Europium hydroxide nanorods (EHNs) ameliorate isoproterenol

Subscriber access provided by LUNDS UNIV

Article

Europium hydroxide nanorods (EHNs) ameliorate isoproterenolinduced myocardial infarction: An in vitro and in vivo investigation Satish Vemuri, Susheel Kumar Nethi, Rajkiran Reddy Banala, Peda Venkata Subbaiah Goli, Venkata Gurava Reddy Annapareddy, and Chitta Ranjan Patra ACS Appl. Bio Mater., Just Accepted Manuscript • DOI: 10.1021/acsabm.8b00669 • Publication Date (Web): 20 Feb 2019 Downloaded from http://pubs.acs.org on February 25, 2019

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Subscriber access provided by LUNDS UNIV

ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 31 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41

ACS Applied Bio Materials

ACS Paragon Plus Environment

ACS Applied Bio Materials 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 31

Europium hydroxide nanorods (EHNs) ameliorate isoproterenol-induced myocardial infarction: An in vitro and in vivo investigation Satish Kumar Vemuria#, Susheel Kumar Nethib,c,d#, Rajkiran Reddy Banalaa#, Peda Venkata Subbaiah Golia*, Venkata Gurava Reddy Annapareddya, Chitta Ranjan Patrab,d*

aSMART,

Sunshine Hospitals, Secunderabad, Telangana State, India,

bDepartment

of Applied Biology, CSIR-Indian Institute of Chemical Technology, Uppal Road, Tarnaka, Hyderabad - 500007, Telangana State, India. cPresent

address: Department of Experimental and Clinical Pharmacology, College of Pharmacy, University of Minnesota, Minneapolis, MN, United States 55455. dAcademy #Authors

of Scientific and Innovative Research (AcSIR), Ghaziabad, 201002, U.P., India.

contributed equally

KEYWORDS:

Isoproterenol,

myocardial

ischemia,

europium

electrocardiography, cardiac hypertrophy.


hydroxide

nanorods,

Page 3 of 31 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


ABSTRACT: Cardiovascular diseases (CVDs) are one of the leading causes of global morbidity and mortality. Among these the ischemic heart disease (IHD) or coronary artery disease (CAD) account for the major deaths due to CVDs. Several approaches followed to treat the ischemic heart diseases are limited due to various adverse effects and cost of treatment. Recently, nanotechnology has revolutionized the field of biomedical research by introducing various technologies to improve the health care, using nanomedicine approach. In this context, our group has well established the europium hydroxide nanorods (EHNs), which promote the formation of new blood vessels (angiogenesis) through reactive oxygen species (ROS) - nitric oxide (NO) mediated signaling pathways. Further these pro-angiogenic nanorods were also reported to exhibit mild to non-toxic nature towards mammalian cells and mouse models. Henceforth, in the present study myocardial ischemia (MI) was created in Wistar rats using Isoproterenol (ISO), a well-established model for inducing MI. First time, the effect of the pro-angiogenic nanorods (EHN) on the ischemic condition was validated using several assays which revealed that the ischemia and cardiotoxicity induced by ISO was ameliorated by EHN in both H9C2 rat cardiomyocytes (in vitro) and Wistar rats (in vivo). Considering the above results, we believe that EHN could be developed as alternative treatment strategies for myocardial ischemia therapy and other ischemic diseases where angiogenesis plays a significant role in near future.



