA-treated fruit on days 1, 3, and 6 (p < 0.05; Figure 3C). The change pattern in (MeJA + 1-MCP)-treated fruit was similar to the single MeJA-treated fruit, but the elevated AOS activities decreased after fumigation with 1-MCP, which were 9.2, 19.3, and 11.9% lower than MeJA treatment alone on days 1, 3, and 6 (p < 0.05; Figure 3C). SlCOI1 transcript levels were significantly induced by MeJA, which were 1.21-, 1.68-, 1.68-, 1.60-, 1.67-, and 1.42-fold higher than those in the control (p < 0.05; Figure 3D). The expression levels of SlCOI1 in (1-MCP + MeJA)-treated fruit were 22.3 and 18.8% lower than those in single MeJA-treated fruit on days 0.25 and 0.5 (p < 0.05; Figure 3D). Contrastingly, there was no significant difference in SlCOI1 relative expression between fruit treated with MeJA alone and fruit treated with MeJA followed by 1-MCP fumigation (p > 0.05; Figure 3D). Effects of 1-MCP, MeJA, (1-MCP + MeJA), and (MeJA + 1-MCP) Treatments on the Phenolic Metabolism 6729


Article


Figure 4. Effects of 1-MCP, MeJA, (1-MCP + MeJA), and (MeJA + 1-MCP) treatments on the (A) total phenolic content, (B) PAL activity, (C) C4H activity, (D) 4CL activity, and (E) POD activity in tomato fruit. 1-MCP indicated tomato fruit fumigated with 0.5 μL L−1 1-MCP alone. (1MCP + MeJA) indicated tomato fruit prefumigated with 0.5 μL L−1 1-MCP and then followed by fumigating with 0.1 mM MeJA. MeJA indicated tomato fruit fumigated with 0.1 mM MeJA alone. (MeJA + 1-MCP) indicated tomato fruit prefumigated with 0.1 mM MeJA and then followed by fumigating with 0.5 μL L−1 1-MCP. Data are the mean values of three biological replicates ± SD. Values followed by different letters for each treatment were significantly different according to Duncan’s multiple range test at p < 0.05.

4B). Moreover, PAL activities in (1-MCP + MeJA)-treated fruit were 19.2, 33.4, 14.9, 60.5, and 45.1% lower than those in single MeJA-treated fruit on days 0.5, 1, 3, 6, and 9 (p < 0.05; Figure 4B). In fruit treated with MeJA followed by 1-MCP fumigation, PAL activities were 15.5, 36.3, and 18.4% lower

than those in single MeJA-treated fruit on days 1, 6, and 9 (p < 0.05; Figure 4B). C4H activities in single MeJA-treated fruit displayed a marked increase during the early stages after treatment, which were 22.3, 25.3, and 47.7% higher than those in the control on 6730


Article


Table 2. Pearson’s Correlations among the Ethylene Content, JA Biosynthesis, Total Phenolic Content, and Enzyme Activities Related to the Phenolic Metabolism Pathway

ethylene content JA content LOX activity AOS activity total phenolic content PAL activity C4H activity 4CL activity POD activity

ethylene content

JA content

LOX activity

AOS activity

total phenolic content

PAL activity

C4H activity

4CL activity

POD activity

1.000

0.466a 1.000

0.149 0.329 1.000

0.197 0.523b 0.237 1.000

0.496a 0.561b −0.210 0.202 1.000

0.185 0.201 −0.362 0.095 0.708b 1.000

0.322 0.637b 0.239 0.406a 0.485a 0.129 1.000

0.721b 0.545b 0.235 0.173 0.321 −0.086 0.420a 1.000

0.353 0.731b −0.009 0.427a 0.596b 0.348 0.484a 0.431a 1.000

a

Correlation is significant at the 0.05 level (two tailed). bCorrelation is significant at the 0.01 level (two tailed).

