Research Article Cite This: ACS Synth. Biol. 2019, 8, 170−180
pubs.acs.org/synthbio
Expanding the Potential of CRISPR-Cpf1-Based Genome Editing Technology in the Cyanobacterium Anabaena PCC 7120 Tian-Cai Niu,†,# Gui-Ming Lin,†,# Li-Rui Xie,† Zi-Qian Wang,†,‡ Wei-Yue Xing,†,‡ Ju-Yuan Zhang,†,* and Cheng-Cai Zhang† †
Key Laboratory of Algal Biology, Institute of Hydrobiology, the Chinese Academy of Sciences, Wuhan, Hubei Province, China University of Chinese Academy of Sciences, Beijing, 100049, China
‡
ACS Synth. Biol. 2019.8:170-180. Downloaded from pubs.acs.org by IOWA STATE UNIV on 01/20/19. For personal use only.
S Supporting Information *
ABSTRACT: CRISPR systems, such as CRISPR-Cas9 and CRISPRCpf1, have been successfully used for genome editing in a variety of organisms. Although the technique of CRISPR-Cpf1 has been applied in cyanobacteria recently, its use was limited without exploiting the full potential of such a powerful genetic system. Using the cyanobacterium Anabaena PCC 7120 as a model strain, we improved the tools and designed genetic strategies based on CRISPR-Cpf1, which enabled us to realize genetic experiments that have been so far difficult to do in cyanobacteria. The development includes: (1) a “two-spacers” strategy for single genomic modification, with a success rate close to 100%; (2) rapid multiple genome editing using editing plasmids with different resistance markers; (3) using sacB, a counter-selection marker conferring sucrose sensitivity, to enable the active loss of the editing plasmids and facilitate multiple rounds of genetic modification or phenotypic analysis; (4) manipulation of essential genes by the creation of conditional mutants, using as example, polA encoding the DNA polymerase I essential for DNA replication and repair; (5) large DNA fragment deletion, up to 118 kb, from the Anabaena chromosome, corresponding to the largest bacterial chromosomal region removed with CRISPR systems so far. The genome editing vectors and the strategies developed here will expand our ability to study and engineer cyanobacteria, which are extensively used for fundamental studies, biotechnological applications including biofuel production, and synthetic biology research. The vectors developed here have a broad host range, and could be readily used for genetic modification in other microorganisms. KEYWORDS: CRISPR, Cpf1, cyanobacteria, genome editing, conditional mutant, large DNA fragment deletion
C
the two RNAs; Cas9 recognizes a target with a 3′ G-rich PAM (5′-NGG-3′) and cuts DNA immediately after, producing blunt ends. CRISPR-Cpf1 is another CRISPR-Cas system that shows great promise for genome editing. The system was first characterized in Francisella novicida.6 Compared with CRISPRCas9, CRISPR-Cpf1 is different in several aspects: Cpf1 recognizes a target with a 5′ T-rich PAM (5′-TTN-3′); it possesses both a ribonuclease activity processing the precrRNA array into mature crRNAs and a nuclease activity cutting the double DNA sequence to produce staggered ends, without the aid of a tracrRNA. In many organisms, both Cas9 and Cpf1 can be exploited for efficient genome editing. However, in certain species such as Chlamydomonas reinhardtii and Corynebacterium glutamicum, Cas9 was found to be highly toxic and thus not suitable for genome editing.7,8 The toxicity of Cas9 in these organisms remains unclear. However, when Cpf1 was used in these organisms, efficient genome editing could be achieved.8,9 Thus, Cpf1 protein seems to be less toxic than Cas9, at least in these organisms where Cas9 does not work well.
RISPR-Cas systems are adaptive immune systems widely distributed in bacteria and archaea, and have been developed into a revolutionary genome editing method in recent years.1 With such systems, the speed of genetic manipulation in many organisms, ranging from microorganisms to plants and mammals, has been greatly accelerated. In CRISPR-Cas assisted genome editing, the Cas effector protein, which belongs to RNA-guided endonucleases, is directed by a crRNA that harbors a spacer sequence (CRISPR guide), to the target DNA site specified by both a protospacer that matches the spacer and a protospacer-adjacent motif (PAM), to induce double stranded breaks. The DNA breaks can be repaired by cells via either the mechanism of nonhomologous end joining (NHEJ), leading to random insertions or deletions, or the mechanism of homology-directed repair (HDR) that results in precise editing when a homologous repair template is provided.2,3 CRISPR-Cas9 and CRISPR-Cpf1 are two main CRISPR-Cas systems used for genome editing, with the CRISPR-Cas9 from Streptococcus pyogenes being the first CRISPR-Cas system developed for that purpose.4,5 CRISPRCas9 possesses the following features: the maturation of crRNAs from a pre-crRNA array requires the activity of ribonuclease III; Cas9 is guided to the target DNA site by a crRNA in complex with a tracrRNA, or by an artificial fusion of © 2018 American Chemical Society
Received: October 23, 2018 Published: December 10, 2018 170
DOI: 10.1021/acssynbio.8b00437 ACS Synth. Biol. 2019, 8, 170−180
Research Article
ACS Synthetic Biology
Figure 1. Genome editing vectors developed in this study. RSF1010, the replication region from the broad host range plasmid RSF1010; cpf1, the gene encoding the Cpf1 protein from Francisella novicida; sacB, the counter-selection gene conferring sucrose sensitivity; lacZ′, the sequence encoding the β-galactosidase fragment LacZα for blue/white screening during spacer cloning; nptII, the kanamycin/neomycin resistance gene; aadA, the spectinomycin/streptomycin resistance gene. To make an editing plasmid, the spacer sequence should be cloned between the two AarI sites, and the homology repair template should be cloned at the BglII-BamHI site.
