Exosomes Secreted by Stem Cells from Human Exfoliated Deciduous

Article Cite This: ACS Biomater. Sci. Eng. 2019, 5, 3561−3571

pubs.acs.org/journal/abseba

Exosomes Secreted by Stem Cells from Human Exfoliated Deciduous Teeth Promote Alveolar Bone Defect Repair through the Regulation of Angiogenesis and Osteogenesis Jinyan Wu,† Lingling Chen,† Runfu Wang, Zhi Song, Zongshan Shen, Yiming Zhao, Shuheng Huang,* and Zhengmei Lin*

Downloaded via BUFFALO STATE on July 20, 2019 at 06:04:52 (UTC). See https://pubs.acs.org/sharingguidelines for options on how to legitimately share published articles.

Guanghua School of Stomatology, Hospital of Stomatology, Guangdong Provincial Key Laboratory of Stomatology, Sun Yat-sen University, No. 56, Lingyuan West Road, Guangzhou 510055, China

ABSTRACT: Exosomes are important mediators of intercellular communication and have a vital part in the diagnosis and treatment of various diseases in humans. Here, we investigated the benefits and underlying mechanism of exosomes secreted via stem cells from human exfoliated deciduous teeth (SHED-derived exosomes) in promoting alveolar bone regeneration, thus providing new insights into exosome-based therapy for periodontitis. SHED-derived exosomes were isolated by ultracentrifugation. The impacts of SHED-derived exosomes on the angiogenic ability of human umbilical vein endothelial cells (HUVECs) and the osteogenic capability of rat bone marrow mesenchymal stem cells (BMSCs) were evaluated in vitro. Compound C, a pharmacological blocker of adenosine monophosphate-activated protein kinase (AMPK), was used to examine the role of the AMPK signaling cascade in these processes. Periodontal defect rat models were established and treated with PBS, β-tricalcium phosphate (β-TCP), or a grouping of exosomes/β-TCP. Microcomputed tomography (micro-CT) scanning, hematoxylin and eosin (HE) staining, Masson staining, and immunofluorescence staining were done to inspect the impacts of the exosomes/β-TCP combination on periodontal bone regeneration. Our outcomes indicated that the expression of angiogenesis-related genes (KDR, SDF-1, and FGF2), osteogenesis-related genes (COL1, RUNX2, and OPN), and phosphorylated (p)-AMPK were upregulated after treatment with exosomes, while the positive impacts of SHED-derived exosomes on HUVECs and BMSCs were partially reversed by compound C. Micro-CT analysis demonstrated that the exosomes/β-TCP group exhibited better bone regeneration than either the β-TCP group or the control group. Additionally, the results of HE and Masson staining as well as immunofluorescence staining showed neovascularization and new bone formation in the exosomes/β-TCP group but only limited new bone formation in the other two groups. Thus, SHED-derived exosomes contribute to periodontal bone regeneration by promoting neovascularization and new bone formation, possibly through the AMPK signaling pathway. KEYWORDS: exosomes, periodontal defect, angiogenesis, osteogenesis, bone regeneration

■

INTRODUCTION Alveolar bone resorption is a key clinical symptom and pathological process of periodontitis,1 which may lead to tooth loss. Existing therapies approved for periodontal defects include bone transplantation, guided bone regeneration (GBR), and artificial biomaterials combined with growth factors.2 However, these methods have certain deficiencies. For example, autologous bone is not easily formed, and the donor bone area has a potential risk of infection; the therapeutic effect of GBR is unpredictable, and the failure rate © 2019 American Chemical Society

may increase for larger bone defects; and allogeneic bone and synthetic materials may be rejected by the immune system when implanted into the human body.3 Therefore, it is still challenging to treat periodontal defects. Recently, mesenchymal stem cell (MSC)-based tissue engineering has been extensively investigated for bone repair Received: May 2, 2019 Accepted: May 25, 2019 Published: May 25, 2019 3561

DOI: 10.1021/acsbiomaterials.9b00607 ACS Biomater. Sci. Eng. 2019, 5, 3561−3571

Article

ACS Biomaterials Science & Engineering

(DMEM/F-12) (Gibco), 10% (v/v) fetal bovine serum (FBS; Gibco), 100 U/mL penicillin G, as well as 100 mg/mL streptomycin. HUVECs were bought from ALLCELLS (Shanghai, China) and expanded in endothelial cell growth medium (EGM). BMSCs were harvested from the femoral bones of SD rats. All experimental procedures received approval from the Laboratory Animal Center of Sun Yat-Sen University. All incubations were done at 37 °C with 5% CO2 plus 100% humidity. Purification and Identification of SHED-Derived Exosomes. SHEDs at passages 3 to 6 were cultured in PM containing 10% FBS. To deplete bovine exosomes, the FBS was ultracentrifuged for 12 h at 100 000g before use. The culture medium was collected, and exosomes were isolated as previously described.17 Briefly, SHEDcontaining medium was centrifuged at 300g for 10 min and 2000g for another 15 min to eliminate dead cells. The sample was centrifuged at 10 000g for 30 min to remove cell debris and condensed to a suitable volume with an ultrafiltration tube (Millipore), followed by centrifuged at 100 000g for 1 h. PBS was used to wash and resuspend the exosomes pellet for subsequent use. The exosome concentration was inspected by a BCA Protein Assay Kit (Thermo Fisher Scientific, Rockford, IL). Western blot was conducted to examine the exosome markers CD81, CD9, and tumor susceptibility gene 101 (Abcam, U.K.). The morphology of the exosomes was detected with transmission electron microscopy (TEM; Japan). Exosomes were loaded onto a copper grid. After staining with 2% (w/v) phosphotungstic acid for 5 min, the sample was examined by TEM. The particle size distribution was identified by nanoparticle tracking analysis (NTA) with a Nano sight NS300 (Malvern, Worcestershire, U.K.). Exosome Labeling and Uptake. PKH26 (Sigma) was utilized to label and trace exosomes because of its lipophilicity. According to the product instructions, 1 μL of PKH26 diluted in 250 μL of Diluent C was incubated with the isolated exosome at room temperature. Five minutes later, a 251-μL volume of FBS was used to halt the staining. The mixture was centrifuged and washed two times with DMEM-F12 by centrifuging at 100 000g for 1 h. The PKH26labeled exosomes were resuspended in 1 mL of PM or EGM and added to BMSCs or HUVECs. After 12 h of incubation, the cells were fixed using 4% paraformaldehyde for 20 min and subsequently stained by 4′,6-diamidino-2-phenylindole (DAPI). The uptake of exosomes was visualized by confocal microscopy (Zeiss, Oberkochen, Germany). Cell Proliferation and Migration. Two different concentrations of exosomes (5 μg/mL and 10 μg/mL) were used to evaluate cell proliferation with a Cell Counting Kit-8 (CCK-8; Dojindo, Japan). BMSCs (3000 cells/well) or HUVECs (5000 cells/well) were seeded onto 96-well plates and incubated for 7 days or 5 days. A 10% (v/v) CCK-8 solution was added to the cells and treated in the dark for 2 h. The optical density (OD) was subsequently measured by a microplate reader (BioTEK, U.K.). Transwell inserts with 8-μm pores (Corning) were used to detect cell migration. Concisely, 1 × 105 cells in 100 μL of medium were added into the top chamber; 500 μL of PM or EGM with or without exosomes was added to the bottom chamber and incubated for 18 h. The cells were fixed and the nonmigrated cells were gently erased using a cotton tip applicator. The migrated cells were stained using 1% crystal violet for 30 min and imaged via an inverted microscope (Zeiss, Osaka, Japan). The quantity of migrated cells in five arbitrarily chosen areas of the filter was counted and analyzed. HUVEC Angiogenic Differentiation Assay. Tube Formation Assay. The impact of SHED-derived exosomes on angiogenesis was evaluated by a tube formation assay. HUVECs were harvested, resuspended in EGM with or without exosomes, and seeded into 48well plates coated with Matrigel (Corning, NY) at a concentration of 1 × 105 cells/well. After 4−8 h of culturing duration, images of tube formation were acquired by optical microscopy. ImageJ software (NIH) was used to quantitatively analyze the total tube length and number of junctions. Quantitative Real-Time-Polymerase Chain Reaction (qRT-PCR). HUVECs were loaded into 6-well plates at a concentration of 5 ×