 INTRODUCTION The cardiovascular diseases (CVDs) account for one of the major portion of the annual global deaths (approximately 30%). Over the last two decades, the annual deaths due to ischemic heart diseases have steadily increased, which alone accounted for around 7 million deaths worldwide in the year 2010.1 Among the various CVDs, myocardial infarction (MI) is a major cause for global morbidity and mortality, especially in the developing countries.2 MI usually occurs due to deficiency in the supply of oxygen and nutrients to myocardium due to blood flow obstruction, resulting in degeneration of cardiomyocytes, ischemia and ultimate death of the cardiac tissue.3 Several pathological conditions such as diabetes, hypertension, hypercholesterolemia, hyperlipoproteinemia etc. act as risk factors for causing MI.4 Several ocular disorders such as retinopathy are also reported to be associated with pathophysiology of MI.5 Preclusion of damage caused by ischemia and recovery of oxygen supply by restoring blood flow to the ischemic site is the plausible approach to overcome the cardiac injury. Recently nanotechnology and nanomedicine have revolutionized the field of biology and medicine by introducing several novel approaches to diagnose and cure various disease conditions.6 Several studies have been performed by various researchers across the globe to determine the applications of nanomedicine for cardiovascular diseases (CVDs), especially myocardial ischemia. Paul and his group have demonstrated an injectable angiogenic gene delivery system based in graphene oxide (GO)/hydrogel, for application towards vasculogenesis and cardiac repair.7 Bae et al. revealed a novel hydrogen peroxide (H2O2)-responsive polymer nanoparticles for exhibiting anti-oxidant property in reducing the oxidative stress associated with myocardial injury in mouse model.8 In another study, Magruder and colleagues explained that dendrimer nanoparticles act as ideal drug delivery vehicles in ameliorating reperfusion injury


Page 4 of 31

Page 5 of 31 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


against myocardial ischemia, based on their ability of selective localization in ischemic tissues containing inflammatory injury.9 Stem cell therapy has been previously demonstrated as a potential modality for addressing myocardial ischemia. Park et al. demonstrated a novel combination of mesenchymal stem cells with reduced GO for promoting the expression of angiogenic growth factors for effective treatment of myocardial injury ischemia.10 Very recently, researchers have evaluated the effect of nanomaterials alone such as gold nanoparticles11 and cerium oxide nanoparticles12 in ameliorating the isoproterenol induced myocardial infarction, based on the anti-oxidant property of these nanoparticles. However, the detailed molecular mechanisms of these nanoparticles in overcoming MI are not explained in-detail. It has been well-documented in the literature that angiogenesis improves cardiac function by restoring blood supply, oxygen and is a promising strategy for treating myocardial infarction.13-15 It has also been reported that angiogenesis is essential for promoting survival of cardiomyocytes located along the endocardium in ischemic zone of infarcted hearts and inhibited ventricular remodeling.16 Till date, there are no reports on application of pro-angiogenic nanoparticles for recovering the myocardial ischemia by inducing therapeutic angiogenesis. Our group has wellestablished the pro-angiogenic properties of europium hydroxide nanorods (EHNs) using in vitro endothelial cells (HUVECs, EA.hy926 and ECV-304), ex vivo systems such as chick embryo model and in vivo transgenic zebra fish model.17-19 Our group has comprehensively investigated the toxicity aspects of these pro-angiogenic nanoparticles at in vivo level using mouse models. The short-term (7 days) and long term (60 days) toxicity studies in C57BL6/J mice showed normal serum biochemistry (except slight liver enzymes elevation), normal hematology with none or mild effect on histology of vital organs even at higher doses (125 mg/kg b.w.), where we are using 5-10 mg/kg b.w. as therapeutic dose for the treatment of myocardial infarction.20