PCC 7120, Synechocystis PCC 6803, and Synechococcus elongatus UTEX 2973.21 They found that Cpf1 was much less toxic to cyanobacteria. With the expression of Cpf1 and crRNA from a replicative plasmid bearing the homologous repair template, markerless genome editing (including point mutation, gene knock-in, and gene knockout) could be achieved with high efficiency in all the tested strains. Editing of the genetic information, engineering of metabolic networks, construction of minimal genomes for synthetic biology, or understanding basic processes all require powerful genetic tools. However, in addition to the fact that the current method for genome editing using Cpf1 in cyanobacteria has still much room for improvement, it remained impossible, or at least very difficult to our knowledge, to obtain conditional mutants for genes that are essential in cyanobacteria, or deleting large gene clusters. Such difficulties pose a real obstacle for genetic dissection and manipulation of cyanobacteria in the era of synthetic biology, in contrast to their enormous potential in biotechnological and environmental studies. Here we report the development of CRISPR-Cpf1 based tools and strategies for these challenging genetic manipulations in the cyanobacterium Anabaena PCC 7120, a filamentous strain able to form heterocysts to fix atmospheric nitrogen when growing in a medium lacking combined nitrogen. These tools and strategies can also be used in other organisms for genomic editing.
Cyanobacteria have great potential in biotechnology as they can convert CO2 into valuable bioproducts using light as the sole energy;10 some cyanobacterial strains also serve as important models in basic research in fields such as photosynthesis, biological nitrogen fixation, and prokaryotic cell differentiation.11,12 Many cyanobacteria are polyploids13,14 and have long generation time (i.e., from several hours to more than 20 h), and the conventional allelic-exchange based genome modification available for cyanobacteria is timeconsuming and of low efficiency. Thus, there is a great need to develop more efficient genetic manipulation methods for rapid engineering of cyanobacteria. As the CRISPR-Cas9 system has gained great success in many bacterial species, such as Streptococcus pneumoniae, Escherichia coli, Streptomyces, Bacillus subtilis, and Clostridium beijerinckii,15−18 its potential has also been tested in cyanobacteria. In Synechococcus elongatus PCC 7942, cotransformation of a nonreplicative plasmid expressing Cas9, a crRNA/tracrRNA complex, and a DNA fragment for homology recombination was shown to promote chromosome segregation after homology recombination, with the aid of antibiotic selection.19 In Synechococcus elongatus UTEX 2973, transient expression of Cas9 protein also facilitated markerless genome editing.20 However, like in Chlamydomonas reinhardtii and Corynebacterium glutamicum, higher dosage of Cas9 was also found to be toxic in cyanobacteria as the expression of Cas9 alone on a replicative plasmid in Synechococcus elongatus UTEX 2973 already led to cell death.20 To avoid the toxicity of Cas9, which may cause undesired consequences, Ungerer and Pakrasi explored the application of the CRISPR-Cpf1 system from Francisella novicida, in three model cyanobacterial species: Anabaena
■
RESULTS AND DISCUSSION Development of a “Two-Spacers” Strategy for Genome Editing in Anabaena with a High Success Rate. We sought first to improve the efficiency of genome 171
DOI: 10.1021/acssynbio.8b00437 ACS Synth. Biol. 2019, 8, 170−180
Research Article
ACS Synthetic Biology editing using CRISPR-Cpf1 in cyanobacteria. We used pSL2680 (Addgene no. 85581), developed successfully in cyanobacteria,21 as a starting material for further development of genome editing techniques. This vector contains the components of the broad host range replicon RSF1010 that enable it to replicate in cyanobacteria, the resistance marker nptII, the Francisella novicida cpf1 gene, an AarI-lacZ′-AarI site flanked by CRISPR direct repeats for the cloning of the spacer sequence of crRNA, and a SalI-KpnI site for the cloning of homologous repair template.21 For unknown reasons, pSL2680 could not be well digested with SalI and KpnI in our lab; we therefore made another vector, pCpf1, by replacing the SalIKpnI site of pSL2680 by a BglII-BamHI site (Figure 1). To test the efficiency of the system based on pCpf1, two editing plasmids were constructed for markerless deletion of two heterocyst-related genes, hetR (gene id: alr2339) and patS (gene id: asl2301) in Anabaena, respectively, following the previously described procedure.21 The hetR gene encodes a master regulator necessary for the initiation of heterocyst differentiation,22 while patS encodes an inhibitor of the developmental process, and its deletion leads to increased heterocyst frequency and the occurrence of multiple contiguous heterocysts.23 The editing plasmids of hetR and patS, each contain a spacer targeting the gene region to be deleted