and regeneration. Stem cells from human exfoliated deciduous teeth (SHEDs) are a kind of immature MSC population with multiple differentiation potential and high proliferative ability; in addition, they can be easily harvested noninvasively and with few ethical concerns.4,5 Nakamura et al. confirmed that SHEDs are rich in growth factors, comprising fibroblast growth factor-2 (FGF2) as well as transforming growth factorβ2 (TGF-β2). Therefore, SHEDs have a stronger proliferative capability than bone marrow-derived mesenchymal stem cells (BMSCs).6 Furthermore, other scholars have found that SHEDs have a stronger mineralization ability than dental pulp stem cells.7 These findings suggested that SHEDs can be an ideal seed cell in bone tissue engineering. Nevertheless, MSCs transplantation has disadvantages, such as the low survival rate of locally transplanted cells, tumorigenic capacity, and immune reactions.8,9 More recently, basic research has indicated that the treatment effect of MSC-based therapies is mainly contributed to the paracrine secretion of bioactive factors; and exosomes are important paracrine mediators.10 Exosomes are lipid bilayer vesicles with 30−200 nm in diameter and could be released by various of cell types. These nanoparticles contain a broad spectrum of bioactive molecules derived from the parental cells, including proteins, microRNAs (miRNAs), mRNAs, and lipids.11 The lipid bilayer membrane of exosomes can maintain the stability, integrity, and biological potency of the contained active substances.12 As indispensable mediators in cell−cell communication, MSC-derived exosomes have been reported to have significant therapeutic effects without side effects in various disease models such as cardiovascular diseases,13 neurological diseases,14 and acute inflammation injury.15 Studies have confirmed that MSCderived exosomes promote the osteogenic differentiation of BMSCs and have a therapeutic role in the restoration of bone fractures.16 Xian et al. documented that human dental pulp cell (hDPC)-derived exosomes promoted the angiogenic differentiation of vascular endothelial cells and had potential value in pulp regeneration.17 Thus, we speculate that MSCderived exosomes can mediate osteogenesis and angiogenesis, which could be a powerful therapeutic strategy for tissue repair. However, the therapeutic effect of SHED-derived exosomes on periodontal defects is unclear. Therefore, we examined the impacts of SHED-derived exosomes on angiogenesis and osteogenesis by coculturing exosomes with human umbilical vein endothelial cells (HUVECs) as well as rat bone marrow mesenchymal stem cells (BMSCs). We further clarified the part of the adenosine monophosphate-activated protein kinase (AMPK) cascade in the SHED-derived exosome-mediated effects on HUVECs and BMSCs. In addition, we explored the therapeutic effect of βtricalcium phosphate (β-TCP) scaffolds loaded with SHEDderived exosomes on periodontal defects in Sprague−Dawley (SD) rats. Our data indicated that the combination of SHEDderived exosomes/β-TCP can promote alveolar bone regeneration by enhancing angiogenesis and osteogenesis, potentially providing new ideas for treating periodontal defects.

■

MATERIALS AND METHODS

Cell Culture. SHEDs were acquired from Guangzhou Saliai Stem Cell Science and Technology Co. Ltd. (Guangzhou, China) and cultured in proliferation medium (PM) complemented with Dulbecco’s modified Eagle’s medium, nutrient mixture F-12 3562


Article

ACS Biomaterials Science & Engineering Table 1. Primers in This Study Used for Quantitative Real-Time PCR genes

primer forward

primer reverse

KDR FGF2 VEGF-A Runx2 OPN GAPDH

TACGTTGGAGCAATCCCTGT CGAGCCGGAGACCATCTACA AGGGCAGAATCATCACGAAGT CGCCTCACAAACAACCACAG CCAGCCAAGGACCAACTACA AAGAGGGATGCTGCCCTTAC

TACACTTTCGCGATGCCAAG AGTGGCCTATGTAGTCGCGCC AGGGTCTCGATTGGATGGC TGCAGCCTTAAATGACTCGGT AGTGTTTGCTGTAATGCGCC CGGGACGAGGAAACACTCTC