activity, and between 4CL activity and POD activity (p < 0.05). The significant correlations between JA content and AOS activity indicated that AOS played an important role in endogenous JA production after MeJA treatment (p < 0.01).35 In addition, the close relationships among total phenolic content and PAL, C4H, 4CL, and POD activities could possibly be attributed to the fact that they are key enzymes and affect the generation of phenolic compounds in fruit, which contribute to improved disease resistance (p < 0.05).32,34,36 Furthermore, the significant correlations among ethylene, JA, and total phenolic content (p < 0.05), indicated that there were significant positive relationships among ethylene, JA, and total phenolic contents. Besides, the ethylene content was positively correlated with 4CL activity (p < 0.01), and the JA content were positively correlated with C4H, 4CL, and POD activities (p < 0.01), which are involved in the phenolic metabolism. These results implied that both ethylene and JA contents might exert a significant positive effect on the total phenolic content by influencing enzyme activities related to phenolic metabolism, ultimately increasing plant disease resistance against gray mold.34 The present results were supported by previous studies, which indicated that both ethylene and endogenous JA played crucial roles in modulating phenolic metabolism in response to pathogen infection.37,38

days 0.5, 1, and 3 (p < 0.05; Figure 4C). Moreover, by prefumigation with 1-MCP, C4H activities in MeJA-treated fruit were 37.6, 38.5, and 43.7% lower than those in single MeJA-treated fruit on days 0.5, 1, and 3 (p < 0.05; Figure 4C). Conversely, 1-MCP fumigation after MeJA treatment enhanced C4H activities at the late stages of storage, which were 34.0, 38.0, and 52.8% higher than those in the control on days 3, 6, and 9 (p < 0.05; Figure 4C). 4CL activity increased rapidly, peaked on the first day at 7.15 units g−1 of FW in single MeJA-treated fruit, then declined afterward, but still maintained higher 4CL activity than the control during the storage period, except for day 9 (p < 0.05; Figure 4D). However, by prefumigation with 1-MCP, 4CL activities were induced slightly by MeJA treatment on days 0.5 and 1, which reached a maximum of 6.49 units g−1 of FW on the third day (Figure 4D). The changing pattern of 4CL activity in (MeJA + 1-MCP)-treated fruit was similar to the single MeJA-treated fruit, but 4CL activities in single MeJAtreated fruit were 1.36, 1.45, 1.37, and 1.23 times higher than those in (MeJA + 1-MCP)-treated fruit on days 0.5, 1, 3, and 6 (p < 0.05; Figure 4D). MeJA treatment elevated POD activity, and single MeJAtreated fruit retained markedly higher POD activities during the entire assay period compared to the control; however, 1MCP fumigation weakened the increase in POD activity (p < 0.05; Figure 4E). In 1-MCP prefumigated and MeJA-treated fruit, POD activities decreased by 38.5, 35.5, 30.4, 53.6, and 41.1% on days 0.5, 1, 3, 6, and 9 compared to MeJA treatment alone (p < 0.05; Figure 4E). In addition, 1-MCP fumigation after MeJA treatment also reduced POD activities, and 19.4, 25.0, 13.3, 30.9, and 21.4% decreases were shown in (MeJA + 1-MCP)-treated fruit in comparison to MeJA treatment alone (p < 0.05; Figure 4E). Correlation Analysis of the Ethylene Content, JA Biosynthesis, Total Phenolic Content, and Enzyme Activities Related to the Phenolic Metabolism Pathway. As seen in Table 2, positive correlations were shown between ethylene and JA, between ethylene content and total phenolic content, between ethylene content and 4CL activity, between JA content and AOS activity, between JA content and total phenolic content, between JA content and C4H activity, between JA content and 4CL activity, between JA content and POD activity, between AOS and C4H activity, between AOS and POD activity, between total phenolic content and PAL activity, between total phenolic content and C4H activity, between total phenolic content and POD activity, between C4H activity and 4CL activity, between C4H activity and POD