and a homologous repair template composed of a region of ∼1 kb upstream from the gene and a region of ∼1 kb downstream from the gene. They were introduced, respectively, into Anabaena by conjugation, and individual colonies were obtained on agar plates. These colonies were further grown on fresh agar plates, and their genotypes were checked by PCR. All the 10 individual clones for markerless deletion of hetR were segregated with the complete deletion of hetR on the chromosome, and as expected the mutant strain could not form heterocyst in the medium depletion of combined nitrogen (Supplementary Figure 1). However, the deletion of patS was not successful as all the 13 clones examined still retained wild-type copies of patS (data not shown). The deletion of several other genes also gave inconsistent results (data not shown). One reason for such a problem could be the low efficacy of the spacer sequence, as it is known that successful genome editing based on CRISPR-Cas systems relies very much on the proper selection of the cleavage target, which is determined by the spacer sequence on crRNA.6 To examine the efficacy of diverse spacers in genome editing in Anabaena, and to improve the overall genome editing efficiency, we attempted to create markerless mutants of 26 genes (including hetR and patS mentioned above) (Table 1, Supplementary Table 2), with a strategy we called “two-spacers”. This strategy employs two editing plasmids in every editing case, with both plasmids containing the same homologous repair template but different spacer sequences. The 52 spacers targeting the 26 genes were mainly chosen according to the following criteria: (1) their targets had the PAM 5′-KTTV-3′ (K = T or G, while V = C, G, or A); (2) they had the length of 22 bp; (3) they did not contain more than eight contiguous AT or GC pairs as this could lead to unfavorable crRNA conformation; (4) they were unique sites on the chromosome. Each spacer, together with the corresponding homologous repair template, was cloned into the vector pCpf1 to make the editing plasmid. All editing plasmids were then transferred into Anabaena by conjugation and the exconjugants were examined by PCR.
Table 1. Testing the Efficacy of 52 Spacers by Making Deletion Mutants of 26 Anabaena Genes Using CRISPRCpf1. For Each Gene, Two Spacers Targeting Two Different Sites Were Used Gene ID
target with PAMa
editing efficiencyb
all0173
gttgCTTACCCCGCATAGCAAAGGTG gttgTATGTCAGACAGCATCCGGCTC gttgATTAGTGGGACTAATCAATCTC gttgCTCCTAGCGCGTGATGCTTACG gttgACACTGTTCTACTAATAACCGA tttaGTACTTCAGGTACCTGGTCTAT tttgACTGGCGTTTACCTACTGGTAC tttgCCTTGAAGGCAGATTTATGGAA gttaTATAGAAGAAGTCACCCAGGCA gttcTCCATTCTCGGTCAGTATCCAG gttgGGCGATGTCCTGAATTAAAACC gttcAAGGTTCTACGATCGCCCAAAA gttaAGCTTTCAGGAAATTTGCTGCA gttaATGAGTAGGGCTTTTGCCAATT tttaGCTGTAGATGATCATGCCTCTG tttcCCTGTAAAGGCTACAACACAAG gttgGGAGAGTATGAACTCGTACTCA gttgTCAACAGAGGACACAGTATTCA tttgAGCCTTTGGCTTCCAATACACC tttgCACCGAGTACCGCAACTTGATT gttgCAGAAGCACTAGTGGAAGCGGA tttgCAATAGGGATAATTGCTTTTGT tttgGGGAAGAAATCGCACCTTTAGC gttgTCGCGCTCCTTGTAAAAACATC gttcTACGTCAAGCTATAGCATTAAT gttgGTACTGCTTTAGGTAGTGTGAT gttgCAGAACTTGATTTCACCGATGA tttgGATCTCTTTCTGAATCTCGAAT gttgATCGAATTTCTCCATAAGCGAT attgAGCATAAGTTACCCAGCAATCT atttTGCTTAAGTGCAGCTTTGACTG gttaCTAATTCCAGCCCTTGTTCCTT gttgTCCGAAGTTATTTAATTTTCAT tttgCAATCACTGATCATCATACTGT tttgATTATCGTTGTAAACAAGCAGG tttgGTTTAGGATAATGAATATCAAC gttaACCAACAAACCCGCTAAATCGT gttaGGTCTCAAGGATACTAGGTTAG gttgATAAGGCGTTAAGGTTTGCAGG gttgGGACAGAAGTAAACGCCTTAAG gttgTGGTGGCTAATCATCACACCCT tttgTGAGACGCAAGTGGCAATTGTC tttgGGTGGTCAATCAAATAGCAACG tttgTAATGGTGGTAAAGACTACTCA tttcGATGCCAGCATTGTTAATCAAG tttcTCGTTCTCAATCAGGATTAGCC gttcTACCTCACCCAGTCGATACACC tttaAGTTCGATTTTATTACCTCTAG gttaGTGAATTTCTGTGATGAGCGCG tttcTGTGATGAGCGCGGTAGTGGTA gttcGATTAATGTGGCTGCTAAAAAG tttcAGCCTGGGGAGTAAAGCCCCAG
2/3 3/3 3/3 3/3 3/3 3/3 3/3 3/3 8/8 8/8 6/6 5/5 3/3 3/3 3/3 2/3 0/6 0/6 3/3 3/3 6/6 5/5 8/8 5/8 3/3 0/3 7/7 7/7 0/6 10/10 0/4 3/4 3/3 3/3 3/3 3/3 9/10 0/10 2/3 3/3 3/3 3/3 3/3 3/3 7/12 9/12 0/5 5/5 0/13 5/8 3/3 0/3
all0395 all0521 all0596 all1175 asl1274 all1616 all1781 all2707 alr0452 alr0451 alr1550 alr1860 alr2019 alr2339 alr2535 alr2940 alr3296 alr3546 alr4029 alr4057 alr4777 alr5358 alr7361 asl2301 asr5262
a
The protospacer sequence was in uppercase and the corresponding PAM sequence was in lowercase. bThe number on the right was the number of exconjugants from the conjugation plates examined by PCR, and the left was the number of the exconjugants in which the target gene was successfully deleted. 172
DOI: 10.1021/acssynbio.8b00437 ACS Synth. Biol. 2019, 8, 170−180
Research Article
ACS Synthetic Biology