of exosomes loaded in β-TCP was detected with the help of a BCA Protein Assay Kit. Briefly, the exosomes/β-TCP combination was placed in the upper chamber inserted in a 24-well plate and incubated in 100 μL of PBS at 37 °C, with 100 μL of PBS in the lower chamber. A volume of 10 μL of PBS was harvested and replaced by another 10 μL of fresh PBS at days 1, 2, 3, 4, 5, 6, 7, and 8. The amount of released exosomes was tested, and the exosome release rate was calculated. Preparation of the SD Rat Periodontal Defect Model. The animal experiments were sanctioned by the Laboratory Animal Center of Sun Yat-sen University, and all of the operations were based on the institutional animal guidelines. A total of 30 male SD rats (8 weeks old) were accommodated in a specific pathogen-free (SPF) environment. The periodontal defect model was created as previously described.18 A bone defect of approximately 4 × 2 × 1.5 mm3 was created at the buccal alveolar bone of the first to third mandibular molars. The rats were separated into three groups at random: (1) a control group with PBS treatment (control, n = 10); (2) a group treated with β-TCP scaffolds (β-TCP, n = 10); and (3) a group treated with β-TCP scaffolds loaded with exosomes (β-TCP+ exosomes, n = 10). A special kind of rehabilitation membrane (HealAll, Yantai, China) was used to cover the defect in all rats in case the implants were removed. This kind of membrane has good biological compatibility with tissues and is generally used in China as a GBR membrane to prevent connective tissue infiltration, leading to a better bone regeneration.19 At 4 weeks following the surgery, the mandibles with the defects were obtained and fixed with 4% paraformaldehyde for 48 h. Microcomputed Tomography (micro-CT) Analysis. To evaluate bone regeneration, a micro-CT scanner (SCANCO, Switzerland; 45 kVp, 177 mA, 10 μm resolution) was used to scan the mandibles with the defects. Three-dimensional (3D) pictures were created and analyzed using VGStudio MAX (Heidelberg, Germany) in accordance with the software instructions. The ratio of new bone volume to tissue volume (BV/TV) was calculated. Histological Analysis and Immunofluorescence Analysis. After micro-CT analysis, the mandibles were decalcified for 2 months in 10% disodium ethylenediaminetetraacetic acid (EDTA), dehydrated in a gradient alcohol series, and embedded in paraffin. Subsequently, the samples were cut into 4-μm thick sections and stored at 4 °C. For histological analysis, the mandible sections were stained using HE and Masson’s solution to visualize the defect healing and bone formation. Immunofluorescence staining for the angiogenesis-related protein CD31 and the osteogenesis-related protein COL1 was conducted to further observe the neovascularization and new bone formation in periodontal defect areas. Both the primary antibodies, targeting CD31 and COL1, were purchased from Abcam and diluted 1:100 as per the supplier’s protocol. Images were obtained by a confocal microscopy. Statistical Analysis. Data were presented as the mean ± standard deviation of three independently repeated experiments. Two-group comparisons were evaluated by Student’s t tests. Comparisons among three or four groups were evaluated by one-way ANOVA followed by Tukey’s post hoc test. For all analyses, P < 0.05 was reflected to specify statistical significance.

105 cells per well and cultured for 24 h. Total RNA was extracted with NucleoZol reagent (Millipore) and synthesized into complementary DNA (cDNA). PCR was conducted on a LightCycler 96 system (Roche, Sweden). The primers used to amplify the kinase insert domain receptor (KDR), FGF2, vascular endothelial growth factor (VEGF), and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) were presented in Table 1. Western Blot. Total proteins were isolated from cells. The protein sample (30 μg) was separated and transferred onto a 0.2-μm PVDF membrane (Millipore), followed by blocking with 5% (w/v) nonfat milk for 1 h. The primary antibodies including anti-KDR (Cell Signaling Technology), anti-FGF2 (Abcam), antistromal cell-derived factor 1 (SDF-1; Abcam), and anti-β-tubulin (Abcam) were then diluted in 1:1000 and incubated with the membrane at 4 °C overnight. The membrane was subsequently treated with a secondary antibody (Thermo Fisher Scientific) at room temperature for 1 h. The blots were visualized on an Image Quant LAS4000 mini instrument (GE, Japan). ImageJ software was used to analyze the densitometric of the bands. BMSC Osteogenic Differentiation Assay. Four groups were evaluated as mentioned below: (1) PM, (2) PM supplemented with SHED-derived exosomes (PM + exosomes), (3) positive control medium (OM), and (4) OM supplemented with SHED-derived exosomes (OM + exosomes). To measure alkaline phosphatase (ALP) activity, BMSCs (1 × 105 cells/well) were loaded into 24-well plates. The ALP activity was tested by an ALP kit (Jiancheng, Nanjing, China) following 7 days of osteoinduction. Alizarin red staining was conducted to assess mineralization. After 14 days of osteoinduction, cells were fixed and stained with 2% alizarin red solution (Sigma) for 5 min. Pictures were captured with a microscope (Zeiss, Osaka, Japan). To further investigate the expression of osteogenesis-related genes, PCR and Western blot were performed as previously described. The primers used in the reaction were itemized in Table 1. Primary antibodies against collagen 1 (COL1) and runt-related transcription factor 2 (RUNX2) were purchased from Abcam. All of the antibodies were diluted 1:1000 as described in the manufacturer’s protocol. AMPK Signaling Pathway Inhibition Assay. Compound C (MedchemExpress, NJ), a pharmacological inhibitor of AMPK, was used to assess the participation of the AMPK signaling pathway in the SHED-exosome-mediated effects on HUVECs. Cells were pretreated with 10 μM compound C for 1 h before the treatment of exosomes. The angiogenic differentiation of HUVECs was valued by a tube formation assay and Western blot analysis. For BMSCs, the cells were cocultured with 1 μM compound C for 14 days. Alizarin red staining as well as Western blot were done as described above to evaluate the osteogenic differentiation of BMSCs. The primary antibody including anti-AMPK (Cell Signaling Technology), antiphosphorylated (p)-AMPK (Cell Signaling Technology), and osteopontin (OPN) were diluted to 1:1000. Animal Experiment Design. SHED-derived exosome immobilization and release profile. Scaffolds with diameters of less than 1 mm, constructed from particles of the porous biomaterial β-TCP (Biolu Biomaterials Co., Ltd., Shanghai), were used as exosome carriers in our study. In total, 100 μg of exosomes combined with 5 mg of β-TCP were used for each defect. For the immobilization of exosomes, 2 μg/μL exosomes diluted in PBS (100 μL) were incubated with 10 mg of β-TCP at 4 °C overnight to enable complete loading of the scaffolds with exosomes. The release profile 3563


Article


Figure 1. Characterization of SHED-derived exosomes. (A) Western blot analysis of exosomal markers (CD9, CD81, and tumor susceptibility 101) and a cytosolic marker (β-actin). (B) TEM observation of SHED-derived exosome morphology. Scale bar: 200 nm. (C) Particle size distribution and concentration of SHED-derived exosomes detected by Nanosight analysis.

