Exogenous Melatonin Treatment Increases Chilling Tolerance and

Article pubs.acs.org/JAFC

Exogenous Melatonin Treatment Increases Chilling Tolerance and Induces Defense Response in Harvested Peach Fruit during Cold Storage Shifeng Cao,† Chunbo Song,‡ Jiarong Shao,‡ Kun Bian,‡ Wei Chen,‡ and Zhenfeng Yang*,‡ †

Nanjing Research Institute for Agricultural Mechanization, Ministry of Agriculture, Nanjing, Jiangsu 210014, People’s Republic of China ‡ College of Biological and Environmental Sciences, Zhejiang Wanli University, Ningbo, Zhejiang 315100, People’s Republic of China ABSTRACT: The effect of exogenous melatonin on chilling injury in peach fruit after harvest was investigated. To explore the optimum concentration of melatonin for chilling tolerance induction, peach fruit were treated with 50, 100, or 200 μM melatonin for 120 min and then stored for 28 days at 4 °C. The results showed that application of melatonin at 100 μM was most effective in reducing chilling injury of peach fruit after harvest. Peaches treated with melatonin at this concentration displayed higher levels of extractable juice rate and total soluble solids than the non-treated peaches. In addition, melatonin treatment enhanced expression of PpADC, PpODC, and PpGAD and consequently increased polyamines and γ-aminobutyric acid (GABA) contents. Meanwhile, the upregulated transcripts of PpADC and PpODC and inhibited PpPDH expression resulted in the higher proline content in melatonin-treated fruit compared to the control fruit. Our results revealed that melatonin treatment may be a useful technique to alleviate chilling injury in cold-stored peach fruit. The chilling tolerance of harvested peaches induced by melatonin treatment is associated with higher levels of polyamine, GABA, and proline. These data provided here are the first protective evidence of exogenous melatonin in harvested horticultural products in response to direct chilling stress. KEYWORDS: melatonin, peach fruit, polyamines, γ-aminobutyric acid, proline

■

INTRODUCTION Peach fruit (Prunus persica), as a typical tropical fruit, quickly reaches the peak of respiration and ethylene after harvest at room temperature and, thus, accelerates senescence and deterioration.1 Cold storage is one of the most widely used technologies to retard respiration and other metabolic processes and then extend the harvested life of peach fruit.2 However, the fruit is very sensitive to chilling injury (CI) when stored at temperatures below 10 °C. The symptoms of CI include internal browning and flesh mealiness, which shortens storage life and reduces consumer acceptance.3 Therefore, the better understanding of physiological response to low-temperature stress of harvested peach fruit and developing techniques to induce chilling tolerance is in urgent demand for its storage and transportation.4 Melatonin (N-acetyl-5-methoxytryptamine), a well-known animal hormone, was discovered in plants in 1995.5 It is present in different parts of all of the plant species studied, including leaves, stems, roots, fruit, and seeds.6 In recent years, a growing number of researchers have found melatonin, as an effective free-radical scavenger in plants, playing an important role in regulating stress response, plant growth, and development.7−9 It has been shown that melatonin took part in a semilunar rhythm in macroalgae and protected this plant against hightemperature stress.10 Recently, Szafranska et al. reported that mung bean seedlings from seeds primed with melatonin showed a 20% increase in root length and had less disorganized cell ultrastructure at chilling compared to the control.11 Treatment with melatonin attenuated apoptosis cold-induced in carrot suspension cells. Cold-stress-induced shrinkage and © XXXX American Chemical Society

disruption of carrot cell plasma membranes were almost completely alleviated by melatonin treatment.12 These results suggested that, like in animal cells, melatonin also exerts an antiapoptotic effect in plant cells in response to cold stress. However, the effect of exogenous melatonin treatment on quality maintenance and storage life in harvested horticultural products has not yet been reported. Changes in polyamine biosynthesis in plant tissues have been associated with various kinds of stresses.13 Some evidence suggests a relationship between the increase of the polyamine content and chilling tolerance enhancement in harvested horticultural crops. It has been observed that heat treatment reduced CI in pomegranate fruit as a result of the induction of the endogenous polyamine content.14 Nitric-oxide-induced chilling tolerance in bananas was also related to the increase in the polyamine content.15 Moreover, exogenous polyamine treatment could reduce CI in many chilling-sensitive fruit, such as apricot, cucumber, and zucchini fruit.16−18 Both γ-aminobutyric acid (GABA) and proline are wellknown to be involved in regulating stress tolerance in plants, which is closely correlated with polyamine metabolism.19,20 GABA, a four-carbon non-protein amino acid, can rapidly accumulate in response to a variety of biotic and abiotic stresses.21 It is generally believed that GABA is derived from glutamate, via Ca2+/calmodulin- or low pH-mediated stimReceived: March 9, 2016 Revised: June 8, 2016 Accepted: June 8, 2016

A

DOI: 10.1021/acs.jafc.6b01118 J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Article