Again, histological evaluation of lung tissues demonstrated normal alveolar geometry at lower (therapeutic) doses, whereas parabronchiolar lipophagocytic change was observed at the highest dose (125 mg/kg b.w.), which are much higher than the therapeutically optimal doses (5-10 mg/kg b.w).20 Moreover, in vitro and in vivo cytogenetic toxicity evaluation of EHN using a standard battery of genotoxicity assays revealed no evidence of any gross damage to genetic material.19 Considering these reported observations we strongly believe that EHNs are non-toxic and can be safely administered for therapeutic purposes. However, further detailed investigations at the molecular level are to be carried to widely establish their safety for effective translation towards clinical applications. Mechanistic studies revealed nitric oxide (NO) as the key signaling molecule underlying the EHNs induced pro-angiogenesis following PI3K/Akt/eNOS signaling axis18 MnTBAP [Mn (III) tetrakis (4-benzoic acid) porphyrin chloride], abbreviated as M, is a cell-permeable synthetic mimetic of superoxide dismutase (SOD), which is intended to increase the local bioavailability of nitric oxide (NO) by scavenging free radical species such as superoxide anion and subsequently preventing the formation of toxic species such as peroxynitrite.21 Earlier, it was reported by our group that EHN in combination with MnTBAP increases the cellular NO levels in comparison to EHN treatment alone, thereby inducing promoted angiogenesis.18 In the present study, MnTBAP was used in combination with EHN, which is expected to supplement the EHNinduced therapeutic angiogenesis. Herein, we report the concept of using pro-angiogenic europium hydroxide nanorods (EHNs) for addressing the ISO-induced MI, where EHN itself acts as both pro-angiogenic growth factor/cytokine for inducing therapeutic angiogenesis. The protective effect of EHNs against


Page 6 of 31

Page 7 of 31 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


ISO-induced MI was studied using in vitro H9C2 rat cardiomyocyte cells and in vivo male Wistar rats.  MATERIALS Europium nitrate hydrate [Eu(NO3)2·H2O], aqueous ammonium hydroxide [aq. NH4OH, 2628%], MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide), Isoproterenol, formaldehyde and RNAlater tissue storage reagent, Dulbecco`s modified eagles medium (DMEM), fetal bovine serum (FBS), penicillin, streptomycin, kanamycin and Ficoll-Paque were procured from Sigma Aldrich, USA. MnTBAP (abbreviated as M) was bought from Calbiochem. RNA isolation and cDNA synthesis kits were purchased from ThermoFisher, USA, respectively. PCR Mastermix was procured from Takara. The primers were obtained from Eurofins and CD34/CD-45 monoclonal antibodies were bought from BD Biosciences, U.S.A.  METHODS Synthesis and characterization of EHNs The europium hydroxide nanorods (EHNs) were synthesized using an advanced microwave irradiation method as per our previously reported protocols.18 Briefly, the synthesis is based on an aqueous interaction of europium nitrate hydrate and ammonium hydroxide (26-28%) under microwave irradiation conditions. In a typical synthesis process, 0.05 M aqueous solution of EuIII(NO3)2 solution (39 mL) was added with 1 mL of aqueous NH4OH (at a molar ratio of OH/Eu= 4) in a 100 mL round bottomed flask and stirred for 30 min at room temperature. Further, the reaction mixture was subjected to microwave irradiation for 60 min at 600 W in an advanced microwave oven (MAS-II, Sineo). The resultant white precipitate was washed thoroughly several times by centrifugation and dried in a hot air oven and finely grounded using motor and pestle. The resultant fine white powder of EHNs was characterized using several



techniques such as X-ray diffraction (XRD), transmission electron microscopy (TEM), dynamic light scattering (DLS) and thermogravimetric (TGA) analysis, which are described in the Supporting Information. Cell culture H9C2 rat cardiomyocytes were procured from the repository of National Centre for Cell Sciences (NCCS), Pune, India. The cells were grown in DMEM supplemented with 10% FBS and 0.005% antibiotics as per our laboratory protocol. Cell viability (MTT) assay The effect of isoproterenol and EHNs on the growth and viability of H9C2 cells was determined using MTT assay as per our previous reports. Briefly, the cells were seeded in 96-well plate at a density of around 8 X 103 cells per well and cultured.22 The cells were incubated with EHNs at various concentrations of 1-50 µg/mL for 24 h. After treatment period, the media was replaced with fresh media containing MTT (0.5 mg/mL) solution and incubated for 4 h. The media in all the wells was removed and DMSO: Methanol (1:1 v/v) solution was added to each well to solubilize the formazan crystals. The absorbance of the plate was measured at 570 nm using a Synergy H1 Biotek plate reader and absorbance all the samples were recorded in triplicates. Additionally, to induce the cardiac ischemic condition cells were treated with ISO (100-200 µM) and observed for cell viability for 48 h. To check the effect of EHNs on ISO induced cardiotoxicity in H9C2 cells, EHNs (10 µg/mL) treatment was performed 2 h post ISO treatment and further incubated for 48 h. After the treatment time, MTT assay was performed as explained previously.22 Cell cycle analysis