■

RESULTS Identification of SHED-Derived Exosomes. Western blotting analysis (Figure 1A) demonstrated that SHEDderived exosomes expressed CD9, CD81, and tumor susceptibility 101. TEM analysis revealed that SHED-derived exosomes exhibited a cup-shaped morphology and had a bilayer membrane structure (Figure 1B). NTA analysis (Figure 1C) showed that the diameters of these nanoparticles ranged mainly from 50 to 200 nm and that the nanoparticles were associated with two peaks, at 101 and 144 nm. Thus, these results indicated that SHED-derived exosomes were successfully isolated. SHED-Derived Exosomes Promote the Proliferation and Migration of HUVECs. To investigate whether SHEDderived exosomes can be internalized into target cells, exosomes labeled with PKH26 were incubated with HUVECs for 12 h. Fluorescence microscopy analysis revealed that PKH26-labeled exosomes (red) were internalized by HUVECs (Figure 2A) and were located mainly in the cytoplasm. HUVECs were treated with two separate dosages of exosomes (5 μg/mL and 10 μg/mL) and cultured for 5 days. The cells in the 10 μg/mL exosome group proliferated faster compared with the 5 μg/mL exosome group, as presented in Figure 2B. Thus, 10 μg/mL was chosen as the optimal exosome concentration for succeeding experimentations. To assess cell migration, 10 μg/mL exosomes was added to HUVECs. Following incubation for 18 h, the quantity of migrated cells in the exosome-treated group was much greater compared with the control group (Figure 2C,D). SHED-Derived Exosomes Promote the Angiogenic Differentiation of HUVECs. To further investigate the effect of SHED-derived exosomes on HUVEC angiogenesis, a tube formation assay was performed (Figure 2E). Compared with the control group, the total tube length increased nearly 1.5fold (Figure 2F), and the number of junctions increased approximately 2-fold (Figure 2G) in the exosomes group. As shown in Figure 2H, the mRNA expression of KDR, FGF2, and VEGF-A was distinctively upregulated by SHED-derived exosomes. The protein expression of KDR, FGF2, and SDF-1 was also enhanced in the exosome-treated group (Figure 2I,J). SHED-Derived Exosomes Promote the Proliferation and Migration of BMSCs. SHED-derived exosomes labeled with PKH26 were incubated with BMSCs for 12 h. Fluorescence microscopy analysis revealed that PKH26-

labeled exosomes (red) were internalized into BMSCs (Figure 3A) and were located mainly in the cytoplasm. BMSCs were treated with two separate dosages of exosomes (5 μg/mL and 10 μg/mL) and cultured for 7 days. Cell proliferation in the two exosome-treated groups was suggestively enhanced compared with the control group. Specifically, from the fifth day to the seventh day, the OD value in the 10 μg/mL exosome group was greater compared with the 5 μg/mL exosome group (Figure 3B). Therefore, BMSCs were treated with 10 μg/mL exosomes in succeeding experiments. To assess cell migration, BMSCs were cocultured with 10 μg/mL exosomes. Following the incubation for 18 h, the quantity of migrated cells in the exosome-treated group was much greater compared with the control group, as shown in Figure 3C,D. SHED-Derived Exosomes Promote the Osteogenic Differentiation of BMSCs. To evaluate whether SHEDderived exosomes can promote BMSCs osteogenesis, BMSCs were cultured in the presence or absence of 10 μg/mL exosomes. Following 7 days of stimulation, ALP activity in BMSCs was assessed. When exosomes were added to PM or OM, ALP activity in BMSCs was markedly increased (Figure 3E). Alizarin red staining on day 14 indicated that the mineralization ability of BMSCs was enhanced by exosomes (Figure 3F). As shown in Figure 3G, the mRNA levels of RUNX2 and OPN were suggestively augmented in PM as well as OM supplemented with 10 μg/mL exosomes. Furthermore, the protein expressions of COL1 as well as RUNX2 were enhanced by exosomes (Figure 3H,I). Therefore, we established that SHED-derived exosomes can significantly encourage the osteogenic differentiation of BMSCs. Inhibition of the AMPK Signaling Pathway Alleviates SHED-Derived Exosome-Mediated Angiogenesis and Osteogenesis. AMPK signaling is involved in angiogenesis and osteogenesis.20,21 To confirm whether AMPK signaling is activated by SHED-derived exosomes, HUVECs and BMSCs were treated with SHED-derived exosomes. As shown in Figure 4A,F, AMPK phosphorylation was increased in both HUVECs and BMSCs after stimulation with exosomes. Then, compound C was added to cells to further validate the participation of the AMPK signaling cascade in the SHEDderived exosome-mediated effects on HUVECs and BMSCs. Compound C treatment downregulated the impacts of SHEDderived exosome on KDR and SDF-1 expression (Figure 3564


Article


Figure 2. Effects of SHED-derived exosomes on HUVECs. (A) Confocal fluorescence analysis showed that SHED-derived exosomes were taken up by HUVECs. Exosomes were labeled with PKH-26 (red), and DAPI was used to stain the cell nuclei (blue). Scale bar: 100 μm. (B) Growth curves measured using a CCK-8 kit. SHED-derived exosomes promoted the proliferation of HUVECs. *p < 0.05 compared with the control group, #p < 0.05 compared with the 5 μg/mL exosomes group. (C, D) SHED-derived exosomes had a positive effect on the migration capacity of HUVECs. Scale bar: 200 μm. (E) A tube formation assay was conducted after cells were incubated with SHED-derived exosomes. Scale bar: 200 μm. (F) Relative total tube lengths. (G) Relative numbers of junctions. (H) Expression of angiogenic genes (KDR, FGF2, and VEGF-A) was increased in groups treated with exosomes, as analyzed by qRT-PCR. (I, J) Expression of angiogenesis-related proteins (KDR, FGF2, and SDF-1) was increased after treatment with 10 μg/mL exosomes. *P < 0.05. **P < 0.01.

4A,B). In addition, the proangiogenic effects of SHED-derived exosomes on HUVECs were reduced after compound C treatment (Figure 4C−E). In terms of BMSC osteogenesis, compound C treatment decreased SHED-derived exosome-

stimulated OPN and RUNX2 expression (Figure 4F,G). The outcomes of alizarin red staining (Figure 4H) indicated that the enhanced mineralization capacity of BMSCs was reduced by compound C. These outcomes indicated that the AMPK 3565


Article


Figure 3. Effects of SHED-derived exosomes on BMSCs. (A) Confocal fluorescence analysis showed that SHED-derived exosomes were taken up by BMSCs. Exosomes were labeled with PKH-26 (red), and DAPI was used to stain the cell nuclei (blue). Scale bar: 100 μm. (B) SHED-derived exosomes promoted the proliferation of BMSCs, as measured by a CCK-8 assay. *p < 0.05 compared with the control group, #p < 0.05 compared with the 5 μg/mL exosomes group. (C, D) SHED-derived exosomes enhanced the migration of BMSCs in a Transwell assay in PM. Scale bar: 200 μm. (E) Quantitative analysis of ALP activity was used to evaluate the effect of SHED-derived exosomes on the osteogenic differentiation of BMSCs. (F) Alizarin red staining. Scale bar: 200 μm. (G) The expression of osteogenic genes (RUNX2 and OPN) was increased in the groups treated with exosomes. (H, I) The expression of osteogenesis-related proteins (COL1 and RUNX2) was increased after treatment with SHEDderived exosomes. *P < 0.05. **P < 0.01.

