Evaluation of Androgenic Activity of Nutraceutical-Derived Steroids

ARTICLE pubs.acs.org/ac

Evaluation of Androgenic Activity of Nutraceutical-Derived Steroids Using Mammalian and Yeast in Vitro Androgen Bioassays Omar N. Akram,†,‡ Christina Bursill,† Reena Desai,z Alison K. Heather,§ Rymantas Kazlauskas,^ David J. Handelsman,*,‡,z and Gilles Lambert†,|| †

Lipid Research Group and §Gene Regulation Group, The Heart Research Institute, Sydney, Australia University of Sydney Medical School, Sydney, Australia ^ National Measurement Institute, Pymble, Sydney, Australia z ANZAC Research Institute, Concord Hospital, Sydney, Australia Faculte de medecine, Universite de Nantes, Nantes, France

)

‡

bS Supporting Information ABSTRACT: Androgenic steroids marketed online as nutraceuticals are a growing concern in sport doping. The inability of conventional mass spectrometry (MS)-based techniques to detect structurally novel androgens has led to the development of in vitro androgen bioassays to identify such designer androgens by their bioactivity. The objective of this study was to determine the androgenic bioactivity of novel steroidal compounds isolated from nutraceuticals using both yeast and mammalian cell-based androgen bioassays. We developed two new in vitro androgen bioassays by stably transfecting HEK293 and HuH7 cells with the human androgen receptor (hAR) expression plasmid together with a novel reporter gene vector (enhancer/ARE/SEAP). The yeast β-galactosidase androgen bioassay was used for comparison. Our new bioassay featuring the enhancer/ARE/SEAP construct (-S) displayed simpler assay format and higher specificity with lower sensitivity compared with the commonly used mouse mammary tumour virus (MMTV)-luciferase. The relative potencies (RP), defined as [EC50] of testosterone/[EC50] of steroid, of nutraceutical extracts in the yeast, HEK293-S, and HuH7-S, were 34, 333, and 80 000 for Hemapolin; 208, 250, and 80 for Furazadrol; 0.38, 10, and 106 for Oxyguno; 2.7, 0.28, and 15 for Trena; and 4.5, 0.1, and 0.4 for Formadrol, respectively. The wide discrepancies in rank RP of these compounds was reconciled into a consistent potency ranking when the cells were treated with meclofenamic acid, a nonselective inhibitor of steroid metabolizing enzymes. These findings indicate that steroids extracted from nutraceuticals can be converted in vitro into more or less potent androgens in mammalian but not in yeast cells. We conclude that the putative androgenic bioactivity of a new compound may depend on the bioassay cellular format and that mammalian cell bioassays may have an added benefit in screening for proandrogens but sacrifice specificity for sensitivity in quantitation.

T

he over-the-counter nutritional supplement (nutraceutical) market has grown rapidly since the 1994 legislation permitting sale of steroid precursors as nutraceutical food supplements1 with a market turnover estimated at more than US $60 billion in 2006.2 Nutraceuticals, claiming on their labels to enhance performance legally, are marketed to athletes. However, chemical analysis has revealed undeclared compounds in these products including substances banned by the World Anti-Doping Agency (WADA) as well as novel designer androgens or proandrogens, which are not specified in the WADA Prohibited List but generically are prohibited as androgens.2 WADA-approved doping detection tests for androgens identify banned steroids using gas or liquid chromatography with tandem mass spectrometry (MS).3 Although sensitive and specific, these methods can only detect r 2011 American Chemical Society

specified steroid structures and not their in vivo metabolites nor whether they are androgen agonists or antagonists. Hence, MSbased methods alone cannot serve adequately to support the generic prohibition of androgens. One approach to addressing these limitations has been the development of in vitro androgen bioassays, which allow for functional characterization of steroids as androgens according to their AR-specific transcriptional activity, regardless of structural knowledge. These assays entail the use of eukaryotic cells overexpressing the androgen receptor (AR) and introduced with a reporter gene driven by an androgen Received: October 30, 2010 Accepted: January 31, 2011 Published: February 18, 2011 2065

dx.doi.org/10.1021/ac102845y | Anal. Chem. 2011, 83, 2065–2074

Analytical Chemistry response element.4-6 A widely used model for evaluating steroidal bioactivity is the yeast-based AR β-galactosidase (β-gal) bioassay6 with recent variations using modified (yeast enhanced green fluorescent, luciferase) readout,7,8 although these display notably reduced sensitivity (EC50 10-50 nM vs ∼5 nM for β-gal). In addition, mammalian cell-based androgen bioassays developed using a mouse mammary tumour virus (MMTV) sequence driven luciferase (luc) reporter gene feature reduced specificity because the MMTV sequence contains response elements that are recognized not only by the AR but also by the progesterone (PR) and glucocorticoid (GR) receptors.9-11 In this study, we developed two new, robust, and specific mammalian AR bioassays, using a novel hybrid androgen response element (ARE) driven secreted alkaline phosphatase (SEAP) reporter gene in two human cell lines. We show that our novel mammalian bioassay has higher specificity and simpler format but lower sensitivity than the MMTVluciferase format. We used both mammalian bioassays to determine the androgenic potency of known androgens as well as that of nutraceutical-derived steroids in tandem with a yeast-based AR bioassay to gather insight into the contributions of different cellular formats on androgen bioassay performance.