Page 8 of 31

Page 9 of 31 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


The influence of ISO and EHNs on the cell population existing in various phases of cell cycle was determined using cell cycle analysis using flow cytometry as reported by us previously.22 The H9C2 cells were cultured and treated with ISO (50 - 100 µM) for 6 h. Further, cells were treated with EHNs (10 µg/mL) and incubated for 48 h. After the treatment time, the cells were trypsinized, washed with PBS and fixed in 70% ethanol for overnight. The cells were then washed and stained with propidium iodide (PI) supplemented with RNAse and Triton-X for 40 min at room temperature in dark. Finally, the cells were washed again to remove the unbound PI and the cell cycle analysis was done using BD FACS Canto flow cytometer. Isolation and characterization of hematopoietic stem cells from rat bone marrow The male Wistar rats (weighing ~ 200 g) were sacrificed by cervical dislocation for collecting bone marrow mononuclear cells. The tibias and femurs were recovered by dissection under sterile conditions. The metaphyseal ends of the bones were cut, and the marrow plugs were flushed by passing 1X PBS through a needle inserted into one end of the bone. The bone marrow was diluted at 1:1 ratio with normal saline. Mononuclear cells (MNC) fraction was obtained by gradient centrifugation using 1.073 g/mL Ficoll at 1500 rpm for 30 min. The cells were rinsed twice with normal saline and counted using haemocytometer.23 Further, the cells were characterized by incubation with CD34 and CD45 antibodies (Negative markers) for 30 min and analyzed using BD FACS Aria II equipped with FACS Diva software (BD Biosciences, USA).23 Model for myocardial ischemia: Isoproterenol (ISO), a synthetic non-selective β-adrenoreceptor agonist is known for its deleterious effects on heart such as cardiac necrosis, apoptosis, inflammation, hypertrophy, fibrosis and myocardial infarction.24-26 Reduced nitric oxide (NO) bioavailability, vascular oxidative stress followed by endothelial cell dysfunction etc. was reported to be the molecular



Page 10 of 31

mechanisms underlying the ISO- induced MI.27-29 The ISO-induced MI in rats is a wellestablished

experimental

model

to

investigate

the

cardioprotective

effects

of

any

substance/compound, since it is widely known that the morphological and pathophysiological alterations induced by ISO in rat models are similar to the acute MI in humans.30 Several research groups employed this model for validating the cardioprotective effects of various herbal extracts,31-32 polyphenols,33 chemotherapeutic agents,34 steroids,35 peptides,36 etc. Based on this background, we have selected this ISO-induced MI model in our study to examine the effect of EHN in overcoming the condition of MI. Animals The male Wistar rats aged 2-3 months, weighing around 200 g were procured from Jeeva Life Sciences Pvt. Ltd, Uppal, Hyderabad, India and used for the ischemia study. The animals were accommodated in plastic cages under conditions of 12 h light and 12 h dark cycles. The standard pellet diet and water were provided throughout the study period ad libitum. Experimental study was performed according to the approval of the Institutional animal ethical committee (Approval No. CPCSEA/IAEC/JLS/03/15/003). Experimental grouping The animals were categorized into six groups for the entire study. Group I: Untreated, Group II: ISO alone (ISO-ischemia induced), Group III: EHN (ISO-ischemia induced), Group IV: ISO + EHN + M (ISO-ischemia induced), Group V: Protective EHN (simultaneous EHNs treatment along with ISO-ischemia induced) and Group VI: ISO+ Cells (CD34+/CD45+) + EHN (Table 1).