Figure 2. PCR verification on the genotype of the hetR/hetN double mutant strains. (a) The relative positions of the oligonucleotides for PCR. The boxes filled with gray stripes represent the deleted chromosomal regions, and the blue boxes represent the homologous recombination regions (the lengths of the shapes are not proportional to the actual sizes). P1, P2, P3, P4, P5, P6, P7, and P8 are short names for the oligonucleotides Palr2339F1093m, Palr2339R1865, cr2_alr2339F431F, Palr2339R570, Palr5358F1090m, Palr5358R2078, cr_alr5358F111F, and Palr5358R861, respectively. The expected sizes of the PCR products for WT, ΔhetR, and ΔhetN were shown on the right. (b) PCR verification on the genotype of three exconjugants randomly selected from the conjugation plates after iterative editing hetR and hetN (see text for the detail). All the exconjugants had the mutation genotypes. (c) PCR verification on the genotype of three exconjugants randomly selected from the conjugation plates of simultaneous editing hetR and hetN. Two of the three exconjugants were correctly edited. Bands of DNA marker (M) in panel b and panel c have the sizes of 8000 bp, 5000 bp, 3000 bp, 2000 bp, 1000 bp, 750 bp, 500 bp, 250 bp, and 100 bp, respectively. (d) Microscopic images of the hetR/ hetN double mutant. Arrows indicate heterocysts. This mutant strain, created by iterative editing, was not able to undergo heterocyst differentiation in the nitrogen-depleted medium BG110. Bars correspond to a length of 10 μm. The double mutant strain created by simultaneous editing had the same phenotype (data not shown).
from those reported in a recent study based on a limited number of CRISPR targets in Saccharomyces cerevisiae, which showed that the 5′-TTTV-3′ PAM was strongly favored by Cpf1 from Francisella novicida.25 Multiple Genome Editing in Anabaena. Often, more than one round of genome editing could be necessary, and in such a case, next-round editing cannot be performed unless the previous editing plasmid has been cured or the new round uses a plasmid with a different selection marker. To facilitate multiple rounds of editing, we developed another vector, pCpf1-Sp, which was derived from pCpf1 following replacement of the kanamycin-resistance cassette nptII by the spectinomycin/streptomycin resistance marker aadA (Figure 1). The benefit of having two editing plasmids with different resistance markers is that a strain edited with the first plasmid, once confirmed to be fully segregated, can receive immediately the second plasmid for a new round of editing (Supplementary Figure 2). By repeating the same procedure, multiple genetic modifications can be achieved. With this method, we successfully made a markerless double mutant of hetR and hetN (gene id: alr5358, which encodes an inhibitor for heterocyst differentiation and its deletion leads to increased heterocyst frequency26) by sequentially deleting one after the other using the editing plasmids pCpf1-ΔhetR and pCpf1-SpΔhetN (Figure 2A,B). The mutant strain could not form heterocysts when grown in the BG110 medium lacking combined nitrogen (Figure 2D), consistent with a previous report showing that hetR mutation is epistatic to hetN mutation.27 Double genome editing can also be implemented by transferring simultaneously two editing plasmids conferring
The result showed that among the 52 spacers, 43 could mediate successful deletion, giving a high success rate of 82.7% (Table1). We estimated that if two spacers were used for each specific editing, the average success rate should be further increased to 97.0% (calculated as 1 − (1 − 82.7%)×(1 − 82.7%)). Indeed, our result fitted well with the estimation: among the 26 genes, 15 were successfully deleted with either of the two spacers tested; for 7 genes, full segregation mutants could be obtained with one of the two spacers; only all2707, encoding the cell division related protein Ftn2, could not be completely deleted with either spacer−it is very likely that this gene is essential as a previous attempt to inactivate it could not get a fully segregated strain either.24 In total, 25 of the 26 tested genes could be deleted with full segregation when two spacers were used for each deletion, giving a success rate of 96.2%. The CRISPR-Cpf1 system could facilitate gene editing effectively in Anabaena, as reported previously,21 and with the “two-spacers” strategy, the editing efficiency could be further leveraged to nearly 100%. The PAM of the CRISPR target is one of the most important factors that influence the efficiency of genome editing. Here, most CRISPR targets had a 5′-TTTV-3′ PAM and a 5′-GTTV-3′ PAM, thus we were able to compare their efficacy. Among the 52 targets for gene deletion, 21 had a 5′TTTV-3′ PAM and 29 had a 5′-GTTV-3′ PAM (Table 1). Both PAMs could result in high editing efficiency, although the targets with a 5′-TTTV-3′ PAM could be edited more efficiently than those with a 5′-GTTV-3′ PAM (95.2% vs 75.9%). 5′-ATTV-3′ and 5′-CTTV-3′ were rarely chosen as the PAM of the targets in this study, hence their influence on editing efficiency could not be estimated yet. This result differs 173
DOI: 10.1021/acssynbio.8b00437 ACS Synth. Biol. 2019, 8, 170−180
Research Article
ACS Synthetic Biology