Journal of Agricultural and Food Chemistry Table 1. Primers Used for Gene Expression Analysis gene

accession number

forward and reverse primer sequence

annealing temperature (°C)

amplicon size (bp)

PpOAT

KP973954

57

120

PpP5CS

KP973956

56

140

PpPAO

KP973957

56

114

PpGAD

KP973955

56

106

PpADC

BAG68575

55

143

PpODC

EMJ01803

57

101

PpPDH

EMJ16473

58

104

PpTEF2

JQ732180

F: CCTTATTGCCTGGACATCT R: CAGCCTCTCCTTGAATGG F: CGCATCGTTCTCAAGGTT R: GCTCCTGATGACACCAATA F: CGTTGACGAATGAGGAATC R: CAGTAGCTTCAGGAATGTTG F: CCAAGCCGAATCTCTACG R: TCTCTTCTACACTCTTCTTAGC F: TGTCATCCGACCTCTACC R: AACCTTCTTCACGATCTTCA F: GAGAGTATTGGATTAGTGATGG R: GGTGAGGACTTAGAATTTGG F: GTCTCCTATTCACGATAGCA R: CAAGAACAACTCCACCAGA F: GGTGTGACGATGAAGAGTGATG R: TGAAGGAGAGGGAAGGTGAAAG

59

129

ulation of glutamate decarboxylase (GAD) activity.19 In addition to GABA, proline can act as a potent non-enzymatic antioxidant. Its accumulation has been proposed to serve as a chilling adaptation in higher plants.22 Recently, it has been demonstrated that exogenous application of methyl jasmonate (MeJA), glycine betaine, GABA, and nitric oxide can effectively induce chilling tolerance and ameliorate CI by increasing levels of GABA and proline in several harvested fruit.15,23−25 To our knowledge, there has been no report on the effect of melatonin on the chilling tolerance of harvested horticultural crops. Therefore, the objective of this study was to investigate the exogenous melatonin treatment on CI in harvested peach fruit during cold storage. Moreover, the effects of exogenous melatonin treatment on polyamine, GABA, and proline were also investigated to unveil the contributions of these compounds to chilling tolerance of peach fruit during cold storage.

■

CI index =

∑ [(browning level)(number of fruit at the browning level)]/(total number of fruit in the treatment)

Polyamine Content. Frozen samples (8.0 g) were ground in liquid nitrogen, homogenized with 20 mL of 5% (w/v) cold perchloric acid, and then centrifuged at 15000g at 4 °C for 30 min. The resulting supernatant was collected for polyamine assays by benzoyl using the method of Zhang et al.26,27 Polyamines were analyzed by highperformance liquid chromatography (HPLC, Waters 2695, Waters Corporation, Milford, MA) equipped with a 4.6 × 150 mm C18 column. The elution was 64% (v/v) methanol, and the solvent flow was 0.8 mL min−1. Detection was with a diode array at 230 nm. Results were expressed as nanomoles per gram of fresh weight (FW). GABA Content. The GABA concentration was determined by the method of Deewatthanawong et al.28 The absorbance at 645 nm was monitored using a Shimadzu UV-1750 spectrophotometer (Shimadzu Co., Ltd., Japan). The result was compared to a standard curve constructed using known amounts of GABA and expressed as micrograms of GABA per gram of FW. Proline Content. The proline content was measured by the method of Shang et al.24 The results were compared to a standard curve constructed using known amounts of proline and expressed as micrograms of proline per gram of FW. Total RNA Extraction and cDNA Synthesis. Total RNA was isolated from frozen tissues of peach samples using the Plant RNA Kit (Omega Bio-Tek, Inc., Norcross, GA) according to the instructions of the manufacturer. RNA was quantified using a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, Inc., Wilmington, DE). cDNAs were synthesized using the SuperRT First Strand cDNA Synthesis Kit (CWBIO, Beijing, China) from 2.0 μg of RNase-free DNase1 (Omega Bio-Tek, Inc., Norcross, GA), following the instructions of the manufacturer. Quantitative reverse transcription polymerase chain reaction (qRT-PCR) analyses were carried out using the SYBR Green PCR master mix (Thermo Fisher Scientific, Inc., Pittsburgh, PA), and the reactions were performed with a Mx3000P qPCR system (Agilent Stratagene, Santa Clara, CA) in triplicates using gene-specific primers (Table 1). Real-time polymerase chain reaction (PCR) data were calibrated relative to the PpTEF2 (JQ732180) expression level at zero time for each treatment, following the 2−ΔΔCt method for relative quantification. Fruit Quality. Fruit firmness was measured with a TMS-Touch Full Touch Properties Analyzer (Federal Trade Commission, U.K.). The extractable juice percentage was estimated from the weight loss from placental tissue plugs in response to low-speed centrifugation. Total soluble solid (TSS) was analyzed with a digital refractometer (GMK-701AC, G-WON, Korea). Fruit color was measured with a Chroma meter (Konica Minolta, CR-410, Japan).