■

DISCUSSION The synergistic interaction between JA and ET on inducing immune response against a necrotrophic pathogen has been reported.6 Exogenous MeJA treatment promoted ethylene biosynthesis and then consequently stimulated ethylene response, which was mediated by conditional activation of ethylene perception.39,40 Relative expression of ETR genes could be upregulated by MeJA treatment, and impaired ethylene perception by silencing SlETR genes has been reported to improve disease resistance and decrease disease symptoms in tomato.20,22,30 Previous studies have presented that both ethylene biosynthesis and the ethylene signaling component SlERF2 were important for MeJA-induced resistance against gray mold,14,15 but there is a lack of knowledge about whether ethylene perception participates in MeJA-mediated immune responses in tomato fruit. This study investigated the relationship between MeJA and ethylene perception in immune responses against B. cinerea in tomato fruit. These findings further extend our understanding on the interaction between MeJA and ethylene in disease resistance. To evaluate the involvement of ethylene perception in MeJA-mediated immune responses, ethylene antagonist 16731


Article


content (p < 0.05; Table 2), indicated that there was a significant positive relationship between endogenous ethylene content and JA content. In addition, 1-MCP fumigation reduced ethylene production and regulated endogenous JA accumulation, suggesting that there might be a feedback regulation between endogenous JA and ethylene. The present result was supported by the findings in tomato that ethylene directly activated the expression of SlAOS, and blocking ethylene biosynthesis downregulated SlAOS expression, which played a crucial role in endogenous JA biosynthesis.33 Besides, blocking JA biosynthesis could also reduce ethylene production by suppressing the activities of ACS and ACO.13 Extensive studies demonstrated that MeJA-induced immune responses could be partially attributed to the activation of the phenylpropanoid pathway, because several phenylpropanoid metabolites are reported to have a direct effect on pathogens.15,34,46 Phenolic compounds, which are critical secondary metabolites produced by the phenylpropanoid pathway, can be directly toxic to the pathogen or be deposited inside the cell walls, acting as a strong mechanical and biochemical barrier against pathogen invasion.47 PAL catalyzes the first step in the phenylpropanoid pathway to generate the phenolic compounds, which is also a widely used index to evaluate disease resistance.36 A previous study presented that overexpression of NtPAL remarkably enhanced disease resistance against Cercospora nicotianae, accompanied by higher levels of chlorogenic acid in tobacco plant.48 C4H and 4CL are also pivotal regulatory enzymes in the phenylpropane pathway, which are positively correlated with the disease resistance against gray mold.34,36 POD participates in the stiffening and strengthening of cell walls by inducing lignification, thereby inhibiting attempted fungal penetration.49 In this study, MeJA treatment significantly enhanced the total phenolic content and elevated activities of PAL, C4H, 4CL, and POD (p < 0.05; Figure 4). These results were in agreement with a previous report, which demonstrated that both higher levels of total phenolic content and increase in these enzyme activities were the primary immune responses induced by MeJA in Chinese bayberry,46 implying that activation of the phenolic metabolism pathway might be relevant to the improved disease resistance in fruit. Besides, either before or after fumigation with 1-MCP disturbed the MeJA-induced elevations in the total phenolic content and PAL, C4H, 4CL, and POD activities (p < 0.05; Figure 4), which might account for the reduced disease resistance in both (1-MCP + MeJA)- and (MeJA + 1-MCP)-treated fruit, suggesting that blocking ethylene perception by 1-MCP attenuated the MeJA-mediated disease resistance in tomato fruit. We summarized our previous results on the interaction between MeJA and the ethylene signaling pathway in disease resistance against gray mold in Figure 5. Endogenous JA was induced at the early stages of B. cinerea infection, which resulted in the activation of phenolic metabolism and accumulation of PRs.50 Exogenous MeJA elevated endogenous levels of JA through stimulating LOX activity, which consequently activated ACO and ethylene biosynthesis.13,14 When ethylene levels were subsequently accumulated, the ethylene signaling component SlERF2 was activated and, consequently, stimulated phenolic metabolism and PR accumulation, which enhanced disease resistance against gray mold.15 In the present study, exogenous MeJA promoted the endogenous JA content through inducing AOS activity. Furthermore, blocking ethylene perception reduced the