’ EXPERIMENTAL SECTION Compounds. Capsules of (i) 19-norandrost-4,9-diene-3,17dione (Trena; Nutracoastal), (ii) 6R-methylandrost-4-ene-3,17dione (Formadrol; Legal Gear), (iii) 2R,3R-epithioandrostane17R-methyl-17β-ol (Hemapolin; Star Mark Laboratories), and (iv) a mixture of 17β-hydroxyandrostano[3,2-c]-isoxazole and 17β-hydroxyandrostano[2,3-d]-isoxazole isomers (Furazadrol; Axis Laboratories) were obtained from www.bodybuilding.com via the Internet and emptied before extraction. Tablets of (v) Oxyguno [labeled ingredient 4-chloro-17R-methyl-etioallochol4-ene-17β-ol-3,11-dione, not isolated pure but as a mixture of steroidal components, many containing chlorine (Spectra Force)] were crushed before extraction. Steroids were extracted with 3 volumes of a dichloromethane/methanol mixture (1:1), evaporating the solvent then chromatographing the residue on silica gel. The compounds were eluted with dichloromethane/t-butylmethylether mixtures, and separation was followed by thin-layer chromatography (TLC) or by GC/MS on the fractions. Fractions with fairly pure materials were recrystallized from mixtures of solvents such as toluene t-butylmethylether and hexane. Structures were determined from GC/MS and 1H NMR and 13 C NMR data. Structures for Hemapolin, Trena, and Formadrol matched the data depicted on the label after appropriate consideration was given to the misleading nomenclature used. Only Oxyguno was not characterized and isolated pure, as it appeared to be a mixture of chlorinated and nonchlorinated compounds which cocrystallized. Furazadrol was a mixture of two compounds (neither of which was the compound listed on the label). All other steroids were from Steraloids, Inc. (Newport, RI). Steroid structures are shown in Figure S-1, Supporting Information. Meclofenamic acid was purchased from Sigma (St. Louis, MO). All steroids and meclofenamic acid were dissolved in 100% ethanol. Dilutions for cell culture experiments were carried out in phenol-red free Dulbecco's Modified Eagle Medium (DMEM). Cell Culture. Human embryonic kidney (HEK293) cells (Gibco Invitrogen, Carlsbad, CA) were grown in DMEM-Lglutamine (high glucose; Sigma) supplemented with 10% fetal calf serum (FCS), penicillin (500 U/mL), and streptomycin

ARTICLE

(500 μg/mL) at 37 C under 5% CO2. HuH7 cells (ATCC, Manassas, VA) were grown in the same conditions except that DMEM-L-glutamine (low glucose) was used (Sigma). Yeast were grown overnight at 30 C with shaking in CSM-leu-ura (BIO101) selective medium, as described.12 Following incubation, the yeast culture was subcultured in fresh medium and grown to early midlog phase (OD600 ∼ 0.3). Plasmid Constructs. The synthetic oligonucleotide encoding the androgen response element was designed using sequences from previous studies,13,14 showing these to be highly responsive to androgens. The ARE sequence, consisting of three tandem repeats of ARE oligonucleotides (AAG CTT AGA ACA GTT TGT AAC GAG CTC GTT ACA AAC TGT TCT AGC TCG TTA CAA ACT GTT CTA AGC TCA AGC TTA),14was combined downstream (30 ) of an enhancer sequence (ACT CTG GAG GAA CAT ATT GTA TCG ATT)13 required for strong AR binding affinity. The construct was inserted at the multiple cloning site of the pTA-SEAP plasmid (Clontech, Mountain View, CA) between Bgl-II and Mlu-I. The resulting construct was verified by DNA sequencing of the sense and antisense strands. Stable Transfections. Yeast strain YPH500 (MatR, ura3-52, lys2-801, ade2-101, trp1-Δ63, his3-Δ200, leu2-Δ1) was cotransformed with the full-length human androgen receptor (hAR)cDNA expression plasmid (encoding the human androgen receptor fused to the CUP1 metallothionein promoter) and the ARE-β-galactosidase reporter plasmid (harboring androgen response elements upstream of the β-gal reporter gene), by standard alkali transformation.12 Both plasmids were obtained from Dr. DP McDonnell (Duke University). HEK293 cells were cotransfected with the hAR-puromycin expression plasmid (provided by Prof. Ilpo Huhtaniemi, Imperial College) and either our enhancer/ARE/SEAP construct or the MMTV-luciferase vector (obtained from Dr. Ron Evans, Salk Institute) using Fugene transfection reagent (Roche, Indianapolis, IN). After 48 h, antibiotic selection was initiated with 1 μg/mL puromycin dihydrochloride (Sigma). HuH7 cells were cotransfected with hAR-puromycin and our enhancer/ARE/SEAP construct. Seventy two hours after transfection, antibiotic selection was initiated using 5.5 μg/mL puromycin dihydrochloride. Every 3 days, cells were washed with PBS and replaced with fresh media supplemented with puromycin. After 2 weeks (HEK293) and 6 weeks (HuH7), visible colonies were isolated using sterile 8 mm cloning cylinders (Millipore, Temecula, CA). The clones showing highest SEAP or luciferase activity were selected and designated HEK293-S (for HEK293/enhancer/ARE-SEAP clone), HEK293-L (for HEK293/MMTV-luciferase clone), and HuH7-S (for HuH7/enhancer/ARE-SEAP clone). The yeast strain harboring the ARE-β-gal construct was designated yeast-B. Real-Time PCR. Total RNA was extracted from cells using TRI reagent (Sigma). cDNA was reverse transcribed from 200 to 800 ng of total RNA, and real-time PCR performed with 35-40 amplification cycles using SYBER Green Supermix (Biorad, Hercules, CA) for relative quantification of human steroid metabolizing enzymes and steroid hormone receptors (Table 1). Western Blot. Total protein lysate was extracted from HEK293 or HuH7 cells using modified RIPA lysis buffer containing 1% nonidet P-40, 0.1% sodium dodecyl sulfate (SDS), 0.5% sodium deoxycholate, 150 mM NaCl, and 50 mM Tris base (pH 8). Cellular proteins (60 μg) were resolved by SDS polyacrylamide gel electrophoresis (PAGE) and transferred onto 2066

dx.doi.org/10.1021/ac102845y |Anal. Chem. 2011, 83, 2065–2074

Analytical Chemistry

ARTICLE

Table 1. Primer Sequences for PCR Analysis primer sequences gene

sense (50 -30 )

antisense (50 -30 )

3β-HSD1

acggtggagtgggttggttc

3β-HSD2

gccagtcttcatctacaccagt

gccagcacagccttctcag)