Figure 3. Spontaneous loss of sacB containing plasmid in E. coli (a,b) and in Anabaena (c−e). E. coli cells bearing pCpf1b-Sp was inoculated at the initial concentration of OD600 = 0.0001, and grown overnight to OD600 = 1.28 (about 13 generations). The culture was then serially diluted with the dilution factors from 102 to 105; 100 μL of each dilute was spread onto the LB plates supplemented with or without 5% of sucrose (a). Eight colonies randomly chosen from the LB plates with or without sucrose respectively were examined by colony PCR using the oligonucleotides Pcpf1F3795 and PV_R14, which could amplify a 944 bp fragment from pCpf1b-Sp. The PCR result showed that all the eight colonies from the plates without sucrose retained the plasmid, while those from the plates with 5% sucrose all lost the plasmid (b). From the numbers of the colonies shown in panel a, we estimated that about 0.04% cells in the overnight culture had lost pCpf1b-Sp spontaneously. After growing Anabaena strain carrying pCpf1b-Sp in BG11 medium without antibiotics for about five generations (OD700 from 0.03 to 1.0), the cell filaments were sonicated and diluted by 103 fold; 0.3 mL of the dilute was spread onto the BG11 plates containing 5% sucrose (c). All seven Anabaena colonies randomly chosen from the sucrose plate had lost the plasmid as revealed by colony PCR using the oligonucleotides Pcpf1F3795 and PV_R14 (d), and they became sensitive to the antibiotics (e). CK, the Anabaena strain containing pCpf1b-Sp.
edited strain should be cured of the editing plasmid. Currently, the edited strain is cured as follows: after growing cells in an antibiotic-free medium for many generations, the culture was then plated without antibiotics, followed by screening the colonies for those that have spontaneously lost the editing plasmid.21 Such a procedure is time-consuming and unreliable since the related plasmids are stable in Anabaena cells. To improve the efficiency of plasmid curing, we exploited sacB, a gene from Bacillus subtilis widely used as a counter-selection marker to screen double crossover recombination in the conventional genetic manipulation of cyanobacteria.28 Two sacB bearing genome editing vectors, pCpf1b and pCpf1b-Sp, were constructed by inserting the sacB gene into pCpf1 and pCpf1-Sp, respectively (Figure 1). Their efficiency was tested in both E. coli and Anabaena. We observed that after growing E. coli cells originally containing pCpf1b-Sp in LB medium without antibiotics overnight (about 13 generations), 0.04% of
different antibiotic resistance into the same host cells, shortening the time required for two genetic modifications (Supplementary Figure 2). To demonstrate the feasibility of this method, we created a hetR/hetN double mutant by simultaneously transferring the editing plasmids pCpf1-ΔhetR and pCpf1-Sp-ΔhetN into Anabaena by conjugation. We checked three randomly chosen colonies grown up from the plates, and two of them had the desired genotypes (Figure 2A,C). The whole procedure took the same time as required for single genetic modification. Conjugation with two plasmids was less efficient, but this shortcoming was compensated by the high efficiency of the CRISPR-Cpf1-based genome editing and the operation time saved. Counter Selection with sacB Facilitates Curing of Editing Plasmid from Cells. To make a markerless modification strain, with no genetic interference from any unrelated genetic background during phenotypic analysis, the 174
DOI: 10.1021/acssynbio.8b00437 ACS Synth. Biol. 2019, 8, 170−180
Research Article
ACS Synthetic Biology the population could survive on the LB plates containing 5% sucrose, and the sucrose-resistant colonies tested had all lost the plasmid (Figure 3A,B). In Anabaena, as cells form filaments, the percentage of plasmid loss was not estimated. After growing Anabaena cells containing pCpf1b-Sp in antibiotic-free medium for about five generations (OD750 from about 0.03 to 1.0), the long filaments were sonicated into single cells or short filaments (less than five cells per filament on average), then spread on BG11 plates supplemented with 5% sucrose (Figure 3C). Seven randomly chosen sucroseresistant colonies all had lost the plasmid as determined by PCR (Figure 3D), and became sensitive to spectinomycin/ streptomycin at the same time (Figure 3E). The sonicated culture was also spread on BG11 plates without sucrose supplementation; however, eight randomly chosen colonies grown up in these plates all retained the plasmid (Supplementary Figure 3). These results indicate that sacB could significantly facilitate the process of plasmid curing. Create Conditional Mutants of Anabaena with CRISPR-Cpf1. Despite the importance of genes that are essential, it remains difficult or even impossible to obtain conditional mutants for these genes in cyanobacteria for a better understanding of the basic biological processes. This is probably because of the low efficiency of DNA replacement based on classical homologous recombination; in addition, cyanobacteria currently used for genetic studies are polyploid, making them even more difficult to replace DNA fragment on