MCP was used either before or after treatment with MeJA. We found that exogenous MeJA treatment significantly reduced disease incidence and lesion diameter of tomato fruit (p < 0.05; Figure 1). 1-MCP prefumigation before MeJA treatment disturbed the disease resistance ability induced by MeJA (p < 0.05; Figure 1). Moreover, 1-MCP fumigation after MeJA treatment abolished MeJA-induced resistance to pathogen development (p < 0.05; Figure 1). These results revealed that blocking ethylene perception greatly weakened the inhibitory effect on disease symptoms induced by MeJA, suggesting that ethylene perception participated in the MeJA-mediated disease resistance in tomato fruit. 1-MCP reportedly influenced ethylene biosynthesis by blocking ethylene perception in tomato fruit, which exerted a feedback to downregulate the expression of SlACS2, SlACS4, SlACO1, and SlACO4.41,42 However, activating ethylene biosynthesis was considered a primary defense response induced by MeJA, and inhibiting ethylene production could effectively disturb MeJA-induced resistance against B. cinerea.13,14 In agreement with previous reports, our present study showed that 1-MCP exerted a negative impact and MeJA exerted a positive impact on the stimulation of ethylene production (p < 0.05; Figure 2A). Moreover, 1-MCP fumigation before MeJA treatment delayed the peak of ethylene release and suppressed ethylene production induced by MeJA (Figure 2B). In contrast, 1-MCP fumigation after MeJA treatment had less effect on MeJA-induced ethylene production compared to prefumigation (Figure 2A). These results revealed that 1-MCP significantly weakened the MeJAinduced elevation in ethylene production, and the inhibition on ethylene production was better when 1-MCP was prefumigated before MeJA treatment. It is indicated that ethylene was like an important factor in the MeJA-mediated immune responses, and the 1-MCP-attenuated disease resistance mediated by MeJA might be ascribed to two mechanisms: either blocking ethylene responses or regulating ethylene production through feedback inhibition. Previous studies demonstrated that MeJA treatment promoted the endogenous JA content, and the increase in the JA content was correlated with the activation of key enzymes involved in JA biosynthesis.13,43 LOX and AOS are identified as two critical enzymes that catalyze endogenous JA synthesis in plants.44 The JA signal could be perceived by an intracellular receptor COI1, which participates in JA perception and then activates JA signaling transduction.44 In Arabidopsis thaliana, either the aos mutant impaired in JA biosynthesis or the coi1 mutant impaired in JA perception exhibited enhanced susceptibility to B. cinerea.45 Yu et al. reported that exogenous MeJA enhanced defense resistance against gray mold and significantly elevated JA content and LOX activity in tomato fruit.13 Our data also presented that MeJA treatment dramatically enhanced the JA content and elevated activities of JA biosynthesis enzymes (LOX and AOS) as well as upregulated expression of SlCOI1 in comparison to the control (p < 0.05; Figure 3), which revealed that exogenous MeJA stimulated endogenous JA biosynthesis and then upregulated SlCOI1 expression. Furthermore, 1-MCP fumigation either before or after MeJA treatment suppressed the increases in the JA content and LOX and AOS activities (p < 0.05; panels A−C of Figure 3). The present results presented that blocking ethylene perception by 1-MCP disturbed MeJAinduced activation of JA biosynthesis. Furthermore, the significant correlation between ethylene content and JA 6732


Article

Journal of Agricultural and Food Chemistry Funding

This work was supported by the National Natural Science Foundation of China (31571893, 31371847, and 31272215). Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS The authors thank the Crop Chemical Control Laboratory (College of Agronomy and Biotechnology, China Agricultural University) for gifting the JA ELISA kit. ABBREVIATIONS USED

■

REFERENCES

SA, salicylic acid; JA, jasmonic acid; ET, ethylene; MeJA, methyl jasmonate; PR, pathogenesis-related protein; ETR, ethylene receptor; Nr, Never ripe; ACO, 1-aminocyclopropane1-carboxylic acid oxidase; SlCOI1, Solanum lycopersicum coronatine-insensitive 1; SlERF2, Solanum lycopersicum ethylene response factor 2; 1-MCP, 1-methylcyclopropene; LOX, lipoxygenase; AOS, allene oxide synthase; PAL, phenylalanine ammonia-lyase; C4H, cinnamate 4-hydroxylase; 4CL, 4coumarate:coenzyme A ligase; POD, peroxidase; SD, standard deviation; RH, relative humidity; ELISA, enzyme-linked immunosorbent assay; FW, fresh weight