3R-HSD1

aagaagtggcaagcaatgga

gcagaatcaatatggcggaag

3R-HSD2

aataatgaggagcaggttgga

tggagaatgaataagatagaggtc

3R-HSD3

gccatccgaagcaagattg

agatagaggtcaacatagtccaa

17β-HSD1

ttatgcgagagtctggcggttc

gaagcggtggaaggtgtggat

17βHSD2

cactttcttctcggacacagcat

gacaggatgagcaggcagact

17β-HSD3 17β-HSD4

ccttctacagcggtgccttcc tgtgaggagaatggtggcttgt

tctgctcctctggtcctcttca tcttggatactctgaggcttgct

17β-HSD6

agccacctccaagacaagtatg

cgcagccagcactctcaa

17β-HSD7

gctgtctgtgctgctctg

agtgctttgatattagttgtggat

17β-HSD8

tctgtcgttgtgtcctgtg

atgctactgatgttgatgatgg

androgen receptor

caaaagagccgctgaagggaaaca ttcttcagcttccgggctcccaga

estrogen receptor-R actcaacagcgtgtctcc

tatgaaagggaggcagcaggac

cgttctccaggtagtaggg

estrogen receptor-β aagaatatctctgtgtcaaggccatg tggcaatcacccaaaccaaag progesterone receptor

ggcagcacaactacttatgtgc

tcatttggaacgcccact

glucocorticoid

actctgcctggtgtgctctg

tgctgtccttccactgctctt

receptor aromatase

ccatccttgccaatagtgtcatcc

ttctcttgtagcctggttctctgg

5R-reductase1

cggagaagcctgacttgagaacc

ccgtcgccgttgccatcg

5R-reductase2

cgggaagcacacggagagc

gtggaagtaatgtaggcagaagagg

a nitrocellulose membrane, as described.15 Membranes were incubated with a rabbit polyclonal antibody against human 17β-HSD2 (Abcam, Cambridge, UK) at 1:100 and an antirabbit IgG secondary horseradish peroxidase (HRP) conjugated antibody at 1:1000 (SantaCruz Biotech, Santa-Cruz, CA). Mammalian Cell Bioassays. On confluency, HEK293-S, HEK293-L, and HuH7-S cells were seeded into 96-well plates (2 104/well). After 24 h, media was replaced with phenol-red free DMEM supplemented with 10% charcoal-stripped FCS (200 μL/well) and treated with steroids in a final ethanol concentration of 0.1% for 24 h. For the luciferase assay, cells were disrupted using passive lysis buffer (Promega, Madison, WI), and the assay was performed using 10 μL of cell lysate and 50 μL of luciferase assay reagent (Promega, Madison, WI). The SEAP assay was performed using 25 μL of culture medium and 50 μL of substrate (Clontech). Luminescence was measured with a SpectraMax L luminometer (Molecular Devices, Balwyn North, VIC) at 470 nm (luciferase) and 527 nm (SEAP). Androgenic potency was defined as EC50 estimated from a 4 parametric sigmoidal curve fit using Sigmaplot version 8.0 software (Systat Software, Chicago, IL). For enzyme inhibitor assays, HEK293-S and HuH7-S cells were pretreated with meclofenamic acid for 3 h before steroid treatment and assayed as described above. Yeast Bioassay. Yeast-B from early midlog phase growth was aliquoted into 24-well plates (500 μL/well), and 100 μM CuSO4 was added to induce AR expression. Yeast was then treated with steroids over an appropriate concentration range and incubated overnight at 30 C with shaking (300 rpm). Following incubation, yeast was lysed and assayed for β-galactosidase activity as described previously.4 Androgenic potency was also defined as EC50 estimated from a 4 parametric sigmoidal curve fit. For

enzyme inhibitor assays, cells were treated with meclofenamic acid before steroid treatment and assayed as described above. For the antiandrogen screen, each nutraceutical-derived steroid was tested in the presence of 2.5nM testosterone (EC50 concentration), and its inhibitor potency was defined as its % inhibition of testosterone’s EC50 stimulating activity. LC-MS/MS Steroid Analysis. Unconditioned (0 h) DMEM media containing 2 μM of either estradiol or progesterone or EC50 concentrations of T (0.5 and 16 nM for HEK293-S and HuH7-S, respectively) were added to cells. After 24 h, 100 μL of incubation medium was collected and stored in glass vials. Media samples were diluted 1:40 with PBS (pH 7.4) for estradiol or progesterone but used undiluted for T measurements. Aliquots (100 μL) of cell culture samples, standards, or quality controls were transferred into 5 mL glass tubes, made up to 200 μL with PBS followed by the addition of 1 mL of Hex/EtOAc (3:2 ratio containing deuterated internal standards) and vigorously mixed for 1 min to extract steroids into the organic layer. Tubes were then covered and stood for 1 h at 4 C to allow phase separation before transfer to -80 C for 30 min to freeze the lower aqueous layer. The upper organic layer was then decanted into clean glass tubes with the solvent allowed to evaporate in a fume hood overnight at 37 C. Calibration standards were prepared by diluting the working profile solution into DMEM media, and quality control samples were prepared in-house by spiking media with appropriate volumes of steroid stock solutions. For analysis, the dried samples were resuspended in 500 μL of 20% methanol in PBS. Tubes were then mixed for 1 min, and the volume was transferred into a 96 well microtiter plate. A 425 μL aliquot was injected onto the column for LC-MS/MS analysis as described.16 Statistical Analysis. Data are presented as mean ( SD. Treatments were compared using a one-way ANOVA or a two-tailed Student t test, as appropriate. A value of p < 0.05 was considered to be statistically significant.