every copy of the chromosome. With its high efficiency, we here tested whether CRISPR-Cpf1 could be exploited to make conditional mutants of essential genes. PolI, the first recognized DNA replication enzyme, was initially discovered in Escherichia coli six decades ago.29 PolI is involved in several aspects related to the process of DNA replication and repair, such as filling in the gaps between Okazaki fragments,30 repairing UV-damaged DNA,31 participating in translesion synthesis.32 In many bacteria such as E. coli, Bacillus subtilis, or Haemophilus influenzae, the activity of PolI is dispensable for cell viability.32−34 Analysis of the available genome sequences revealed that homologues of PolI-encoding gene, polA, are universally conserved in all cyanobacterial species. PolI however seems to be critical for viability in cyanobacteria, as an effort to create a full deletion mutant of polA did not succeed in the unicellular cyanobacterium Synechococcus elongatus PCC 7942 by using the conventional method of homologous recombination.35 We also failed to inactivate polA (gene id: alr1254) in Anabaena by traditional homologous recombination (data not shown). We therefore attempted to create a markerless conditional mutant of Anabaena polA (Figure 4A), by replacing the native ribosome binding site (RBS) of polA with an artificial theophylline riboswitch which has been used successfully in cyanobacteria for the control of gene expression.36,37 As mentioned previously, not all spacers work efficiently in Cpf1-based genome editing. To increase the success rate of editing, we selected two spacers targeting the region compassing the RBS site of polA. Instead of using the standard “two-spacers” strategy as described above, which involves making two editing plasmids with each containing one spacer, we here used a variant of it that features two spacers on the same editing plasmid. The corresponding editing plasmid harbored two tandem spacers, and a repair template that contains a theophylline riboswitch between the upstream and the downstream homologous recombination regions. The
Figure 4. Construction of the conditional mutant of polA using CRISPR-Cpf1. (a) The schematic representation of the genotype of Anabaena wild type strain (WT) and the TRS-polA strain. (b) Verification on the genotype of TRS-polA by PCR using the primers shown in panel a (black arrows). P1, P2, and P3 are short names for the oligonucleotides Palr1254F1456m, cr2_alr1254F14mR, and Priboswitch2, respectively. Three colonies grown up on the conjugation plates were examined. The expected size of the PCR product amplified from the WT genome with P1 and P2 is 1468 bp and that from TRS-polA with P1 and P3 is 1480 bp. (c) The growth of TRS-polA in the BG11 agar plates supplemented with or without 2 mM of theophylline (Tp). The culture of TRS-polA at OD700 = 0.5 was serially diluted and spotted on the agar plates. WT was used as the control. The pictures were taken 8 days after the cells were grown in the light incubator.
plasmid was transferred into Anabaena via conjugation on the BG11 plates containing 100 μg mL−1 neomycin and 2 mM theophylline. The exconjugants were then streaked in a fresh plate containing the same concentrations of neomycin and theophylline. Subsequently the genotype of three exconjugants was subjected to PCR verification and two of them were found 175
DOI: 10.1021/acssynbio.8b00437 ACS Synth. Biol. 2019, 8, 170−180
Research Article
ACS Synthetic Biology
Figure 5. Deletion of large chromosomal regions using CRISPR-Cpf1. (a) Polyketide synthesis gene cluster and its different regions removed with Cpf1-mediated genome editing in this study (the lengths of the shapes and lines are proportional to the actual sizes). The sites (S, V, and O) selected for Cpf1 cleavage are indicated by arrows. (b) Verification on the genotype of the Anabaena strains with 43 kb, 109 kb, and 118 kb chromosomal region deletion by PCR. The relative positions of the oligonucleotides for PCR were shown. The boxes filled with gray stripes represent the deleted chromosomal regions, and the blue boxes represent the homologous recombination regions (the lengths of the shapes are not proportional to the actual sizes). P1, P2, P3, P4, P5, and P6 are short names for the oligonucleotides Pall2641R4181, Pall2649F2, Pall2647R1694, Pall2647F588, Palr2680R8065, and Palr2634F460m, respectively. The genotype of three or four colonies randomly selected exconjugants of each edited strain was examined. For successfully edited colonies, the oligonucleotide pairs P1/P2, P1/P5, and P6/P5 should give products of 2310 bp, 2344 bp, and 2437 bp, respectively; while P3/P4 should give no product. For WT or unsuccessfully edited colonies, P1/P2, P1/P5, or P6/P5 should give no product while P3/P4 should give a product of 1106 bp. Bands of DNA marker (M) have the sizes of 8000 bp, 5000 bp, 3000 bp, 2000 bp, 1000 bp, 750 bp, and 500 bp, respectively. The result shows that most colonies had the desired genotypes.