Figure 5. Proposed model of the role of the ET pathway in MeJAmediated immune responses against B. cinerea in postharvest tomato fruit. Exogenous application of MeJA is indicated in blue, and endogenous JA and ET are indicated in red.

ethylene content, which provided a feedback regulation to the endogenous JA accumulation. The present results also revealed that exogenous MeJA activated the phenolic metabolism, which might be attributed to the modulation of endogenous JA and ethylene production, and the activation of the phenolic metabolism pathway could be significantly suppressed by the absence of ethylene perception. Taken together, it is proposed that ethylene biosynthesis, perception, and signaling component SlERF2 participated in the MeJA-mediated immune responses against B. cinerea, which supported that the ET signaling pathway was significantly important for the MeJAmediated immune responses against gray mold in tomato fruit. In conclusion, exogenous MeJA remarkably enhanced disease resistance against gray mold. The increase in disease resistance was partially relevant to the induction of endogenous JA biosynthesis and ethylene production, which might participate in the activation of the phenolic metabolism pathway, thereby enhancing the disease resistance of tomato fruit. Furthermore, blocking ethylene perception either before or after treatment with MeJA could differently weaken the immune responses induced by MeJA, including impairing the elevations in ethylene production and endogenous JA biosynthesis and disturbing the modulation of the phenolic metabolism pathway, as evidenced by the decreased total phenolic content and lower activities of enzymes related to phenolic metabolism. These results suggested that ethylene perception participated in MeJA-induced immune responses in tomato fruit. Future studies will elucidate how JA biosynthesis and signaling transduction participated in ET-induced disease resistance against gray mold in tomato fruit.

■

■

(1) Zheng, Y.; Yang, Y.; Liu, C.; Chen, L.; Sheng, J.; Shen, L. Inhibition of SlMPK1, SlMPK2, and SlMPK3 disrupts defense signaling pathways and enhances tomato fruit susceptibility to Botrytis cinerea. J. Agric. Food Chem. 2015, 63, 5509−5517. (2) Aghdam, M. S.; Luo, Z.; Jannatizadeh, A.; Sheikh-Assadi, M.; Sharafi, Y.; Farmani, B.; Fard, J. R.; Razavi, F. Employing exogenous melatonin applying confers chilling tolerance in tomato fruits by upregulating ZAT2/6/12 giving rise to promoting endogenous polyamines, proline, and nitric oxide accumulation by triggering arginine pathway activity. Food Chem. 2019, 275, 549−556. (3) Dal Bello, G.; Mónaco, C.; Rollan, M. C.; Lampugnani, G.; Arteta, N.; Abramoff, C.; Ronco, L.; Stocco, M. Biocontrol of postharvest grey mould on tomato by yeasts. J. Phytopathol 2008, 156, 257−263. (4) Yang, J.; Sun, C.; Zhang, Y.; Fu, D.; Zheng, X.; Yu, T. Induced resistance in tomato fruit by γ-aminobutyric acid for the control of Alternaria rot caused by Alternaria alternata. Food Chem. 2017, 221, 1014−1020. (5) Xu, Y.; Charles, M. T.; Luo, Z.; Mimee, B.; Tong, Z.; Veronneau, P.; Roussel, D.; Rolland, D. Ultraviolet-C priming of strawberry leaves against subsequent Mycosphaerella fragariae infection involves the action of reactive oxygen species, plant hormones, and terpenes. Plant, Cell Environ. 2019, 42, 815−831. (6) Glazebrook, J. Contrasting mechanisms of defense against biotrophic and necrotrophic pathogens. Annu. Rev. Phytopathol. 2005, 43, 205−227. (7) Wasternack, C. Jasmonates: An update on biosynthesis, signal transduction and action in plant stress response, growth and development. Ann. Bot. 2007, 100, 681−697. (8) Wasternack, C.; Stenzel, I.; Hause, B.; Hause, G.; Kutter, C.; Maucher, H.; Neumerkel, J.; Feussner, I.; Miersch, O. The wound response in tomato-role of jasmonic acid. J. Plant Physiol. 2006, 163, 297−306. (9) Chen, J.; Zou, X.; Liu, Q.; Wang, F.; Feng, W.; Wan, N. Combination effect of chitosan and methyl jasmonate on controlling Alternaria alternata and enhancing activity of cherry tomato fruit defense mechanisms. Crop Prot. 2014, 56, 31−36. (10) Kȩpczyńska, E.; Król, P. The phytohormone methyl jasmonate as an activator of induced resistance against the necrotroph Alternaria porri f. sp. solani in tomato plants. J. Plant Interact. 2012, 7, 307−315.