’ RESULTS AND DISCUSSION Establishing Mammalian Cell AR Bioassays. We generated a new AR reporter vector, incorporating a known ARE sequence combined with an additional enhancer sequence required for strong AR bioactivity. This construct was cloned upstream of the SEAP reporter gene and stably cotransfected with a human AR expression vector into HEK293 (HEK293-S) and HuH7 (HuH7-S) cells. The MMTV-luciferase reporter vector was also stably transfected in HEK293 cells (HEK293-L) for comparison. Human AR mRNA levels were quantified by real-time PCR (Figure 1A). In HEK293-S and HEK293-L, AR levels were 10and 8-fold higher compared with nontransfected HEK293, respectively. Compared to naive HuH7, which does not endogenously express the AR, the stable clone HuH7-S displayed significant AR expression (Figure 1A), although this was lower than in HEK293-S (3.5-fold lower) and HEK293-L (2-fold lower). We next assessed the sensitivity of the 4 androgen bioassays (HEK293-S, HEK293-L, HuH7-S, and yeast-B), using testosterone (T) and androstenedione (A4) as standards at concentrations ranging from 5 10-14 to 5 10-6 M (Figure 1B). At maximal T concentration, the dynamic range of the bioassay, defined as the magnitude of fold induction of read-out compared with vehicle treated cells, was highest for HEK293-S (1000-fold) and lowest for yeast-B (10-fold; Table 2). For T, the EC50 and 2067



ARTICLE

Figure 1. hAR levels in HEK293 and HuH7 cell lines and bioassay sensitivity. (A) Total RNA was extracted from nontransfected and stably transfected HEK293 and HuH7 cell lines. cDNA was reverse transcribed from 400 ng of total RNA, and qPCR was performed with 35 amplification cycles. Amplicons were visualized by 2% agarose gel electrophoresis using ethidium bromide staining. (B) Cells were assayed with T and A4 over concentrations ranging from 5 10-14 to 5 10-6 M, and bioactivity was expressed as a percentage of maximally inducing a T or A4 response. Data are presented as a mean ( SD of 5 independent experiments.

Table 2. Performance Characteristics of Bioassays EC50 (nM) bioassay

maximal fold-induction

A4

T

limit of T detection (nM)

HEK293-L HEK293-S

30 1000

15 ( 3.5 99 ( 5.6

0.07 ( 0.017 0.5 ( 0.13

0.00125 0.0125

yeast-B

10

45 ( 8.1

2.5 ( 0.47

0.5

HuH7-S

650

620 ( 172

16 ( 5.5

1.25

detection limit were (from most to least sensitive), HEK293-L, HEK293-S, yeast-B, and HuH7-S. Using A4 as standard, there was a similar rank order of EC50 except HEK293-S was less sensitive than yeast-B. Thus, for T, HEK293-L and HEK293-S are more sensitive than yeast-B and HuH7-S. Compared to the various other androgen bioassays reported to date, the sensitivity of our HEK293-S bioassay (0.5 nM) was similar to two previous versions of the same bioassay9,10 but higher than others (where EC50 for T is given)5,14,17-22 except for two, which were established in different cells lines (CHO23 and

PC-324). Unlike luciferase, SEAP activity can be measured directly from culture media, a procedure better suited for high-throughput screening. Interestingly, T EC50 of our HEK293-L bioassay (0.07nM) was an order of magnitude lower compared to previous reports of a similar bioassay,9,10 consistent with our construct featuring a more favorable site of genomic insertion and/or a greater number of copies of the transgenes (hAR and MMTV-luc).25 Validating AR Bioassays. To validate the enhancer/ARE/ SEAP construct, HEK293-S and HuH7-S were exposed to 2068



ARTICLE

Figure 2. Transactivational properties of AR antagonists in HEK293-S and HuH7-S bioassays. HEK293-S and HuH7-S cells were treated with increasing concentrations of either CA or HF in the presence and absence of EC50 concentration of T. (A) HEK293-S. (B) HuH7-S. Data are presented as a mean ( SD of 3 independent experiments.

increasing concentrations of a steroidal (cyproterone acetate, CA) and a nonsteroidal (hydroxyflutamide) AR antagonist in the presence of EC50 concentrations of T (0.5 and 16 nM for HEK293-S and HuH7-S, respectively). Both antagonists inhibited a T-induced enhancer/ARE/SEAP response in a dose dependent manner (Figure 2), as reported for the MMTVluciferase construct9 but with CA showing significant agonist activity at high concentrations (>5 μM), the latter consistent with CA being a partial androgen antagonist. We next screened both cell lines for endogenous expression of major steroid metabolizing enzymes by real time PCR (Table 3). Aromatase, 5R-reductases, and most hydroxy steroid dehydrogenases (HSD) were expressed at comparable levels in both HEK293 and HuH7. Two HSDs, namely 3R-HSD1 and 3βHSD1, were expressed in HuH7 but not in HEK293 cells. More importantly, 17β-HSD2, a key enzyme that catalyzes the conversion of T to A4, was expressed at significantly higher levels in HuH7 (40%), which was also confirmed at the protein level. We also screened our stable cell lines for endogenous expression of other steroid hormone receptors by real-time PCR (Figure 3A). The glucocorticoid receptor (GR; primer consensus to 7 transcript variants) was expressed in both HEK293 and HuH7 (Ct values of 18.69 ( 0.12 and 23.21 ( 0.13, respectively), as well as the estrogen receptor (ER-β), but to a lesser extent (Ct values of 30.88 ( 0.32 and 35.44 ( 0.09, respectively). The progesterone receptor (PR) was expressed in HuH7 (Ct value 33.82 ( 0.59) but not in HEK293. The estrogen

receptor ER-R could not be detected (Figure 3A) in either HEK293 or HuH7. To determine the specificity of our novel enhancer/ARE/ SEAP construct to androgens, HEK293-S and HuH7-S were exposed to increasing concentrations of estradiol, progesterone, or dexamethasone (Figure 3B). The enhancer/ARE/SEAP construct was highly specific. In the HEK293-S bioassay relative to T, neither dexamethasone nor progesterone had any significant effect on the bioassay whereas estradiol was cross-reactive but only at very supraphysiological concentrations (>100nM). As ER-R mRNA was not expressed, it is possible the estradiol response was mediated via the low level of ER-β expression in this cell line (Figure 3A).26 Alternatively, given that the ER’s have distinct DNA recognition sequences,27 the estradiol response may instead be mediated via direct cross-reactivity at the AR, as previously described in a yeast AR bioassay.28 The low apparent cross-reactivity of estradiol in HEK293-S was not due to rapid estradiol metabolism by the host cells as 63% of initial estradiol levels remained after 24 h (Table 4). Another study has demonstrated minimal glucocorticoid but some estradiol and progesterone-induced transactivating activity using ARE repeat sequences.14 In the HuH7 cell line, our enhancer/ARE/SEAP construct showed a negligible response for all of the nonandrogenic steroids, even at 2 μM, consistent with specificity for androgens over these nonandrogenic steroids. However, the avid metabolism of both estradiol and progesterone (decreased by 95% and 2069