MATERIALS AND METHODS

Selection of Melatonin Optimal Dose. Peach fruit (P. persica Batsch cv. Hujing) were harvested at commercial maturity from a local orchard in Fenghua, China. The peaches were selected for uniformity without any damage and randomly divided into four groups. The fruit of each group were immersed in sterile deionized water (control) or 50, 100, and 200 μM melatonin for 120 min and then dried in air at room temperature for approximately 30 min. Thereafter, all fruit were stored at 4 °C and 80% relative humidity for 28 days. Fruit samples were taken before melatonin treatment (time 0) and at 7 day intervals during storage for measurements. Each treatment was repeated 3 times, and the experiment was conducted twice. Experiments Using 100 μM Melatonin Treatment. Peaches were treated as described above at the concentration of 100 μM melatonin. All fruit were air-dried at room temperature for approximately 30 min and then transferred to 4 °C and 80% relative humidity for 28 days. Fruit samples were taken before melatonin treatment (time 0) and at 7 day intervals during storage for measurements of polyamines, such as putrescine, spermidine, and spermine, GABA, and proline and molecular analysis. CI Index. The CI index was assessed on the mesocarp surface, following a double cut parallel to the axial diameter. CI intensity was scored by visual surface browning with a scale from 0 to 3: 0, no chilling; 1, mild injury (1−25% of fruit affected); 2, moderate injury (25−50% of fruit affected); and 3, severe injury (50−100% of fruit affected). The CI index was calculated using the following formula: B


Article

Journal of Agricultural and Food Chemistry Statistical Analysis. All values are shown as the mean ± standard errors. Statistical analysis was performed using the SPSS package program, version 16.0 (SPSS, Inc., Chicago, IL). Student’s unpaired t test was used to compare the means at p < 0.05.

Fruit treated with 100 μM melatonin showed significantly higher extractable juice on days 7 and 21 compared to the control (Table 2). Melatonin treatment at 100 μM maintained significantly higher levels of TSS in peaches throughout the storage, except day 14. A higher TSS content in peaches treated with melatonin at 50 or 200 μM was only observed on day 7. No significant difference in color changes of peach fruit was found among all treatments (Table 2). Effect of Exogenous Melatonin Treatment on the Polyamine Content. Because 100 μM melatonin had the most effective result on inhibiting CI in harvested peaches, the mechanism by which melatonin treatment at 100 μM mediated chilling stress was investigated further. Changes of putrescine and spermidine contents in control peaches showed similar patterns throughout the storage, with a maximum level of these two polyamines on day 21. Melatonin-treated peaches displayed a significantly higher level of putrescine content than the control during the whole storage, except day 14 (Figure 2A). Meanwhile, significantly higher levels of spermidine and spermine were observed in fruit treated with melatonin after 7 days of storage (panels B and C of Figure 2). Effect of Exogenous Melatonin Treatment on the Expression of PpADC, PpODC, and PpPAO. Expression of PpADC and PpODC in both control and treated fruit increased during the first 7 and 14 days of storage, respectively, following a decrease during the rest of the cold storage. PpADC in treated fruit expressed significantly higher than that in non-treated fruit during the first 21 days of storage (Figure 3A); however, higher transcripts of PpODC were observed in treated peaches after 7 days of storage (Figure 3B). No significant change of PpPAO expression was found in control fruit during the whole storage, but there was an increase in melatonin-treated peaches. Melatonin treatment could upregulate this gene expression effectively throughout the storage (Figure 3C). Effect of Exogenous Melatonin Treatment on the Endogenous GABA Content and PpGAD Expression. The GABA content in control and treated peaches increased

■

RESULTS Effect of Exogenous Melatonin Treatment on CI and Quality Parameters. Peach fruit without melatonin treatment developed CI symptoms after 7 days of cold storage, which increased with storage time. The CI index was significantly reduced in peaches treated with 100 or 200 μM melatonin, with a better effect at the concentration of 100 μM. No significant difference in CI was observed between the control and 50 μM melatonin-treated fruit (Figure 1).

Figure 1. CI index of peach fruit treated with exogenous melatonin (0, 50, 100, and 200 μM) during storage at 4 °C. All data are presented as a mean of 15 biological replicates, and error bars represent ±standard errors. Asterisks (∗) indicate significant differences among melatonintreated and control samples [Student’s unpaired t test; (∗) p < 0.05, (∗∗) p < 0.01, and (∗∗∗) p < 0.001].

Fruit firmness declined rapidly during storage, corresponding to the increase of extractable juice. There was no significant difference in fruit firmness among all treatments (Table 2).