AUTHOR INFORMATION

Corresponding Author

*Telephone/Fax: +86-10-62737620. E-mail: shen5000@cau. edu.cn. ORCID

Lin Shen: 0000-0002-3942-4367 6733


Article


1-MCP-treated apple fruit after long-term cold storage. J. Agric. Food Chem. 2006, 54, 3887−3895. (31) Zheng, Y.; Hong, H.; Chen, L.; Li, J.; Sheng, J.; Shen, L. LeMAPK1, LeMAPK2, and LeMAPK3 are associated with nitric oxideinduced defense response against Botrytis cinerea in the Lycopersicon esculentum fruit. J. Agric. Food Chem. 2014, 62, 1390−1396. (32) Jiao, W.; Li, X.; Wang, X.; Cao, J.; Jiang, W. Chlorogenic acid induces resistance against Penicillium expansum in peach fruit by activating the salicylic acid signaling pathway. Food Chem. 2018, 260, 274−282. (33) Sivasankar, S.; Sheldrick, B.; Rothstein, S. J. Expression of allene oxide synthase determines defense gene activation in tomato. Plant Physiol. 2000, 122, 1335−1342. (34) Ma, L.; He, J.; Liu, H.; Zhou, H. The phenylpropanoid pathway affects apple fruit resistance toBotrytis cinerea. J. Phytopathol 2018, 166, 206−215. (35) Ju, L.; Zhang, C.; Liao, J.; Li, Y.; Qi, H. An oriental melon 9lipoxygenase gene CmLOX09 response to stresses, hormones, and signal substances. J. Zhejiang Univ., Sci., B 2018, 19, 596−609. (36) Qiao, Y.; Meng, X. J.; Jin, X. X.; Ding, G. H. Genes expression of key enzymes in phenylpropanes metabolism pathway in cucumber with RT-PCR. Adv. Mater. Res. 2013, 746, 53−57. (37) Liang, Z.; Ma, Y.; Xu, T.; Cui, B.; Liu, Y.; Guo, Z.; Yang, D. Effects of abscisic acid, gibberellin, ethylene and their interactions on production of phenolic acids in Salvia miltiorrhiza bunge hairy roots. PLoS One 2013, 8, No. e72806. (38) Wang, B.; Niu, J.; Li, B.; Huang, Y.; Han, L.; Liu, Y.; Zhou, W.; Hu, S.; Li, L.; Wang, D.; Wang, S.; Cao, X.; Wang, Z. Molecular characterization and overexpression of SmJMT increases the production of phenolic acids in Salvia miltiorrhiza. Int. J. Mol. Sci. 2018, 19, 3788. (39) Li, M.; Liu, M.; Peng, F.; Fang, L. Influence factors and gene expression patterns during MeJa-induced gummosis in peach. J. Plant Physiol. 2015, 182, 49−61. (40) Chen, Y.; Etheridge, N.; Schaller, G. E. Ethylene signal transduction. Ann. Bot. 2005, 95, 901−915. (41) Li, L.; Guo, M.; Wang, X.; Zhang, X.; Liu, T. Effects and mechanism of 1-methylcyclopropene and ethephon on softening in Ailsa Craig tomato fruit. J. Food Process. Preserv. 2017, 41, No. e12883. (42) Hu, Z.; Tang, C.; He, Z.; Lin, J.; Ni, Y. 1-Methylcyclopropene (MCP)-containing cellulose paper packaging for fresh fruit and vegetable preservation: A review. BioResources 2016, 12, 2234−2248. (43) Litholdo, C. G.; Leal, G. A.; Albuquerque, P. S. B.; Figueira, A. Differential expression of jasmonate biosynthesis genes in cacao genotypes contrasting for resistance against Moniliophthora perniciosa. Plant Cell Rep. 2015, 34, 1747−1759. (44) Méndez-Bravo, A.; Calderón-Vázquez, C.; Ibarra-Laclette, E.; Raya-González, J.; Ramírez-Chávez, E.; Molina-Torres, J.; GuevaraGarcía, A. A.; López-Bucio, J.; Herrera-Estrella, L. Alkamides activate jasmonic acid biosynthesis and signaling pathways and confer resistance to Botrytis cinerea in Arabidopsis thaliana. PLoS One 2011, 6, No. e27251. (45) Rowe, H. C.; Walley, J. W.; Corwin, J.; Chan, E. K.; Dehesh, K.; Kliebenstein, D. J. Deficiencies in jasmonate-mediated plant defense reveal quantitative variation in Botrytis cinerea pathogenesis. PLoS Pathog. 2010, 6, No. e1000861. (46) Wang, K.; Jin, P.; Han, L.; Shang, H.; Tang, S.; Rui, H.; Duan, Y.; Kong, F.; Kai, X.; Zheng, Y. Methyl jasmonate induces resistance against Penicillium citrinum in Chinese bayberry by priming of defense responses. Postharvest Biol. Technol. 2014, 98, 90−97. (47) Yin, L.; Zou, Y.; Ke, X.; Liang, D.; Du, X.; Zhao, Y.; Zhang, Q.; Ma, F. Phenolic responses of resistant and susceptible Malus plants induced by Diplocarpon mali. Sci. Hortic. 2013, 164, 17−23. (48) Shadle, G. L.; Wesley, S. V.; Korth, K. L.; Chen, F.; Lamb, C.; Dixon, R. A. Phenylpropanoid compounds and disease resistance in transgenic tobacco with altered expression of L-phenylalanine ammonia-lyase. Phytochemistry 2003, 64, 153−161.