ARTICLE

67%, respectively, after 24 h in the bioassay, Table 4) precluded any firm exclusion of cross-reactivity by these nonandrogenic steroids. In contrast, the HEK293-L bioassay showed significant activity for estradiol and dexamethasone, as described previously.9,10 This may be explained by endogenous expression of GR and ER-β in HEK293 or possibly direct cross-reactivity with the AR. Above 10 nM, progesterone showed some activity relative to T in the HEK293-L but not in the HEK293-S bioassay, despite the absence of PR mRNA expression and presence of Table 3. Endogenous Steroidogenic Enzyme mRNA Expression in HEK293 and HuH7 Cellsa enzyme

significant progesterone metabolism in this cell line (64% reduction). We hypothesize that, in HEK293, progesterone binds to the AR29 at these concentrations and that the progesterone-AR complex tethers to the MMTV sequence but not to the enhancer/ARE sequence. In addition, the differential recruitment of AR coregulators by the MMTV and enhancer/ARE sequence is plausible30and can also account in part for the disparate response of progesterone in HEK293-S and HEK293-L. From these analyses, we conclude that our hybrid enhancer/ARE sequence permits high specificity to androgens in HEK293-S when compared to the HEK293-based MMTV-luciferase system while the negligible response of estradiol and progesterone in HuH7-S is likely to be mostly due to steroid metabolism.

HEK293 (Ct value)

HuH7 (Ct value)

3β-HSD1

ND

26.46 ( 0.08

3β-HSD2

28.59 ( 0.30

25.62 ( 0.09

3R-HSD1 3R-HSD2

ND 28.63 ( 0.15

25.56 ( 0.03 20.5 ( 0.14

3R-HSD3

34.01 ( 0.12

23.4 ( 0.15

17β-HSD1

30.22 ( 0.48

32 ( 0.13

17β-HSD2

33.5 ( 0.44

23.87 ( 0.18

17β-HSD3

30.21 ( 0.28

25.2 ( 0.35

0

34.2 ( 0.84

17β-HSD4

19.9 ( 0.26

18.9 ( 0.13

24

1.73 ( 0.56

17β-HSD6

27.98 ( 0.15

29.7 ( 0.35

HEK293-S

17β-HSD7 17β-HSD8

25.96 ( 0.14 25.02 ( 0.13

26 ( 0.06 24.6 ( 0.2

0

38.05 ( 0.35

24

23.9 ( 0.84

aromatase

29.31 ( 0.86

30.7 ( 0.05

5R-Red1

25.56 ( 0.12

23 ( 0.14

5R-Red2

35.8 ( 0.31

30.52 ( 0.24

Table 4. Measurements of E2 and P4 by Mass Spectrometry in Bioassay Media time (hrs)

steroid

reduction

E2 (ng/mL) HuH7-S -95%

-37%

P4 (ng/mL) HuH7-S

a

Total RNA was extracted from HEK293 and Huh7 cells; cDNA was synthesized using 800 ng of total RNA for enzymes 3β-HSD1,2, 17βHSD1-4, and aromatase and 200 ng of total RNA for all other enzymes. Real-time PCR was performed for each enzyme in duplicate. Data are represented as ( SD of 3 independent RNA extractions. ND: not detected.

0 24

18.4 ( 1.55 6.21 ( 0.42

-67%

HEK293-S 0

22.5 ( 0.7

24

8.13 ( 0.02

-64%

Figure 3. Endogenous steroid receptor expression in HEK293 and HuH7 cells and cross reactivity of nonandrogenic steroids in the HEK293-S, HEK293-L, and HuH7-S bioassays. (A) Total RNA was extracted from HEK293 cells, and cDNA was synthesized by reverse transcription using 400 ng of total RNA. qPCR was performed with 40 amplification cycles, and amplicons were visualized on 2% agarose gel electrophoresis using ethidium bromide staining. (B) Dexamethasone, estradiol, and progesterone were assayed over a concentration range of 0.1 nM to 2 μM in all 3 mammalian bioassays. Bioactivity was expressed as a percentage of the maximal T response. Data are presented as a mean ( SD of 3 independent experiments. 2070



ARTICLE

Table 5. Parallel Bioactivity Comparison of Bioassaysa yeast EC50 (nM)

HEK293 (S) RP

EC50 (nM)

HEK293 (L) RP

EC50 (nM)

Huh7 (S) RP

RP

testosterone

2.5 ( 0.47

100

0.5 ( 0.13

100

100

16 ( 5.5

100

DHT

1.9 ( 0.68

131

0.09 ( 0.003

555

0.006 ( 5 10-4

1166

1.6 ( 0.26

1000

hemapolin

7.4 ( 0.83

34

3333

0.0015 ( 3 10-4

norbolethone

3.8 ( 0.15

66

0.3 ( 0.036

madol

16 ( 0.15

15

1.8 ( 0.052

furazadrol

1.2 ( 0.70

208

0.2 ( 0.036

250

oxyguno

650 ( 60

5 ( 0.305

10

0.38

0.015 ( 0.0

0.07 ( 0.017

EC50 (nM)

166 27.8

4666

0.020 ( 0.005

80000

0.012 ( 0.01

580

0.3 ( 0.01

5333

0.15 ( 0.02

47

2.5 ( 0.93

640

0.003 ( 7 10-5

2333

20 ( 5.0

80 106

0.6 ( 0.44

11.7

15 ( 3.6

androstenedione trena

45 ( 8.1 92 ( 11.0

5.5 2.7

99 ( 5.6 180 ( 7.0

0.5 0.28

15 ( 3.5 15 ( 5.0

0.5 0.5

620 ( 172 115 ( 1.5

2.5 15

formadrol

55 ( 5.7

4.5

450 ( 24.0

0.1

136 ( 60.0

0.05

3700 ( 524.0

0.4

EC50: concentration yielding half of maximal response, presented as ( SD. RP: relative potency (bioactivity of steroid relative to testosterone; T[EC50]/steroid[EC50] 100). (S): enhancer/ARE/SEAP bioassay. (L): MMTV-luciferase bioassay. a