Table 2. Effect of Various Concentrations of Exogenous Melatonin on Fruit Quality of Peach Fruit during Storage at 4 °Ca color parameter storage time (day) 0 7

14

21

28

treatment control 50 μM melatonin 100 μM melatonin 200 μM melatonin control 50 μM melatonin 100 μM melatonin 200 μM melatonin control 50 μM melatonin 100 μM melatonin 200 μM melatonin control 50 μM melatonin 100 μM melatonin 200 μM melatonin

firmness (kg/cm2) 19.17 2.17 2.16 2.16 2.34 2.20 2.02 2.03 2.11 2.72 2.72 1.69 2.29 1.81 1.90 1.95 1.98

± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ±

1.57 0.10 0.25 0.11 0.45 0.25 0.07 0.09 0.18 0.33 0.11 0.24 0.20 0.04 0.50 0.28 0.19

extractable juice (%) a b b b b b b b b b b b b b b b b

41.80 50.64 63.70 63.53 51.48 65.37 69.56 71.58 60.85 66.24 81.25 84.86 85.01 66.41 69.06 69.70 69.00

± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ±

1.10 2.31 2.60 5.45 5.77 6.04 3.85 1.74 2.23 5.21 0.71 1.73 1.44 2.12 1.89 3.86 5.28

e de c c de c c bc cd c ab a a c c c c

7.86 7.46 8.66 9.4 8.96 8.99 7.59 8.31 7.69 8.57 7.81 9.57 8.47 7.12 6.61 8.08 7.75

± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ±

0.28 0.10 0.01 0.07 0.08 0.12 0.03 0.12 0.04 0.12 0.04 0.00 0.05 0.10 0.21 0.16 0.06

h0

L*

TSS (%) ef gh bc a b b fg cd fg c efg a c h i de efg

86.21 80.01 82.77 81.04 83.47 79.40 80.2 81.01 80.04 76.02 76.96 79.03 78.11 76.91 75.37 77.15 77.7

± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ±

0.07 1.00 0.42 1.12 0.38 0.99 0.36 0.74 0.89 1.50 0.83 1.37 0.36 3.28 2.04 0.82 0.57

a bcde abc bcd ab bcdef bcd bcd bcde ef def cdef def def f def def

93.02 91.41 94.74 94.02 96.59 92.09 90.91 94.46 92.14 88.41 88.45 91.35 88.80 88.68 86.49 90.38 89.08

± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ±

0.79 0.75 0.77 3.67 1.04 1.52 2.73 1.04 1.29 1.49 0.38 1.04 1.30 2.88 2.40 1.11 0.44

C* abcd abcde ab abcd a abcde abcde abc abcde de de abcde cde cde e bcde bcde

25.81 22.63 23.97 23.21 23.93 23.68 22.30 23.29 24.47 24.64 24.15 25.68 23.35 25.15 24.80 25.02 25.47

± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ±

0.52 0.63 0.74 0.21 0.88 0.73 1.11 0.62 1.29 1.08 0.84 0.81 0.90 0.10 0.40 0.47 1.08

a bc abc abc abc abc c abc abc abc abc a abc ab abc ab a

a Means in a column followed by a different letter for the same storage period differ significantly at p = 0.05 by Duncan’s multiple range tests. Data are accompanied by standard errors of the means (n = 3).

C


Article

Journal of Agricultural and Food Chemistry

Figure 2. Content of (A) putrescine, (B) spermidine, and (C) spermine of peach fruit treated with 100 μM during storage at 4 °C. All data are presented as a mean of three biological replicates, and error bars represent ±standard errors. Contents of putrescine, spermidine, and spermine are expressed as nanomoles per gram of FW. Asterisks (∗) indicate significant differences between melatonintreated and control samples [Student’s unpaired t test; (∗) p < 0.05, (∗∗) p < 0.01, and (∗∗∗) p < 0.001].

Figure 3. Expression of (A) PpADC, (B) PpODC, and (C) PpPAO genes of peach fruit treated with 100 μM during storage at 4 °C. All data are presented as a mean of three biological replicates, and error bars represent ±standard errors. Transcript abundance was determined using qRT-PCR and was normalized using PpTEF2. Asterisks (∗) indicate significant differences between melatonintreated and control samples [Student’s unpaired t test; (∗) p < 0.05, (∗∗) p < 0.01, and (∗∗∗) p < 0.001].

gradually during the whole cold storage. Melatonin-treated fruit displayed significantly higher GABA levels than control fruit after 7 days of storage (Figure 4A). No significant changes in PpGAD expression in control peaches were observed throughout the storage; however, melatonin treatment promoted PpGAD expression significantly, and a higher transcript of this gene could be found in treated peaches during the whole storage, except day 14 (Figure 4B). Effect of Exogenous Melatonin Treatment on the Proline Content and Expression of PpP5CS, PpOAT, and PpPDH. The proline content in both control and treated fruit increased during the first 14 days of storage, following a slight decrease. Melatonin-treated fruit showed significantly higher levels of proline than control peaches during the whole storage (Figure 5A). In the control fruit, expression of PpP5CS and PpOAT increased during the first 14 days of storage and then declined gradually during the remainder of the storage. In comparison to the control, significantly higher transcripts of these two genes were observed in melatonin-treated fruit during the whole storage (panels B and C of Figure 5). PpPDH expression in both control and treated fruit showed a sharp

decrease during the first 7 days of storage, and then a drastic increase was observed in control fruit. In comparison to control fruit, PpPDH expression was downregulated in melatonintreated fruit during the first 21 days of storage (Figure 5D).