Table 1. Experimental grouping of male Wistar rats into six treatment groups. Each group contains n = 5 animals.


Page 11 of 31 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Myocardial infarction model and treatments The induction of myocardial ischemia in male Wistar rats was done by giving intravenous (i.v.) injection of ISO (5 mg/kg) every day for a period of 7 days, as per the existing literature.37 The animals were allotted into five treatment groups with five rats in each group. The rats of Group-I did not receive any treatment and were labeled as untreated (negative) control group (nonischemic). The rats of Group-II received isoproterenol for a period of 7 days (Ischemic positive). The rats of the Group-III received the EHNs- 10 mg/kg b.w. treatment post-ischemic induction using isoproterenol. The rats of the Group-IV were administered with EHNs (10 mg/kg b.w.) + M post- ischemic induction with isoproterenol. The animals of the Group-III and Group-IV were treated intraperitoneally (i.p.) for 8 times (alternate days in first week and thrice in the second week and once in next week). Researchers performed comparison studies of administering nanoparticle formulations through different routes, indicating the prominence of i.p. administration over other ways. For instance, Jung et al. reported a biexponential decrease of blood concentration time curves for intravenously injected nanoparticles, whereas the i.p. administration showed a slow increase of blood concentration followed by reaching a steady state.38 Importantly, they also showed an increased retention of nanoparticles into atherosclerotic lesions, given by i.p. route, demonstrated using several imaging techniques (MRI, x-ray



fluorescence, confocal fluorescence microscopy etc.) performed in ex vivo and in vivo models. Furthermore, several groups injected growth factors, hormones etc. through i.p. route for treating myocardial infarction.39 Moreover, i.p. administration provides an additional advantage for injecting larger volume of nanoparticle suspension dose. Hence, according to the wellestablished literature we adapted i.p. route for dosing EHN in the present study. Furthermore, after establishing the pharmacological activity of EHNs in higher animals, we intend to optimize the best injection route for EHNs by comparing with various route of administration (oral, intravenous, intramuscular, sub-cutaneous etc.) for achieving the optimum therapeutic response. The animals of the Group V received EHNs (10 mg/kg b.w.) treatment simultaneously (i.p.) during Ischemic induction along with isoproterenol for a period of 7 days (protective group). Rats of Group VI were administered with a single i.p. dose of CD34+/CD45+ positive bone marrow cells derived from rats in combination with EHNs- 10 mg/kg b.w. Finally, the rats were sacrificed at the end of 35 days of the study period as shown in the Scheme 1.

Scheme 1. Overall representation of the ischemia induction through ISO administration (i.v.) for 7 days followed by injecting with EHNs on alternate days and sacrifice of rats at the end of Serum biomarker analysis the study. Whereas, in protective (Pro.) group, EHNs were simultaneously administered to rats on the same day of ischemia induction using ISO for 7 days. The serum biomarker analysis was performed to investigate the recovery of the rats from the ischemia injury at the biochemical level. Briefly, the blood from the Wistar rats was collected at Day 10 and Day 20 of the study period. The serum was isolated from the collected blood by


Page 12 of 31

Page 13 of 31 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


centrifugation (1500 rpm for 5 min) and the expression level of various biomarkers was done using Beckmen Coulter Uni Cell DXE 800 analyzer. Electrocardiogram (ECG) analysis ECG analysis was performed as per previously published literature.40 The Wistar rats are anesthetized using ketamine/xylazine solution and placed in supine position. Two needle electrodes were connected to the forelimbs of the rat and one needle electrode connected to the left hind limb of the rat. The ECG readings were obtained using a Philips HeartStart XL Monitor/Defibrillator machine. Three needle electrodes/leads are connected to rats at two forelimbs and the left hind limb. The determination of P-wave amplitude, QRS complex and alterations in the ST wave were analyzed using ECG by Cardiologist, Sunshine Hospitals, Hyderabad, India. Heart/ Body weight ratio Determining the heart to body weight ratio is essential to understand the effect of EHNs on the cardiac hypertrophy induced by isoproterenol. During sacrifice, the hearts were removed, washed in PBS buffer and the weights of the heart was recorded. Body weights of the animals were regularly monitored during the study period. Gene expression studies Reverse Transcriptase-PCR After the end of the ischemia study, the rats were sacrificed and heart tissue was isolated and collected in RNAlater solution and stored at -20 °C. Further, following the manufacturer`s protocol RNA isolation (mini RNA sure kit, Nucleopore, Genetix bio Pvt Ltd) was done from the heart samples and cDNA (Verso cDNA synthesis kit, Thermofisher scientifics) was prepared.