Interestingly, the HEK293-L bioassay showed higher sensitivity (lower EC50; Table 5) for all steroids tested compared to HEK293-S. This may be attributed to the less specific MMTV sequence in HEK293-L, exhibiting stronger binding affinity to steroid receptors and/or the wider dynamic range of the luciferase reporter gene (7 vs 5 orders of magnitude for the SEAP reporter according to their suppliers), but further experimentation would be required to clarify the relevant mechanism. Androgenic Activity of Known and Nutraceutical Derived Androgens. A series of natural (T, DHT) and synthetic (Madol, norbolethone, Furazadrol, Hemapolin, and Oxyguno) androgen steroids (Figure S-1, Supporting Information) relevant to sports doping were comparatively tested in all androgen bioassays. For each compound, the mean EC50 and relative potency (RP) versus the reference androgen T (defined as 100%) was calculated (Table 5). All androgens tested showed full agonist activity (defined as ultimately reaching 100% enzyme activity) in all bioassays. The androgens extracted from nutraceuticals elicited no antagonist activity (defined as % of T EC50), as shown in yeast-B (Figure S-2, Supporting Information). We previously demonstrated using the yeast bioassay that norbolethone and DHT are potent androgens.4,12 We extend these findings to include an additional designer androgen, Madol. These steroids were found to elicit potent androgenic activity in the yeast bioassay at concentrations in the nM range and remained potent across all 3 mammalian bioassays (Table 5). In keeping with our previous study,4,12 norbolethone exhibited similar potency (EC50 of 3.8 nM and RP of 66) to T, while Madol elicited reduced androgenic activity (EC50 of 16 nM and RP of 15) in yeast. Madol in the HEK293-S and HEK293-L bioassays also showed a decrease in potency but an exaggerated response in HuH7-S relative to T (RP of 27.8, 47, and 640, respectively), likely due to the high EC50 value of T. However, conversion of Madol to higher potency metabolite/s in this cell line as a cause of the high RP cannot be ruled out. In contrast, norbolethone consistently exhibited increased AR potency in HEK293-S, HEK293-L, and HuH7-S (RP of 166, 580, and 5333, respectively), also consistent with previous findings in yeast.12 Results from our study, however, indicate that norbolethone may be metabolized to higher potency metabolite/s as the RP is above T in the mammalian lines but below T in yeast. Nonetheless, compared to yeast, the EC50 values for these potent androgens were lower in the mammalian cell bioassays, suggesting the

importance of AR coactivators in amplifying ARE transcriptional activity.31 This is supported by the fact that DHT, the most potent natural androgen and therefore unable to convert to any more potent androgens, has lower EC50 values in the mammalian bioassays (HEK293-S and -L and HuH7-S) compared to yeast. The consistent relative potency for Madol in the mammalian cell line (HEK293-S and -L) compared with yeast also indicates that the lower EC50 values are due to the contribution of AR coactivators rather than metabolic activation. In line with this, a literature review revealed that 10/12 (85%) of all mammalian bioassays reported to date have greater sensitivity than all yeast bioassays reported to date when the EC50 of reference compounds are compared (unpublished). In the HuH7-S cell line, however, we found low T sensitivity. This was likely due to T to A4 conversion by 17β-HSD2 which was present in abundance both at the mRNA (Table 3) and at the protein level (Figure 4A), in HuH7 relative to HEK293. To confirm this hypothesis, we treated HuH7-S, HEK293-L, and yeast-B cells with meclofenamic acid (MA), a nonselective inhibitor of aldo-keto-reductase (AKR1C) class of steroid metabolizing enzymes (e.g., AKR1C1, 2, and 3).32 This compound was selected for its nonspecific enzyme inhibition of 3β and 17β-HSD enzymes (effective in the μM concentration range). As anticipated, T bioactivity was increased in HuH7-S but not in HEK293-S or yeast-B with 20 μM MA (Figure 4B). At inhibitor concentrations up to 5 μM, no effect on AR bioactivity was observed, while concentrations at 50 μM or above cell toxicity was evident in mammalian but not in yeast cells (data not shown). These effects were verified by MS measurements of steroids in the bioassay medium which demonstrated a marked depletion in T levels after 24 h but significant inhibition of T metabolism by cotreatment with 20 μM MA in HuH7-S (Table 6) whereas there was minimal change in T levels in HEK293-S and yeast-B with and without MA (Table 6). Consistent with these findings, in HUH7-S, the EC50 of T decreased from 16 to 5.5 nM in the presence of the inhibitor (Figure S-3, Supporting Information), indicating that the low T sensitivity in that mammalian bioassay is largely due to T metabolism to A4. In this experiment, T levels after 24 h in the presence of MA did not maintain unchanged levels comparable with unconditioned media (Table 6), consistent with previous observations that MA is an incompletely effective inhibitor22 whereby DHEA conversion to A4 was only partially blocked by a 3β-HSD specific inhibitor. 2071



ARTICLE

Figure 4. Effects of the steroid metabolizing enzyme inhibitor meclofenamic acid (MA) on bioactivity. (A) Western blot analysis of 17β-HSD2 expression in HuH7 and HEK293 cells. (B) HEK293-S, HuH7-S, and yeast-B cells were exposed to an experimentally determined μM range of a promiscuous inhibitor, MA in the presence of EC50 stimulating concentration of steroids. Bioactivity was expressed as percentage of the EC50 response. Data are expressed as a mean ( SD of 3 independent experiments. No significant effect on AR bioactivity was observed in yeast at all concentrations tested (data not shown). /, # p < 0.05 vs nontreated cells.