(11) Zehra, A.; Meena, M.; Dubey, M. K.; Aamir, M.; Upadhyay, R. S. Activation of defense response in tomato against Fusarium wilt disease triggered by Trichoderma harzianum supplemented with exogenous chemical inducers (SA andMeJA). Rev. Bras. Bot. 2017, 40, 651−664. (12) Zhu, Z.; Tian, S. Resistant responses of tomato fruit treated with exogenous methyl jasmonate to Botrytis cinerea infection. Sci. Hortic. 2012, 142, 38−43. (13) Yu, M.; Shen, L.; Fan, B.; Zhao, D.; Zheng, Y.; Sheng, J. The effect of MeJA on ethylene biosynthesis and induced disease resistance to Botrytis cinerea in tomato. Postharvest Biol. Technol. 2009, 54, 153−158. (14) Yu, M.; Shen, L.; Zhang, A.; Sheng, J. Methyl jasmonateinduced defense responses are associated with elevation of 1aminocyclopropane-1-carboxylate oxidase in Lycopersicon esculentum fruit. J. Plant Physiol. 2011, 168, 1820−1827. (15) Yu, W.; Zhao, R.; Sheng, J.; Shen, L. SlERF2 is associated with methyl jasmonate-mediated defense response againstBotrytis cinerea in tomato fruit. J. Agric. Food Chem. 2018, 66, 9923−9932. (16) Saltveit, M. E. Effect of ethylene on quality of fresh fruits and vegetables. Postharvest Biol. Technol. 1999, 15, 279−292. (17) Mou, W.; Li, D.; Bu, J.; Jiang, Y.; Khan, Z. U.; Luo, Z.; Mao, L.; Ying, T. Comprehensive analysis of ABA effects on ethylene biosynthesis and signaling during tomato fruit ripening. PLoS One 2016, 11, No. e0154072. (18) Nambeesan, S.; AbuQamar, S.; Laluk, K.; Mattoo, A. K.; Mickelbart, M. V.; Ferruzzi, M. G.; Mengiste, T.; Handa, A. K. Polyamines attenuate ethylene-mediated defense responses to abrogate resistance to Botrytis cinerea in tomato. Plant Physiol. 2012, 158, 1034−1045. (19) Mengiste, T. Plant immunity to necrotrophs. Annu. Rev. Phytopathol. 2012, 50, 267−294. (20) Di, X.; Gomila, J.; Takken, F. L. W. Involvement of salicylic acid, ethylene and jasmonic acid signalling pathways in the susceptibility of tomato toFusarium oxysporum. Mol. Plant Pathol. 2017, 18, 1024−1035. (21) Pantelides, I. S.; Tjamos, S. E.; Paplomatas, E. J. Ethylene perception via ETR1 is required in Arabidopsis infection by Verticillium dahliae. Mol. Plant Pathol. 