Delete Large Chromosomal Regions with CRISPRCpf1. Synthetic biology often requires extensive changes in the genome, including resynthesis and reorganization of genetic materials, construction of minimal genomes, or removal or introduction of a large DNA fragment. CRISPR-Cas systems have been used mostly for genomic modification of chromosomal regions smaller than several kilobases, such as gene knock-in, gene knockout or base substitution. Nevertheless, editing of large chromosomal regions with CRISPRCas systems were also reported in several bacterial species. For instances, an 82.8 kb Ca2+-dependent antibiotic biosynthetic gene cluster was deleted with CRISPR-Cas9 from the chromosome of Streptomyces coelicolor;17 E. coli chromosomal regions up to 100 kb could be removed with either the nicking Cas9 or a Cas9-based method termed CRISPR/Cas9-assisted gRNA-free one-step (CAGO) genome editing technique helped by the RED recombinase.38,39 CRISPR-Cpf1 was also
to be fully segregated (Figure 4B). Further examination by sequencing confirmed that the −37 to −1 region of polA was replaced as expected by the theophylline riboswitch sequence (Supplementary Figure 4). The mutant strain, TRS-polA, grew slightly slower than the WT in the presence of theophylline; however, it was unable to survive when theophylline was absent in the medium (Figure 4C). Thus, the expression of polA was indeed under the control of theophylline riboswitch in the mutant strain. The result implies that polA is an indispensable gene in Anabaena. With the same strategy, we also created markerless conditional mutant strains for several other genes, such as all3578, which encodes the α-subunit of DNA polymerase III that is required for viability (data not shown). Thus, with the aid of CRISPR-Cpf1, it becomes now much easier to investigate the function of essential genes in cyanobacteria. 176
DOI: 10.1021/acssynbio.8b00437 ACS Synth. Biol. 2019, 8, 170−180
Research Article
ACS Synthetic Biology
chromosome structure and rearrangement, or the manipulation of large gene clusters as required in synthetic biology.
used to mediate the deletion of a 49.2 kb chromosomal region in Clostridium dif f icile.40 To test the capacity of Cpf1 in editing large DNA fragments in cyanobacteria, we sought to make deletions within a 118 kb gene cluster (all2635 to alr2680) that might participate in the synthesis of polyketides (Figure 5A) in Anabaena. Part of this gene cluster covering 43 kb was successfully removed by a conventional genetic method, and such a deletion did not obviously affect cell grow under standard growth conditions.41 Therefore, the whole gene cluster might be dispensable. We designed three deletions: a 43 kb region from all2641 to all2649, the same region that was interrupted before; a 109 kb region from all2641 to alr2680; and the entire 118 kb cluster. Each editing plasmid for the deletions contains a homologous repair template composed of about 1 kb fragment upstream the region to be deleted, and another fragment of similar size downstream the region. As the regions to be deleted are much larger than those for single gene deletion, to understand if the relative position of the crRNA targeting site within such large regions has an influence on editing efficiency, we chose spacers targeting different positions. For the 43 kb deletion, one spacer was selected to target one end of the deletion region (site V in Figure 5A). For the 109 kb deletion, two spacers were chosen, one targeting the center and the other targeting one end of the deletion region (sites S and V), and both were cloned into one editing plasmid. For the 118 kb deletion, two spacers targeting the center and one end of the deletion region (sites V and O) were chosen and separately cloned into two editing plasmids. These editing plasmids were transferred into Anabaena cells by conjugation. More than 100 colonies could be obtained for each conjugation plate, and these numbers were close to those obtained in small size fragment deletion. The genotypes of several randomly picked exconjugants were examined by PCR (Figure 5B). For 43 kb and 118 kb deletions, all the examined exconjugants had been successfully edited (the PCR verification result of the 118 kb deletion mediated by the target site O was similar to that of site V, and the related picture was not shown). For the 109 kb deletion, all four checked exconjugants contained edited chromosome copy, but one of them also contained wild-type copy, indicating incomplete segregation. Altogether, deletion of chromosomal regions up to 118 kb could be accomplished with CRISPRCpf1 with high efficiency. Many cyanobacteria are oligoploid or polyploid. For example, Synechococcus elongatus PCC7942 and Anabaena PCC 7120 contain, respectively, around four and eight copies of the chromosome in each cell.13,14 We here demonstrated that Anabaena genomic regions sizing from 43 kb to 118 kb could be deleted by the CRISPR-Cpf1 technique with high efficiency, indicating that polyploidy does not prevent efficient removal of large DNA fragments. Additionally, the two different spacers targeting, respectively, the center and one end of the 118 kb region to be deleted gave the same 100% editing efficiency, implying that the relative position of the CRISPR target does not influence the editing efficiency. To our knowledge, 118 kb is the largest bacterial chromosomal region that has ever been removed with the CRISPR-Cas systems. As neither region size nor ploidy seems to be critical for CRISPR-Cpf1 based editing, CRISPR-Cpf1 may possibly be used for manipulating even much larger chromosomal regions, which could be very useful in the investigation of
■