Two nutraceutical extracts with a T backbone, Hemapolin and Furazadrol, showed androgen bioactivity similar to or greater than the known potent androgens tested in the yeast bioassay (Table 5). Hemapolin, with a thioepoxide group and an added C17R methyl, was claimed in its marketing to be an “estrogen blocker” without reference to its potent androgenic effects which we identified. In the mammalian bioassays, however, Hemapolin showed the highest AR bioactivity, surpassing T by 800-fold in the HuH7-S bioassay. It is likely that, in these mammalian cell lines, Hemapolin is a proandrogen and is metabolized to more potent androgenic metabolites. Indeed, consistent with this proposition, in the presence of 20 μM MA, a significant decrease in Hemapolin bioactivity was observed in both mammalian cell lines but not in yeast (Figure 4B). Relative to T, Furazadrol, a steroid isomeric mixture showed 2-fold (yeast-B) and 2.5-fold

(HEK293-S) higher AR bioactivity but lower AR bioactivity in the HuH7-S bioassay. These effects could at least partially be reversed when cells were treated with MA in the mammalian cell bioassays (Figure 4B), indicating that the differing potencies are a result of metabolic conversion(s). In contrast, Oxyguno, which could not be fully structurally characterized, was shown to have almost negligible AR bioactivity in yeast, possibly due to the 11keto substitution which resembles a corticosteroid (as indicated on labeling). Here, we show that the extract/s from Oxyguno is a potent androgen in the mammalian cell bioassays (RP of 10, 11.7, and 106 in HEK293-S, HEK293-L, and HuH7-S, respectively). This suggests likely pro-drug metabolism as, in the presence of MA, bioactivity significantly decreases in the HEK293-S and HuH7-S cell lines (Figure 4B). MA was not tested in the HEK293-L bioassay, as it is the same cell line as HEK293-S 2072



ARTICLE

Table 6. Measurements of T by Mass Spectrometry in Bioassay Mediaa T (ng/mL)

% change

0 24

8.125 ( 0.67 0.065 ( 0.02

-99.2% vs 0 h

24 (MA)

0.155 ( 0.04

þ230% vs 24 h

time (h) HuH7-S

HEK293-S 0 24 24 (MA)

0.825 ( 0.09 0.67 ( 0.05

-18.8% vs 0 h

0.615 ( 0.05

-8.3% vs 24 h

0.97 ( 0.18 0.88 ( 0.07

-9.3% vs 0 h

yeast-B 0 24 24 (MA) a

1.015 ( 0.02

þ15.3% vs 24 h

MA is 20 μM meclofenamic acid.

and was expected to exhibit the same effect. MA had no apparent effect in yeast-B, indicating the absence of specific steroid metabolizing enzymes in this model. Oxyguno’s high relative potency and Furazadrol’s lower relative potency in the HuH7-S compared to HEK293-S and yeast milieus certainly underscores the significance of comparing different bioassays to define androgenic activity within vastly different cellular metabolic environments. Androgenic Activity of Known and Nutraceutical Derived Pro-Androgens. The AR bioactivity of nutraceutical steroids with an A4 (proandrogen) backbone (Trena and Formadrol) (Figure S-1, Supporting Information) were also measured and compared with A4 (Table 5). The extract from Trena was novel in structure, while the isolate from Formadrol, although previously described chemically, has not been reported as detected in supplements until now (Figure S-1, Supporting Information). Overall, the proandrogenic steroids showed relatively weak androgenic potency (and no antagonistic activity (Figure S-2, Supporting Information)) with exception of Trena in the HuH7S bioassay (RP of 15%), indicating conversion to slightly more potent metabolite/s unlike that seen for A4. In all four bioassays, A4 had very low AR bioactivity (RP of 5.5, 0.5, 0.5, and 2.5% relative to T in yeast-B, HEK293-S, HEK293-L, and HuH7-S, respectively). Surprisingly, relative potency for A4 in the HEK293 cell line decreased relative to yeast but was not recoverable in the presence of MA (Figure 4B). This suggests that A4 may be metabolized by an enzyme not inhibited by MA or that A4 has independent androgenic activity influenced by AR coregulators as described previously for androstenediol.33 In contrast, MA increased A4 bioactivity in HuH7-S, indicating that A4 is likely catabolized in this cell line. In all three mammalian cell bioassays, Formadrol, with a C6-methyl substitution, consistently showed a decrease in relative potency compared to yeast (4.5, 0.1, 0.05, and 0.4%, respectively), even lower than that of A4, indicating that metabolites with poor AR bioactivity are formed. Trena, lacking the C19-methyl group, had 2-fold lower AR activity in yeast-B and HEK293-S, similar AR bioactivity in HEK293-L, but increased in HuH7-S, compared with A4 (RP of 2.7, 0.28, 0.5, and 15%, respectively; Table 5).

’ CONCLUSIONS In summary, comparing yeast and mammalian in vitro androgen bioassays, yeast lack steroid receptors, metabolizing

enzymes, and coregulators, which can alter apparent androgenic bioactivity, so they might be considered to have high fidelity and specificity as they measure a molecule’s intrinsic androgenic bioactivity.22,28 In contrast, mammalian cell-based in vitro androgen bioassays are inherently more sensitive than yeast-based bioassays but also express a variable array of steroid metabolizing enzymes which can either enhance or diminish androgenic bioactivity of a test compound. In that sense, the mammalian cell androgen bioassays may detect proandrogens but, conversely, may underestimate androgenic potency of some metabolizable androgens. Hence, mammalian cell androgen bioassays have higher sensitivity while sacrificing specificity. From this study, we show that nutraceuticals obtained from Internet-based suppliers contain a number of different steroids that all display androgenic activity of varied potency. We also show, for the first time, a parallel comparison of yeast and mammalian bioassays and demonstrate that the androgenic biopotency of a compound can vary dramatically between bioassays. We show that these discrepancies likely result from variable expression of steroid metabolism enzymes and/or AR coregulators. The HEK293 cell line, previously thought to lack such enzymes, has the capability to metabolize steroids, an observation amplified in the HuH7 cell line. Thus, the goal of a universal, unambiguous androgen bioassay for screening designer androgens may be more feasible in yeast, and findings of the in vitro androgenic biopotency of novel chemicals in mammalian lines need to be considered in relation to the actual bioassay format used.

’ ASSOCIATED CONTENT

bS

Supporting Information. Additional information as noted in text. This material is available free of charge via the Internet at http://pubs.acs.org.

’ AUTHOR INFORMATION Corresponding Author

*Address: ANZAC Research Institute, Sydney NSW 2139, Australia. E-mail: [email protected].