of SHED-derived exosomes in vivo, the porous biomaterial βTCP was used as a scaffold to carry exosomes. The release profile showed SHED-derived exosomes exhibited a burst release from β-TCP, and the release rate decreased gradually

signaling pathway is involved in SHED-derived exosomemediated angiogenesis and osteogenesis. SHED-Derived Exosomes Promote Alveolar Bone Defect Repair in Vivo. To investigate the therapeutic effect 3566


Article


Figure 4. Inhibition of the AMPK signaling pathway alleviates SHED-derived exosome-mediated angiogenesis and osteogenesis. (A, B) p-AMPK activity and KDR and SDF-1 expression after treatment with the AMPK inhibitor compound C in SHED-derived exosome-stimulated HUVECs. (C−E) Effects of compound C treatment on SHED-derived exosome-stimulated tube formation. (F, G) p-AMPK activity and OPN and RunX2 expression after treatment with the AMPK inhibitor compound C in SHED-derived exosome-stimulated HUVECs. (H) Alizarin red staining. Scale bar: 200 μm. *P < 0.05. **P < 0.01.

as the incubation time increased (Figure 5A). A total of 30 SD rats with periodontal defects were separated into three groups (control, β-TCP, and β-TCP + exosomes; n = 10/group). The

3D as well as two-dimensional (2D) micro-CT images of the defects are shown in Figure 5B. Four weeks later, the mandibles with defects were harvested and scanned using 3567


Article


Figure 5. SHED-derived exosomes can be released from β-TCP and promote periodontal defect repair in SD rats. (A) SHED-derived exosomes release profile. (B) 3D and 2D micro-CT images of periodontal bone defect. (C) 3D micro-CT images of the control, β-TCP, and β-TCP + exosomes groups; 2D cross-sectional images; and 2D vertical section images. (D) Graph of bone volume/total volume. (E) HE staining and Masson staining, the collagen was stained blue. Scale bar: 200 μm. (F) Immunofluorescence staining for CD31 and COL1. The periodontal defect area was marked with a black or white dotted line. AB, host alveolar bone; M, rehabilitation membrane; R, root. *P < 0.05. **P < 0.01.

sections were sliced at the distal roots of the first molars, and the defect areas are noted with a white line. The density of βTCP is higher than that of the alveolar bone. As expected, defects implanted with the combination of exosomes/β-TCP

micro-CT to evaluate bone regeneration. In Figure 5C, the area enclosed in the white box in the 3D image for each group represents the bone defect area. In the 2D images, cross sections were sliced in the middle of the roots, vertical 3568


Article

ACS Biomaterials Science & Engineering healed better than defects implanted with only β-TCP. Healing defects were filled with much greater quantities of new bone in the exosome/β-TCP-treated group compared with the remaining two groups. Specifically, almost no new bone could be seen in the control group. In accordance with the 3D reconstruction analysis, the BV/TV ratio in the exosomes/β-TCP group was 0.943, which was superior compared with the β-TCP (0.768) or the control group (0.659) (Figure 5D). HE staining showed greater bone regeneration in the exosomes/β-TCP group but limited new bone formation in the β-TCP group and even less in the control group. Masson staining showed more collagen deposition in the defective parts of the exosomes-treated group. In addition, the expression of the osteogenesis-related protein COL1 was upregulated obviously in the defect area of the exosomes/β-TCP group, followed by the pure β-TCP group and then the control group. The expression of the angiogenesis-related protein CD31 exhibited a changing trend similar to that of COL1. The results are consistent with HE and Masson staining as presented in Figure 5E.

through clathrin and lipid raft-mediated endocytosis, macropinocytosis, and phagocytosis.32 Accumulating studies have proven that MSC-derived exosomes provide substantial therapeutic effects in the repair of different tissues.33−35 Thus, we speculated that SHED-derived exosomes could be a therapy for alveolar bone defects. We conducted in vitro experiments to prove that SHEDderived exosomes can augment the proliferation, migration, as well as tube formation of HUVECs. Additionally, the expression of angiogenic-related genes (VEGF-A, KDR, FGF2, and SDF-1) was upregulated. Endogenous BMSCs could be activated and mobilized due to damage and act as the major healing class of cells in bone repair.36 In the present study, SHED-derived exosomes were confirmed to stimulate the proliferation and migration of BMSCs and to markedly enhance the osteogenic differentiation of BMSCs. These findings illustrated that SHED-derived exosomes have an important impact on both HUVECs and BMSCs and that they can enhance the angiogenesis of HUVECs as well as the osteogenesis of BMSCs, which may contribute to the repair of alveolar bone defects. It is reported that MSC-derived exosomes contain multiple bioactive molecules involved in angiogenesis, including proteins like epidermal growth factor, platelet derived growth factor, FGF,37 as well as miRNAs like miR-494,38 miR-294,39 and miR-126.40 These molecules can up-regulate the expression of angiogenesis-related genes in target cells. In addition, MSC-derived exosomes load positive regulators including miR-196a,41 miR-21, and miR-10b,42 which can enhance the expression of osteogenesis-related genes in target cells. In this study, SHED-derived exosomes enhanced the angiogenesis of HUVECs and oesteogenic differentiation of BMSCs. However, the exact exosomal cargos that have a positive effect on angiogenesis and osteogenesis should be investigated in future studies. We further investigated the molecular mechanisms of SHED-derived exosomes on the angiogenesis of HUVECs and the osteogenesis of BMSCs. AMPK is a crucial sensor of cellular energy and nutrient status.43 Substantial crosstalk exists between the AMPK signaling pathway and other regulatory pathways that induce the tube formation of endothelial progenitor cells as well as the osteoblastic differentiation of BMSCs.20,21 Researchers found that βCaSiO3/poly-D,L-lactide glycolide scaffolds facilitated BMSC osteogenic discrepancy through the AMPK/Erk1/2 signaling pathway.44 The stimulation of AMPK and eNOS could improve the expression of angiogenesis-related genes in endothelial progenitor cells.45 Thus, we investigated the hypothesis that SHED-derived exosomes can promote the angiogenesis of HUVECs and the osteogenesis of BMSCs via the AMPK signaling pathway. In this study, the expression of p-AMPK was up-regulated during angiogenic and osteoblastic induction, especially in cells treated with SHED-derived exosomes. Under treatment with the inhibitor compound C, the capacity of exosomes to enhance HUVECs tube formation and the mineralization of BMSCs was decreased. Moreover, the expression of p-AMPK, angiogenesis-related genes (KDR and SDF-1) and osteogenesis-related genes (RUNX2 and OPN) was downregulated after treatment with compound C. Our data showed that compound C could partly reverse the positive effects of SHED-derived exosomes on HUVECs and BMSCs, which suggested that other pathways cooperated with the AMPK signaling pathway and were involved in the regulation of neovascularization and new bone formation.