■

DISCUSSION Melatonin has been reported to play important roles in plant defense, which can upregulate transcript levels of many defenserelated factors, including stress receptors, kinases, and transcription factors.29 As a healthy ingredient contained in the diet, recently, melatonin has been applied to tomato fruit after harvest for the first time, and results revealed that melatonin can induce fruit ripening events, such as lycopene accumulation, cell wall degradation, and volatile biosynthesis, by regulating ethylene biosynthesis and signaling.30 The findings expanded our understanding of melatonin roles in harvested products and provided the evidence that melatonin is involved in fruit maturation. However, up to now, little is known about its physiological functions in mediating biotic or abiotic stress in fruit and vegetables after harvest, especially chilling stress, the major problem in the refrigeration industry of tropical or D


Article


subtropical products. Therefore, in the present study, we treated peach fruit with three different concentrations of melatonin after harvest and then stored them at a chilling temperature. Our results documented that melatonin treatment at 100 and 200 μM could reduce CI of peaches without impairing fruit quality during storage with a better induction of chilling tolerance at 100 μM (Figure 1). These findings suggested that a possible protective mechanism against chilling stress might be induced by melatonin treatment, which alleviated CI of peach fruit. Polyamines have been shown to confer protection against chilling stress in many horticultural crops. It has been hypothesized that polyamines protect the integrity of membranes and, in turn, alleviate CI.31 Mirdehghan et al. reported that heat treatment induced increases in free putrescine and spermidine in pomegranate fruit during storage, which could have a role in the lower rate of fruit softening and in the diminution of CI severity.14 Wang et al. also found that nitric oxide had a benefit in reducing CI in banana fruit during harvested cold storage by induction of the polyamine content.15 Similar results were observed in methyl-salicylate-treated tomato fruit, in which the reduction of CI symptoms was also associated with upregulation of polyamines.32 In our present study, the application of melatonin treatment led to an increase in the putrescine concentration during storage compared to control fruit. The treatment also increased the spermidine content but to a lesser extent than putrescine (panels A and B of Figure 2). Taken together, results obtained in this study indicate that the increased levels of these two polyamines could be a defense mechanism against chilling stress, which was responsible for the lower CI found in melatonin-treated peaches. It has also been reported that exogenous melatonin treatment significantly induced poly-

Figure 4. (A) GABA content and (B) PpGAD expression of peach fruit treated with 100 μM during storage at 4 °C. All data are presented as a mean of three biological replicates, and error bars represent ±standard errors. Contents of GABA are expressed as micrograms per gram of FW. Transcript abundance was determined using qRT-PCR and was normalized using PpTEF2. Asterisks (∗) indicate significant differences between melatonin-treated and control samples [Student’s unpaired t test; (∗) p < 0.05, (∗∗) p < 0.01, and (∗∗∗) p < 0.001].

Figure 5. (A) Proline content and the expression of (B) PpP5CS, (C) PpOAT, and (D) PpPDH genes of peach fruit treated with 100 μM during storage at 4 °C. All data are presented as a mean of three biological replicates, and error bars represent ±standard errors. Transcript abundance was determined using qRT-PCR and was normalized using PpTEF2. Asterisks (∗) indicate significant differences between melatonin-treated and control samples [Student’s unpaired t test; (∗) p < 0.05, (∗∗) p < 0.01, and (∗∗∗) p < 0.001]. E


Article


storage, along with the reduction of CI occurrence (Figure 5A). These results indicated that melatonin treatment could increase the proline content during cold storage, and the severity of chilling symptoms was reduced consequently. In higher plants, Δ1-pyrroline-5-carboxylate synthetase (P5CS), ornithine aminotransferase (OAT), and proline dehydrogenase (PDH) are key enzymes in proline metabolism. Proline can be synthesized from glutamate via P5CS or from ornithine via OAT. The proline concentration in plants could also be regulated by degradation, which is catalyzed by PDH. Wang et al. indicated that the higher P5CS and lower PDH activities might account for the proline accumulation in nitricoxide-treated bananas.39 Similar results were observed in MeJAtreated loquat fruit, which showed that proline accumulation induced by MeJA resulted from the collaborated regulation of P5CS, OAT, and PDH activities.23 In the present study, the expression of PpP5CS and PpOAT was upregulated by melatonin treatment during cold storage, whereas PpPDH expression was inhibited (panels B−D of Figure 5). According to the above results, we can conclude that, in comparison to the control fruit, the increased proline synthesis rate but decreased degradation rate could result in the higher proline content in melatonin-treated fruit, which might play an important role in melatonin-regulated chilling tolerance in peach fruit after harvest. In summary, exogenous melatonin treatment alleviated CI without impairing fruit quality in harvested peaches during cold storage. To our knowledge, this is the first report that exogenous melatonin treatment can alleviate CI in harvested horticultural products. The elevated chilling tolerance in melatonin-treated peaches might be associated with the higher levels of polyamines and GABA as a result of the increased expression of PpADC, PpODC, and PpGAD. In addition, as a result of the increased transcripts of PpP5CS and PpOAT and inhibited PpPDH expression, a higher proline level was observed in melatonin-treated peaches, which could activate a potential positive feedback mechanism and induce chilling tolerance in treated peaches. However, further studies are still required to clarify the complex molecular networks regulated by melatonin in response to chilling stress.