’ REFERENCES (1) Handelsman, D. J. J. Clin. Endocrinol. Metab. 2005, 90, 1249– 1251. (2) Geyer, H.; Parr, M. K.; Koehler, K.; Mareck, U.; Schanzer, W.; Thevis, M. J. Mass Spectrom. 2008, 43, 892–902. (3) Handelsman, D. J. Sci. STKE 2004, 2004, No. e41. (4) Death, A. K.; McGrath, K. C.; Kazlauskas, R.; Handelsman, D. J. J. Clin. Endocrinol. Metab. 2004, 89, 2498–2500. (5) Guth, S. E.; Bohm, S.; Mussler, B. H.; Eisenbrand, G. Mol. Nutr. Food Res. 2004, 48, 282–291. (6) McRobb, L.; Handelsman, D. J.; Kazlauskas, R.; Wilkinson, S.; McLeod, M. D.; Heather, A. K. J. Steroid Biochem. Mol. Biol. 2008, 110, 39–47. (7) Michelini, E.; Leskinen, P.; Virta, M.; Karp, M.; Roda, A. Biosens. Bioelectron. 2005, 20, 2261–2267. (8) Bovee, T. F.; Lommerse, J. P.; Peijnenburg, A. A.; Fernandes, E. A.; Nielen, M. W. J. Steroid Biochem. Mol. Biol. 2008, 108, 121–131. (9) Roy, P.; Franks, S.; Read, M.; Huhtaniemi, I. T. J. Steroid Biochem. Mol. Biol. 2006, 101, 68–77. (10) Chen, J.; Sowers, M. R.; Moran, F. M.; McConnell, D. S.; Gee, N. A.; Greendale, G. A.; Whitehead, C.; Kasim-Karakas, S. E.; Lasley, B. L. J. Clin. Endocrinol. Metab. 2006, 91, 4387–4394. (11) Cato, A. C.; Henderson, D.; Ponta, H. EMBO J. 1987, 6, 363–368. 2073



ARTICLE

(12) McRobb, L.; Handelsman, D.; Kazlauskas, R.; Wilkinson, S.; McLeod, S.; Heather, A. J. Steroid Biochem. Mol. Biol. 2008, 110, 39–47. (13) Cleutjens, K. B.; van der Korput, H. A.; van Eekelen, C. C.; van Rooij, H. C.; Faber, P. W.; Trapman, J. Mol. Endocrinol. 1997, 11, 148–161. (14) Sonneveld, E.; Jansen, H. J.; Riteco, J. A.; Brouwer, A.; van der Burg, B. Toxicol. Sci. 2005, 83, 136–148. (15) Lambert, G.; Ancellin, N.; Charlton, F.; Comas, D.; Pilot, J.; Keech, A.; Patel, S.; Sullivan, D. R.; Cohn, J. S.; Rye, K. A.; Barter, P. J. Clin. Chem. 2008, 54, 1038–1045. (16) Harwood, D. T.; Handelsman, D. J. Clin. Chim. Acta 2009, 409, 78–84. (17) Raivio, T.; Palvimo, J. J.; Dunkel, L.; Wickman, S.; Janne, O. A. J. Clin. Endocrinol. Metab. 2001, 86, 1539–1544. (18) Hartig, P. C.; Bobseine, K. L.; Britt, B. H.; Cardon, M. C.; Lambright, C. R.; Wilson, V. S.; Gray, L. E., Jr. Toxicol. Sci. 2002, 66, 82–90. (19) Araki, N.; Ohno, K.; Takeyoshi, M.; Iida, M. Toxicol. In Vitro 2005, 19, 335–352. (20) Sonneveld, E.; Riteco, J. A.; Jansen, H. J.; Pieterse, B.; Brouwer, A.; Schoonen, W. G.; van der Burg, B. Toxicol. Sci. 2006, 89, 173–187. (21) Houtman, C. J.; Sterk, S. S.; van de Heijning, M. P.; Brouwer, A.; Stephany, R. W.; van der Burg, B.; Sonneveld, E. Anal. Chim. Acta 2009, 637, 247–258. (22) Need, E. F.; O’Loughlin, P. D.; Armstrong, D. T.; Haren, M. T.; Martin, S. A.; Tilley, W. D.; Wittert, G. A.; Buchanan, G. Clin. Endocrinol. (Oxford) 2010, 72, 87–98. (23) Paris, F.; Servant, N.; Terouanne, B. Mol. Cell. Endocrinol. 2002, 198, 123–129. (24) Terouanne, B.; Tahiri, B.; Georget, V.; Belon, C.; Poujol, N.; Avances, C.; Orio, F.; Balaguer, P.; Sultan, C. Mol. Cell. Endocrinol. 2000, 160, 39–49. (25) Natesan, S.; Rivera, V. M.; Molinari, E.; Gilman, M. Nature 1997, 390, 349–350. (26) Kuiper, G. G.; Lemmen, J. G.; Carlsson, B.; Corton, J. C.; Safe, S. H.; van der Saag, P. T.; van der Burg, B.; Gustafsson, J. A. Endocrinology 1998, 139, 4252–4263. (27) Claessens, F.; Denayer, S.; Van Tilborgh, N.; Kerkhofs, S.; Helsen, C.; Haelens, A. Nucl. Recept. Signaling 2008, 6, e008. (28) Bovee, T. F.; Helsdingen, R. J.; Hamers, A. R.; van Duursen, M. B.; Nielen, M. W.; Hoogenboom, R. L. Anal. Bioanal. Chem. 2007, 389, 1549–1558. (29) Vinggaard, A. M.; Joergensen, E. C.; Larsen, J. C. Toxicol. Appl. Pharmacol. 1999, 155, 150–160. (30) Kotaja, N.; Aittomaki, S.; Silvennoinen, O.; Palvimo, J. J.; Janne, O. A. Mol. Endocrinol. 2000, 14, 1986–2000. (31) Heinlein, C. A.; Chang, C. Endocr. Rev. 2002, 23, 175–200. (32) Byrns, M. C.; Penning, T. M. Chem. Biol. Interact. 2009, 178, 221–227. (33) Miyamoto, H.; Yeh, S.; Lardy, H.; Messing, E.; Chang, C. Proc. Natl. Acad. Sci. U.S.A. 1998, 95, 11083–11088.

2074


Evaluation of Androgenic Activity of Nutraceutical-Derived Steroids

Recommend Documents