■

DISCUSSION Bone regeneration is a complex process involving bone remodeling, in which the osteogenic differentiation of osteoblasts or preosteoblasts is crucial for new bone formation. Moreover, angiogenesis is closely related to complicated bone repair and regeneration because it brings nutrients and oxygen to a highly metabolically active area.22−24 Thus, vascularized bone regeneration is highly important for the restoration of alveolar bone defects. In the present study, SHED-derived exosomes significantly promoted HUVECs angiogenesis and BMSCs osteogenic differentiation by stimulating the AMPK signaling cascade. Compared with the scaffold constructed from β-TCP alone, the scaffold combining SHED-derived exosomes with β-TCP enhanced bone repair in periodontal defect rat models. MSCs have been extensively used in tissue engineering as well as regenerative medicine. It has been documented that tissue-specific MSCs are superior to MSCs from other sources for repairing specific tissue lesions.25 SHEDs are a kind of MSCs with multiple differentiation potential and high selfrenewal ability; moreover, they are easy to obtain.26 In 2016, Kim et al. confirmed that SHEDs can recruit host vascular endothelial cells to mediate the formation of functional vascular-like tissues.27 Previous work by our team has proved that SHEDs exhibited good therapeutic effects in a rat periodontitis model,28 revealing the potential prospects of applying SHEDs in tissue repair. However, the application of MSCs still has potential risks, including tumorigenesis and immune reactions.8,9 Previously published studies have revealed that the efficacy of SHED-based therapies may be due to paracrine secretion.27,28 Exosomes are important paracrine mediators. MSC-derived exosomes contained bioactive molecules including proteins, lipids, signaling molecules, miRNAs, and mRNAs. They can act as nanocarriers to transfer bioactive molecules from parent cells to recipient cells and modulate the functions of recipient cells.12 Moreover, these exosomes do not induce overt immune reactions in nonimmunocompatible animals because they do not comprise MHC class I or II molecules.29−31 MSC-derived exosomes may release their cargo to target cells by signaling communication via ligand/receptor molecules on the surfaces or by fusion of exosomes with cell membrane 3569


Article

ACS Biomaterials Science & Engineering Author Contributions

Additional studies are required to determine the fundamental mechanisms. To further evaluate the function of SHED-derived exosomes in periodontal defect models, β-TCP was selected as the scaffold material to carry exosomes into the defect areas. Micro-CT analysis indicated that alveolar bone regeneration in the exosomes/β-TCP group as well as β-TCP group was superior compared with the control group; specifically, the exosomes/β-TCP group exhibited the best therapeutic effect. In addition, HE staining, Masson staining, and immunofluorescence staining for COL1 and CD31 indicated that more new bone and new blood vessels were generated after treatment with SHED-derived exosomes. β-TCP has been extensively used in research on bone tissue repair; however, the therapeutic impact of pure β-TCP is inadequate because of its lack of osteoinductive activity.46 In our study, SHEDderived exosomes with good proangiogenic capacity and osteoinductive ability were united with β-TCP scaffolds to compensate for the shortage of pure materials. Meanwhile, βTCP scaffolds acted as the carriers of exosome. The release profile assay showed that SHED-derived exosomes could be released from β-TCP. Zhang et al. found that exosomes from β-TCP recruited native stem cells to the bone defect area by the chemotactic effect and promoted bone healing.29 In this study, SHED-derived exosomes stimulated the migration and differentiation of HUVECs as well as BMSCs after internalization by these cells. In addition, high manifestation of CD31 and COL1 was identified in the defect areas of the exosomestreated group. This finding indicated that SHED-derived exosomes released from β-TCP may promote the endogenous cells, including migration of BMSCs and endothelial cells to the defect area, facilitating angiogenesis and alveolar bone regeneration. Our data suggested that scaffolds combining SHED-derived exosomes with β-TCP could be considered as potential grafts for alveolar bone defect reparation. However, our study had some limitations. For example, periodontal defects caused by periodontitis involve inflammation-mediated bone absorption47 and are more complex than the defect that we established in rats. To better observe the therapeutic effect of SHED-derived exosomes in periodontitis-induced alveolar bone defects, the immunoregulatory role of exosomes should be further explored in large animal periodontitis models.

†

J.W. and L.C. contributed equally to the work.

Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS This work was supported by grants from the National Science Foundation of China (Grant Nos. 81670984, 81873713, and 81700959) and the China Postdoctoral Science Foundation Funded Project (Project No. 2018 M633252).