amine biosynthesis, thus improving the survival rate of tobacco suspension cells during cold stress.33 In plants, putrescine is synthesized from the amino acid ornithine or arginine via decarboxylation catalyzed by ornithine decarboxylase (ODC) or arginine decarboxylase (ADC).34 Spermidine and spermine are synthesized from putrescine via the addition of aminopropyl groups by spermidine synthase and spermine synthase, respectively. ODC and ADC act as ratelimiting factors in polyamine biosynthesis and play pivotal roles in polyamine metabolism.34,35 Polyamine degradation can be catalyzed by diamine oxidase (DAO) and polyamine oxidase (PAO), both of which are also involved in GABA biosynthesis.21 In our present study, transcripts for PpADC and PpODC were upregulated in peach fruit treated with melatonin when stored at a chilling temperature (panels A and B of Figure 3). In this sense, our results suggested that melatonin increased putrescine content through inducing the key biosynthetic gene expression, thus contributing to enhance chilling tolerance in peach fruit. A similar result was also found in banana fruit treated with nitric oxide.15 With respect to polyamine degradation, PpPAO expression, a key gene that catalyzes the degradation of spermidine and spermine, was significantly higher in fruit treated with melatonin (Figure 3C), which might be associated with the lower spermine content observed in those peaches (Figure 2C). It is well-documented that GABA levels tend to accumulate rapidly in response to biotic and abiotic stresses in plants, and a higher GABA content is involved in the defense system against them.19 The main route in GABA biosynthesis is the conversion of glutamate to GABA directly by the activity of GAD, an enzyme localized in the cytosol.36 The contribution of GABA to CI alleviation has been reported in several harvested fruit. For example, in cherimoya fruit during low-temperature storage, GABA levels increased in CO2-treated fruit, which were more tolerant to chilling than untreated fruit.37 In loquat fruit treated with MeJA, the increased GABA content with a higher GAD activity was responsible for the reduction of CI.23 Recently, Shan et al. reported that glycine betaine enhanced chilling tolerance in peaches as a result of the increase of the GABA content.25 In this study, melatonin treatment significantly upregulated PpGAD expression and, thus, induced GABA accumulation in peaches (Figure 4), which could be considered as one of the adaptive mechanisms underlying melatonin-mediated chilling stress. It has been reported that GABA can be derived from polyamines indirectly via a combination of DAO and PAO. Previous studies reported that, under NaCl stress, polyamine degradation pathway supplied about 30% GABA in germinating fava bean.38 Because no DAO expression was detected in harvested peaches in this study, it is noteworthy that the higher transcripts of PpPAO might also be related to the higher GABA levels in melatonintreated peaches, which deserved to be further explored. Proline, an important amino acid, has been considered as a cellular osmotic regulator, protein stabilizer, free-radical scavenger, and lipid peroxidation inhibitor in plant.22 Plant proline has a positive role in enhancing tolerance to abiotic stresses, such as chilling. It was reported that exogenous GABA improved chilling tolerance of harvested peach fruit as a result of the increased proline content.24 The elevated level of proline found in heat-treated tomato fruit was associated with the induced chilling tolerance.27 Our results are in concordance with those reported, because a higher content of proline was observed in melatonin-treated peach fruit during the whole

■

AUTHOR INFORMATION

Corresponding Author

*Telephone: +86-574-88222229. Fax: +86-574-88222991. Email: [email protected]. Funding

This study was supported by the National Natural Science Foundation of China (31371866 and 31571905), the Natural Science Foundation of Zhejiang Province (LQ15C200004), and the Natural Science Foundation of Ningbo (2015A610262). Notes

The authors declare no competing financial interest.

■

ABBREVIATIONS USED ADC, arginine decarboxylase; CI, chilling injury; DAO, diamine oxidase; FW, fresh weight; GABA, γ-aminobutyric acid; GAD, glutamate decarboxylase; HPLC, high-performance liquid chromatography; MeJA, methyl jasmonate; OAT, ornithine aminotransferase; ODC, ornithine decarboxylase; P5CS, Δ1pyrroline-5-carboxylate synthetase; PAO, polyamine oxidase; F