Page 14 of 31

PCR was employed to amplify the obtained cDNA using specific primers for eNOS (Forward: AACTATTTCCTGTCCCTGC, Reverse: CCAGTCTCAGAGCCATACAG), iNOS: inducible NOS

(Forward:

TCACGACACCCTTCACCACAA,

Reverse:

CCATCCTCCTGCCCACTTCCTC), TNF-alpha (Forward: ACTGAACTTCGGGGTGATTG; Reverse:

GCTTGGTGGTTTGCAGCTCGCATCC)

and

GAPDH

(Forward:

TGAGGTGACCGCATCTTCTTG, Reverse: TGGTAACCAGGCGTCCGATA). The PCR reactions was carried out in a final volume of 10 μl containing 1x PCR buffer and Emerald AMP GT PCR Master mix 2x premix (Takara clone-tech) and 0.4 μM of each primer. The template was denatured for 5min at 94 °C, followed by amplification cycles at 94 °C for 1min and reannealing step (61°C for iNOS; 62oC for eNOS; 58.5oC for TNF-alpha and 59°C for GAPDH) for 30 sec and 72 °C for 1 min. Finally, the reaction was terminated with an additional extension step for 8 min at 72 °C. The PCR products were collected and run on 1.5% agarose gel with ethidium bromide staining and visualized under UV Gel Documentation (Life technologies). In negative control, template cDNA was replaced by DEPC water.41-42 Real time PCR The RT-PCR reactions (final volume: 20 μL) are carried out using 10uL Dynamo flash SYBR green mix (2x master mix (contains hot-start version of a modified Tbr DNA polymerase, SYBR® Green I, optimized PCR buffer, 5 mM MgCl2, dNTP mix including dUTP)), 0.4ul ROX dye, 0.4ul Yellow sample buffer, 0.2μl forward and 0.2μl reverse primers, 2ul of template and 6.6ul nuclease free water. The template was denatured for 10 min at 94°C, followed by amplification cycles at 94°C for 30 sec, 61°C/62oC/59oC (iNOS, eNOS and GAPDH) for 30 sec and 72°C for 30 sec, final extension step 7 min at 72°C.43 Histopathology analysis


Page 15 of 31 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


After sacrificing the animals at the end of the study, the heart of the rats was isolated and collected in 10% paraformaldehyde and stored. The heart tissues were embedded in paraffin wax blocks and thin sections of the tissue were cut and then mounted on to pre-cleaned microscopic glass slides. Subsequently, the slides were then washed thoroughly and stained with haematoxylin and eosin (H&E) as per reported literature. These slides were analyzed by professional pathologist and reported for the histopathology. Clearance study using ICP-OES At the end of the study period, the feces of the rats of each group were collected. These feces were weighed and subjected to acid digestion in 70% nitric acid solution for 48-72 h at 50 °C as per our published literature.18 Following, the resultant mixture was collected and filtered using 0.22 μM Millex syringe filters and diluted with Millipore water and analyzed for metal content (ppm) using ICP-OES analysis. Statistical analysis All the data were statistically analyzed using the un-paired student’s t-test and “One way ANOVA” with Dunnett’s posttest performed using Graph Pad Prism version 6.04, San Diego California USA. (* significantly different from control at P

Europium hydroxide nanorods (EHNs) ameliorate isoproterenol

Recommend Documents