■

(1) Petersen, P. E.; Ogawa, H. The global burden of periodontal disease: towards integration with chronic disease prevention and control. Periodontol 2000 2012, 60 (1), 15−39. (2) Sheikh, Z.; Hamdan, N.; Ikeda, Y.; Grynpas, M.; Ganss, B.; Glogauer, M. Natural graft tissues and synthetic biomaterials for periodontal and alveolar bone reconstructive applications: a review. Biomater Res. 2017, 21, 9. (3) Iwata, T.; Yamato, M.; Ishikawa, I.; Ando, T.; Okano, T. Tissue engineering in periodontal tissue. Anat. Rec. 2014, 297 (1), 16−25. (4) Martinez Saez, D.; Sasaki, R. T.; Neves, A. D.; da Silva, M. C. Stem Cells from Human Exfoliated Deciduous Teeth: A Growing Literature. Cells Tissues Organs 2016, 202 (5−6), 269−280. (5) Kashyap, R. SHED-Basic Structure for Stem Cell Research. J. Clin Diagn Res. 2015, 9 (3), ZE07−9. (6) Nakamura, S.; Yamada, Y.; Katagiri, W.; Sugito, T.; Ito, K.; Ueda, M. Stem cell proliferation pathways comparison between human exfoliated deciduous teeth and dental pulp stem cells by gene expression profile from promising dental pulp. J. Endod. 2009, 35 (11), 1536−42. (7) Wang, L.; Zhao, Y.; Shi, S. Interplay between mesenchymal stem cells and lymphocytes: implications for immunotherapy and tissue regeneration. J. Dent. Res. 2012, 91 (11), 1003−10. (8) Qin, Y.; Sun, R.; Wu, C.; Wang, L.; Zhang, C. Exosome: A Novel Approach to Stimulate Bone Regeneration through Regulation of Osteogenesis and Angiogenesis. Int. J. Mol. Sci. 2016, 17 (5), 712. (9) Li, W.; Liu, Y.; Zhang, P.; Tang, Y.; Zhou, M.; Jiang, W.; Zhang, X.; Wu, G.; Zhou, Y. Tissue-Engineered Bone Immobilized with Human Adipose Stem Cells-Derived Exosomes Promotes Bone Regeneration. ACS Appl. Mater. Interfaces 2018, 10 (6), 5240−5254. (10) Zhu, Y.; Wang, Y.; Zhao, B.; Niu, X.; Hu, B.; Li, Q.; Zhang, J.; Ding, J.; Chen, Y.; Wang, Y. Comparison of exosomes secreted by induced pluripotent stem cell-derived mesenchymal stem cells and synovial membrane-derived mesenchymal stem cells for the treatment of osteoarthritis. Stem Cell Res. Ther. 2017, 8 (1), 64. (11) Phinney, D. G.; Pittenger, M. F. Concise Review: MSCDerived Exosomes for Cell-Free Therapy. Stem Cells 2017, 35 (4), 851−858. (12) Deng, H.; Sun, C.; Sun, Y.; Li, H.; Yang, L.; Wu, D.; Gao, Q.; Jiang, X. Lipid, Protein, and MicroRNA Composition Within Mesenchymal Stem Cell-Derived Exosomes. Cell. Reprogramming 2018, 20 (3), 178−186. (13) Yamaguchi, S.; Shibata, R.; Yamamoto, N.; Nishikawa, M.; Hibi, H.; Tanigawa, T.; Ueda, M.; Murohara, T.; Yamamoto, A. Dental pulp-derived stem cell conditioned medium reduces cardiac injury following ischemia-reperfusion. Sci. Rep. 2015, 5, 16295. (14) Jarmalavičiu̅tė, A.; Tunaitis, V.; Pivoraitė, U.; Venalis, A.; Pivoriu̅nas, A. Exosomes from dental pulp stem cells rescue human dopaminergic neurons from 6-hydroxy-dopamine-induced apoptosis. Cytotherapy 2015, 17 (7), 932−9. (15) Pivoraitė, U.; Jarmalavičiu̅tė, A.; Tunaitis, V.; Ramanauskaitė, G.; Vaitkuvienė, A.; Kašeṫ a, V.; Biziulevičienė, G.; Venalis, A.; Pivoriu̅nas, A. Exosomes from Human Dental Pulp Stem Cells Suppress Carrageenan-Induced Acute Inflammation in Mice. Inflammation 2015, 38 (5), 1933−1941.

■

CONCLUSIONS We investigated whether SHED-derived exosomes can enhance osteogenesis and angiogenesis through the AMPK signaling pathway. We further assessed the therapeutic effect of SHED-derived exosomes in SD periodontal defects. Our data showed that the combination of SHED-derived exosomes/β-TCP contributed to alveolar bone regeneration by enhancing angiogenesis and osteogenesis. Thus, this kind of scaffold may serve as a clinical therapy for periodontal defects.

■

REFERENCES

AUTHOR INFORMATION

Corresponding Authors

*E-mail: [email protected]. Phone: +86-20-83801989. Fax: +86-20-83822807. *E-mail:[email protected]. ORCID

Jinyan Wu: 0000-0001-7346-8542 Zhengmei Lin: 0000-0003-1586-3741 3570


Article

ACS Biomaterials Science & Engineering (16) Hao, Z. C.; Lu, J.; Wang, S. Z.; Wu, H.; Zhang, Y. T.; Xu, S. G. Stem cell-derived exosomes: A promising strategy for fracture healing. Cell Proliferation 2017, 50 (5), e12359. (17) Xian, X.; Gong, Q.; Li, C.; Guo, B.; Jiang, H. Exosomes with Highly Angiogenic Potential for Possible Use in Pulp Regeneration. J. Endod. 2018, 44 (5), 751−758. (18) Han, J.; Menicanin, D.; Marino, V.; Ge, S.; Mrozik, K.; Gronthos, S.; Bartold, P. M. Assessment of the regenerative potential of allogeneic periodontal ligament stem cells in a rodent periodontal defect model. J. Periodontal Res. 2014, 49 (3), 333−45. (19) Guo, Y.; Liu, W.; Ma, S.; Wang, J.; Zou, J.; Liu, Z.; Zhao, J.; Zhou, Y. A preliminary study for novel use of two Mg alloys (WE43 and Mg3Gd). J. Mater. Sci.: Mater. Med. 2016, 27 (5), 82. (20) Chen, H.; Liu, X.; Chen, H.; Cao, J.; Zhang, L.; Hu, X.; Wang, J. Role of SIRT1 and AMPK in mesenchymal stem cells differentiation. Ageing Res. Rev. 2014, 13, 55−64. (21) Qu, J.; Lu, D.; Guo, H.; Miao, W.; Wu, G.; Zhou, M. MicroRNA-9 regulates osteoblast differentiation and angiogenesis via the AMPK signaling pathway. Mol. Cell. Biochem. 2016, 411 (1−2), 23−33. (22) Hu, K.; Olsen, B. R. The roles of vascular endothelial growth factor in bone repair and regeneration. Bone 2016, 91, 30−8. (23) Malhotra, A.; Habibovic, P. Calcium Phosphates and Angiogenesis: Implications and Advances for Bone Regeneration. Trends Biotechnol. 2016, 34 (12), 983−992. (24) Stegen, S.; van Gastel, N.; Carmeliet, G. Bringing new life to damaged bone: the importance of angiogenesis in bone repair and regeneration. Bone 2015, 70, 19−27. (25) Pittenger, M. F.; Mackay, A. M.; Beck, S. C.; et al. Multilineage potential of adult human mesenchymal stem cells[J]. Science 1999, 284 (5411), 143−147. (26) Brar, G. S.; Toor, R. S. Dental stem cells: dentinogenic, osteogenic, and neurogenic differentiation and its clinical cell based therapies. Indian J. Dent Res. 2012, 23 (3), 393−7. (27) Kim, J. H.; Kim, G. H.; Kim, J. W.; Pyeon, H. J.; Lee, J. C.; Lee, G.; Nam, H. In Vivo Angiogenic Capacity of Stem Cells from Human Exfoliated Deciduous Teeth with Human Umbilical Vein Endothelial Cells. Mol. Cells 2016, 39 (11), 790−796. (28) Gao, X.; Shen, Z.; Guan, M.; Huang, Q.; Chen, L.; Qin, W.; Ge, X.; Chen, H.; Xiao, Y.; Lin, Z. Immunomodulatory Role of Stem Cells from Human Exfoliated Deciduous Teeth on Periodontal Regeneration. Tissue Eng., Part A 2018, 24 (17−18), 1341−1353. (29) Zhang, J.; Liu, X.; Li, H.; Chen, C.; Hu, B.; Niu, X.; Li, Q.; Zhao, B.; Xie, Z.; Wang, Y. Exosomes/tricalcium phosphate combination scaffolds can enhance bone regeneration by activating the PI3K/Akt signaling pathway. Stem Cell Res. Ther. 2016, 7 (1), 136. (30) Lai, R. C.; Yeo, R. W.; Tan, K. H.; Lim, S. K. Mesenchymal stem cell exosome ameliorates reperfusion injury through proteomic complementation. Regener. Med. 2013, 8 (2), 197−209. (31) Lai, R. C.; Arslan, F.; Lee, M. M.; Sze, N. S.; Choo, A.; Chen, T. S.; Salto-Tellez, M.; Timmers, L.; Lee, C. N.; El Oakley, R. M.; Pasterkamp, G.; de Kleijn, D. P.; Lim, S. K. Exosome secreted by MSC reduces myocardial ischemia/reperfusion injury. Stem Cell Res. 2010, 4 (3), 214−22. (32) Xu, R.; Greening, D. W.; Zhu, H. J.; Takahashi, N.; Simpson, R. J. Extracellular vesicle isolation and characterization: toward clinical application. J. Clin. Invest. 2016, 126 (4), 1152−62. (33) Tao, S. C.; Yuan, T.; Zhang, Y. L.; Yin, W. J.; Guo, S. C.; Zhang, C. Q. Exosomes derived from miR-140−5p-overexpressing human synovial mesenchymal stem cells enhance cartilage tissue regeneration and prevent osteoarthritis of the knee in a rat model. Theranostics 2017, 7 (1), 180−195. (34) Huang, C. C.; Narayanan, R.; Alapati, S.; Ravindran, S. Exosomes as biomimetic tools for stem cell differentiation: Applications in dental pulp tissue regeneration. Biomaterials 2016, 111, 103−115. (35) Li, Y.; Yang, Y. Y.; Ren, J. L.; Xu, F.; Chen, F. M.; Li, A. Exosomes secreted by stem cells from human exfoliated deciduous