Article


(20) Hare, P. D.; Cress, W. A.; Van Staden, J. Proline synthesis and degradation: A model system for elucidating stress related signal transduction. J. Exp. Bot. 1999, 50, 413−434. (21) Shelp, B. J.; Bozzo, G. G.; Trobacher, C. P.; Zarei, A.; Deyman, K. L.; Brikis, C. J. Hypothesis/review: Contribution of putrescine to 4aminobutyrate (GABA) production in response to abiotic stress. Plant Sci. 2012, 193−194, 130−135. (22) Verbruggen, N.; Hermans, C. Proline accumulation in plants: A review. Amino Acids 2008, 35, 753−759. (23) Cao, S. F.; Cai, Y. T.; Yang, Z. F.; Zheng, Y. H. MeJA induces chilling tolerance in loquat fruit by regulating proline and gammaaminobutyric acid contents. Food Chem. 2012, 133, 1466−1470. (24) Shang, H. T.; Cao, S. F.; Yang, Z. F.; Cai, Y. T.; Zheng, Y. H. Effect of exogenous γ-aminobutyric acid treatment on proline accumulation and chilling injury in peach fruit after long-term cold storage. J. Agric. Food Chem. 2011, 59, 1264−1268. (25) Shan, T. M.; Jin, P.; Zhang, Y.; Huang, Y. P.; Wang, X. L.; Zheng, Y. H. Exogenous glycine betaine treatment enhances chilling tolerance of peach fruit during cold storage. Postharvest Biol. Technol. 2016, 114, 104−110. (26) Zhang, X. H.; Shen, L.; Li, F. J.; Meng, D. M.; Sheng, J. P. Arginase induction by heat treatment contributes to amelioration of chilling injury and activation of antioxidant enzymes in tomato fruit. Postharvest Biol. Technol. 2013, 79, 1−8. (27) Zhang, X. H.; Shen, L.; Li, F. J.; Meng, D. M.; Sheng, J. P. Hot air treatment-induced arginine catabolism is associated with elevated polyamines and proline levels and alleviates chilling injury in harvested tomato fruit. J. Sci. Food Agric. 2013, 93, 3245−3251. (28) Deewatthanawong, R.; Rowell, P.; Watkins, C. B. γ-Aminobutyric acid (GABA) metabolism in CO2 treated tomatoes. Postharvest Biol. Technol. 2010, 57, 97−105. (29) Van Tassel, D. L.; Roberts, N.; Lewy, A.; O’Neill, S. D. Melatonin in plant organs. J. Pineal Res. 2001, 31, 8−15. (30) Sun, Q. Q.; Zhang, N.; Wang, J. F.; Zhang, H. J.; Li, D. B.; Shi, J.; Li, R.; Weeda, S.; Zhao, B.; Ren, S. X.; Guo, Y. D. Melatonin promotes ripening and improves quality of tomato fruit during harvested life. J. Exp. Bot. 2015, 66, 657−668. (31) Hussain, S. S.; Ali, M.; Ahmad, M.; Siddique, K. H. Polyamines: Natural and engineered abiotic and biotic stress tolerance in plants. Biotechnol. Adv. 2011, 29, 300−311. (32) Zhang, X. H.; Shen, L.; Li, F. J.; Meng, D. M.; Sheng, J. P. Methyl salicylate induced arginine catabolism is associated with upregulation of polyamine and nitric oxide levels and improves chilling tolerance in cherry tomato fruit. J. Agric. Food Chem. 2011, 59, 9351− 9357. (33) Zhang, G. Y.; Li, P.; Dai, R. R. Arginine decarboxylase activity is increased in tobacco (Nicotiana tabacum) suspension cells by exogenous melatonin during cold stress. Chinese Bull. Bot. 2005, 22, 555−559. (34) Alcázar, R.; Altabella, T.; Marco, F.; Bortolotti, C.; Reymond, M.; Koncz, C.; Carrasco, P.; Tiburcio, A. F. Polyamines: Molecules with regulatory functions in plant abiotic stress tolerance. Planta 2010, 231, 1237−1249. (35) Bagni, N.; Tassoni, A. Biosynthesis, oxidation and conjugation of aliphatic polyamines in higher plants. Amino Acids 2001, 20, 301− 317. (36) Fait, A.; Fromm, H.; Walter, D.; Galili, G.; Fernie, A. R. Highway or byway: The metabolic role of the GABA shunt in plants. Trends Plant Sci. 2008, 13, 14−19. (37) Merodio, C.; Muñoz, M. T.; Del Cura, B.; Buitrago, D.; Escribano, M. I. Effect of high CO2 level on the titres of γaminobutyric acid, total polyamines and some pathogenesis-related proteins in cherimoya fruit stored at low temperature. J. Exp. Bot. 1998, 49, 1339−1347. (38) Yang, R. Q.; Guo, Q. H.; Gu, Z. X. GABA shunt and polyamine degradation pathway on gamma-aminobutyric acid accumulation in germinating fava bean (Vicia faba L.) under hypoxia. Food Chem. 2013, 136, 152−159.