2010, 11, 191−202. (22) Pantelides, I. S.; Tjamos, S. E.; Paplomatas, E. J. Insights into the role of ethylene perception in tomato resistance to vascular infection byVerticillium dahliae. Plant Pathol. 2010, 59, 130−138. (23) Blankenship, S. M.; Dole, J. M. 1-Methylcyclopropene: A review. Postharvest Biol. Technol. 2003, 28, 1−25. (24) Cao, S.; Zheng, Y. Effect of 1-methylcyclopropene on Anthracnose rot caused by Colletotrichum acutatum and disease resistance in loquat fruit. J. Sci. Food Agric. 2010, 90, 2289−2294. (25) Zhang, Z.; Tian, S.; Zhu, Z.; Xu, Y.; Qin, G. Effects of 1methylcyclopropene (1-MCP) on ripening and resistance of jujube (Zizyphus jujuba cv. Huping) fruit against postharvest disease. LWTFood Sci. Technol. 2012, 45, 13−19. (26) Amoah, R. S.; Terry, L. A. 1-Methylcyclopropene (1-MCP) effects on natural disease resistance in stored sweet potato. J. Sci. Food Agric. 2018, 98, 4597−4605. (27) Jiang, Y.; Joyce, D. C.; Terry, L. A. 1-Methylcyclopropene treatment affects strawberry fruit decay. Postharvest Biol. Technol. 2001, 23, 227−232. (28) Tang, Q.; Zhu, F.; Cao, X.; Zheng, X.; Yu, T.; Lu, L. Cryptococcus laurentii controls gray mold of cherry tomato fruit via modulation of ethylene-associated immune responses. Food Chem. 2019, 278, 240−247. (29) Min, D.; Li, F.; Zhang, X.; Shu, P.; Cui, X.; Dong, L.; Ren, C.; Meng, D.; Li, J. Effect of methyl salicylate in combination with 1methylcyclopropene on postharvest quality and decay caused byBotrytis cinerea in tomato fruit. J. Sci. Food Agric. 2018, 98, 3815−3822. (30) Li, D.; Xu, Y.; Sun, L.; Liu, L.; Hu, X.; Li, D.; Shu, H. Salicylic acid, ethephon, and methyl jasmonate enhance ester regeneration in 6734


Article

Journal of Agricultural and Food Chemistry (49) van Loon, L. C.; Rep, M.; Pieterse, C. M. J. Significance of inducible defense-related proteins in infected plants. Annu. Rev. Phytopathol. 2006, 44, 135−162. (50) Yu, M.; Shen, L.; Sheng, J. MeJA-induced disease resistance in postharvest tomato fruits. Food Sci. 2012, 33, 11−15.

6735


Ethylene Perception Is Associated with Methyl-Jasmonate-Mediated

Recommend Documents