teeth contribute to functional recovery after traumatic brain injury by shifting microglia M1/M2 polarization in rats. Stem Cell Res. Ther. 2017, 8 (1), 198. (36) Deschaseaux, F.; Sensébé, L.; Heymann, D. Mechanisms of bone repair and regeneration. Trends Mol. Med. 2009, 15 (9), 417− 29. (37) Anderson, J. D.; Johansson, H. J.; Graham, C. S.; Vesterlund, M.; Pham, M. T.; Bramlett, C. S.; Montgomery, E. N.; Mellema, M. S.; Bardini, R. L.; Contreras, Z.; Hoon, M.; Bauer, G.; Fink, K. D.; Fury, B.; Hendrix, K. J.; Chedin, F.; El-Andaloussi, S.; Hwang, B.; Mulligan, M. S.; Lehtiö, J.; Nolta, J. A. Comprehensive Proteomic Analysis of Mesenchymal Stem Cell Exosomes Reveals Modulation of Angiogenesis via Nuclear Factor-KappaB Signaling. Stem Cells 2016, 34 (3), 601−13. (38) Nakamura, Y.; Miyaki, S.; Ishitobi, H.; Matsuyama, S.; Nakasa, T.; Kamei, N.; Akimoto, T.; Higashi, Y.; Ochi, M. Mesenchymalstem-cell-derived exosomes accelerate skeletal muscle regeneration. FEBS Lett. 2015, 589 (11), 1257−65. (39) Khan, M.; Nickoloff, E.; Abramova, T.; Johnson, J.; Verma, S. K.; Krishnamurthy, P.; Mackie, A. R.; Vaughan, E.; Garikipati, V. N.; Benedict, C.; Ramirez, V.; Lambers, E.; Ito, A.; Gao, E.; Misener, S.; Luongo, T.; Elrod, J.; Qin, G.; Houser, S. R.; Koch, W. J.; Kishore, R. Embryonic stem cell-derived exosomes promote endogenous repair mechanisms and enhance cardiac function following myocardial infarction. Circ. Res. 2015, 117 (1), 52−64. (40) Du, W.; Zhang, K.; Zhang, S.; Wang, R.; Nie, Y.; Tao, H.; Han, Z.; Liang, L.; Wang, D.; Liu, J.; Liu, N.; Han, Z.; Kong, D.; Zhao, Q.; Li, Z. Enhanced proangiogenic potential of mesenchymal stem cell-derived exosomes stimulated by a nitric oxide releasing polymer. Biomaterials 2017, 133, 70−81. (41) Qin, Y.; Wang, L.; Gao, Z.; Chen, G.; Zhang, C. Bone marrow stromal/stem cell-derived extracellular vesicles regulate osteoblast activity and differentiation in vitro and promote bone regeneration in vivo. Sci. Rep. 2016, 6, 21961. (42) Wang, X.; Omar, O.; Vazirisani, F.; Thomsen, P.; Ekström, K. Mesenchymal stem cell-derived exosomes have altered microRNA profiles and induce osteogenic differentiation depending on the stage of differentiation. PLoS One 2018, 13 (2), e0193059. (43) Hardie, D. G. AMPK–sensing energy while talking to other signaling pathways. Cell Metab. 2014, 20 (6), 939−52. (44) Wang, C.; Lin, K.; Chang, J.; Sun, J. Osteogenesis and angiogenesis induced by porous β-CaSiO(3)/PDLGA composite scaffold via activation of AMPK/ERK1/2 and PI3K/Akt pathways. Biomaterials 2013, 34 (1), 64−77. (45) Yu, J. W.; Deng, Y. P.; Han, X.; Ren, G. F.; Cai, J.; Jiang, G. J. Metformin improves the angiogenic functions of endothelial progenitor cells via activating AMPK/eNOS pathway in diabetic mice. Cardiovasc. Diabetol. 2016, 15, 88. (46) Tsukanaka, M.; Fujibayashi, S.; Otsuki, B.; Takemoto, M.; Matsuda, S. Osteoinductive potential of highly purified porous βTCP in mice. J. Mater. Sci.: Mater. Med. 2015, 26 (3), 132. (47) Hienz, S. A.; Paliwal, S.; Ivanovski, S. Mechanisms of Bone Resorption in Periodontitis. J. Immunol. Res. 2015, 2015, 615486.

3571


Exosomes Secreted by Stem Cells from Human Exfoliated Deciduous

Recommend Documents