PDH, proline dehydrogenase; qRT-PCR, quantitative reverse transcription polymerase chain reaction; TSS, total soluble solid

■

REFERENCES

(1) Brummell, D. A.; Dal Cin, V.; Lurie, S.; Crisosto, C. H.; Labavitch, J. M. Cell wall metabolism during the development of chilling injury in cold-stored peach fruit: Association of mealiness with arrested disassembly of cell wall pectins. J. Exp. Bot. 2004, 55, 2041− 2052. (2) Wang, C. Y. Chilling injury of tropical horticultural commodities. HortScience 1994, 29, 986−988. (3) Lurie, S.; Crisosto, C. H. Chilling injury in peach and nectarine. Postharvest Biol. Technol. 2005, 37, 195−208. (4) Sevillano, L.; Sanchez-Ballesta, M. T.; Romojaro, F.; Flores, F. B. Physiological, hormonal and molecular mechanisms regulating chilling injury in horticultural species. Harvested technologies applied to reduce its impact. J. Sci. Food Agric. 2009, 89, 555−573. (5) Dubbels, R.; Reiter, R. J.; Klenke, E.; Goebel, A.; Schnakenberg, E.; Ehlers, C.; Schiwara, H. W.; Schloot, W. Melatonin in edible plants identified by radioimmunoassay and by high performance liquid chromatography-mass spectrometry. J. Pineal Res. 1995, 18, 28−31. (6) Arnao, M. B.; Hernández-Ruiz, J. Function of melatonin in plants: A review. J. Pineal Res. 2015, 59, 133−150. (7) Zhang, N.; Sun, Q. Q.; Zhang, H. J.; Cao, Y. Y.; Weeda, S.; Ren, S. X.; Guo, Y. D. Roles of melatonin in abiotic stress resistance in plants. J. Exp. Bot. 2015, 66, 647−656. (8) Zhang, H. M.; Zhang, Y. Melatonin: A well-documented antioxidant with conditional pro-oxidant actions. J. Pineal Res. 2014, 57, 131−146. (9) Manchester, L. C.; Coto-Montes, A.; Boga, J. A.; Andersen, L. P.; Zhou, Z.; Galano, A.; Vriend, J.; Tan, D. X.; Reiter, R. J. Melatonin: An ancient molecule that makes oxygen metabolically tolerable. J. Pineal Res. 2015, 59, 403−419. (10) Tal, O.; Haim, A.; Harel, O.; Gerchman, Y. Melatonin as an antioxidant and its semi-lunar rhythm in green macroalga Ulva sp. J. Exp. Bot. 2011, 62, 1903−1910. (11) Szafrańska, K.; Glińska, S.; Janas, K. M. Ameliorative effect of melatonin on meristematic cells of chilled and re-warmed Vigna radiata roots. Biol. Plant. 2013, 57, 91−96. (12) Lei, X. Y.; Zhu, R. Y.; Zhang, G. Y.; Dai, Y. R. Attenuation of cold-induced apoptosis by exogenous melatonin in carrot suspension cells: The possible involvement of polyamines. J. Pineal Res. 2004, 36, 126−131. (13) Gupta, K.; Dey, A.; Gupta, B. Plant polyamines in abiotic stress responses. Acta Physiol. Plant. 2013, 35, 2015−2036. (14) Mirdehghan, S. H.; Rahemi, M.; Martínez-Romero, D.; Guillén, F.; Valverde, J. M.; Zapata, P. J.; Serrano, M.; Valero, D. Reduction of pomegranate chilling injury during storage after heat treatment: Role of polyamines. Postharvest Biol. Technol. 2007, 44, 19−25. (15) Wang, Y. S.; Luo, Z. S.; Mao, L. C.; Ying, T. J. Contribution of polyamines metabolism and GABA shunt to chilling tolerance induced by nitric oxide in cold-stored banana fruit. Food Chem. 2016, 197, 333−339. (16) Zhang, W. P.; Jiang, B.; Li, W. G.; Song, H.; Yu, Y. S.; Chen, J. F. Polyamines enhance chilling tolerance of cucumber (Cucumis sativus L.) through modulating antioxidative system. Sci. Hortic. 2009, 122, 200−208. (17) Koushesh saba, M.; Arzani, K.; Barzegar, M. Harvested polyamine application alleviates chilling injury and affects apricot storage ability. J. Agric. Food Chem. 2012, 60, 8947−8953. (18) Palma, F.; Carvajal, F.; Ramos, J. M.; Jamilena, M.; Garrido, D. Effect of putrescine application on maintenance of zucchini fruit quality during cold storage: Contribution of GABA shunt and other related nitrogen metabolites. Postharvest Biol. Technol. 2015, 99, 131− 140. (19) Shelp, B. J.; Bown, A. W.; McLean, M. D. Metabolism and functions of gamma-aminobutyric acid. Trends Plant Sci. 1999, 4, 446− 452. G


Article

Journal of Agricultural and Food Chemistry (39) Wang, Y. S.; Luo, Z. S.; Du, R. X.; Liu, Y.; Ying, T. J.; Mao, L. C. Effect of nitric oxide on antioxidative response and proline metabolism in banana during cold storage. J. Agric. Food Chem. 2013, 61, 8880− 8887.

H


Exogenous Melatonin Treatment Increases Chilling Tolerance and

Recommend Documents