CONCLUSIONS Recently, CRISPR-Cpf1 based genome editing was shown to facilitate markerless genetic modifications of a single gene or a single nucleotide much more easily than the conventional methods in cyanobacteria.21 We here developed more efficient tools and genetic strategies, and demonstrated the application of this system in previously challenging genetic manipulations in the cyanobacterium Anabaena PCC 7120. With the “twospacers” strategy, we were able to improve the success rate of genome editing close to 100%. By simultaneously transferring two editing plasmids having different resistance markers into the same cells, we showed that double genome editing could be accomplished in a much shorter period. By introducing the counter-selection gene sacB into the editing plasmids, we further demonstrated that the process of plasmid curing could be greatly simplified and accelerated. The handling of essential genes is among the most challenging genetic manipulations with conventional genetic methods for cyanobacterial studies, and various attempts had very limited success, often at best obtaining partially segregated mutants with a weakened phenotype. Here we showed that conditional mutation of essential genes, such as the DNA polymerase I encoding gene polA, could be achieved, paving the way for the functional dissection of genes that are essential in cyanobacteria. Similarly, we showed here that deletion of large chromosomal regions up to 118 kb could be efficiently achieved with CRISPR-Cpf1, and such a development will allow the study of large genetic regions, or facilitate reprogramming of the genetic information through synthetic biology. Cyanobacteria have great potential in producing high valueadded compounds and biofuels. The genome editing vectors and the strategies developed here would allow us to rapidly make almost any markerless genomic modification in cyanobacteria with a high success rate, which is critical for engineering cyanobacteria for fundamental research and biotechnological applications. Besides, the broad host range vectors developed here, together with the editing strategies, could be readily applied in other organisms and to other CRISPR-Cas systems.
■
MATERIALS AND METHODS Growing Cyanobacterial Strains. All Anabaena strains were grown in BG11 medium,42 with the exception that the conditional mutant of polA, TRS-polA, was grown in BG11 supplemented with 2 mM theophylline. All strains were cultured at 30 °C with the light density of 30 μmol m−2 s−1. To induce heterocyst formation, the cultures logarithmically growing in BG11 were collected and washed twice with BG110 (BG11 without combined nitrogen), and then grown in BG110. Construction of Vectors and Editing Plasmids. All the oligonucleotides used in this study were listed in Supplementary Table 1. All the constructed plasmids were verified by Sanger sequencing. Construction of Genome Editing Vectors. To construct pCpf1, pSL2680 (Addgene no. 85581) was amplified with the oligonucleotides Padpcpf1_F and Padpcpf1_R, and the PCR product was circularized via seamless cloning.43 To construct pCpf1-Sp, pCpf1 was amplified with the oligonucleotides 177
DOI: 10.1021/acssynbio.8b00437 ACS Synth. Biol. 2019, 8, 170−180
Research Article
ACS Synthetic Biology Pcpf1F102 and Pcpf1R11143, the addA gene that encodes the spectinomycin/streptomycin resistance was amplified from the omega fragment44 using the oligonucleotides Sp_F377m and Sp_R1176, the two fragments were then assembled via seamless cloning. To make pCpf1b and pCpf1b-Sp, the sacB gene amplified from pRL27128 with the oligonucleotides PsacBR1611 and PsacBF479m was inserted via seamless cloning into pCpf1 and pCpf1-Sp linearized with PstI, respectively. Construction of the Editing Plasmids for Single Gene Deletion. To make an editing plasmid, a spacer sequence and a repair template need to be cloned into one of the editing vectors (Figure 1). The spacer prepared by annealing a pair of complementary oligonucleotides was ligated into the AarIdigested vector with T4 DNA ligase. The homologous repair template, which consists of about 1 kb upstream fragment and about 1 kb downstream fragment of the region to be deleted, was amplified from Anabaena genome and cloned via seamless cloning into the vector digested with BamHI and BglII. For most of the editing plasmids, the repair template was cloned into the vector prior to the spacer sequence; however, when the repair template contains an AarI site, the spacer sequence was cloned first. The detailed cloning procedure was exemplified by the construction of the deletion plasmids of hetR and hetN (see below). All other Cpf1-based editing plasmids used in this study were constructed in the same way. A total of 52 plasmids were constructed for the deletion of 26 genes (Supplementary Table 2), with each gene being edited with two editing plasmids that had the same repair template but different spacers (Table 1, Supplementary Table 1). Construction of the Plasmids for hetR/hetN Double Mutation. To construct the hetR (gene id: alr2339) deletion plasmid pCpf1-ΔhetR, the spacer sequence and the homologous repair template were first prepared. To prepare the spacer sequence, equal amounts of two complementary oligonucleotides, cr_alr2339F431F and cr_alr2339F431R, were annealed in the annealing buffer (10 mM Tris, pH 8.0, 50 mM NaCl, 1 mM EDTA) at 65 °C for 10 min. To prepare the homologous repair template, an upstream region (−1051 to 29, positions relative to the start codon of hetR) and a downstream region (741 to 1803) were amplified respectively from Anabaena chromosome with the primer pairs Palr2339F1051mb/ Palr2339R29 and Palr2339F741/Palr2339R1803b. The two fragments, which have a 20 bp overlap, were then fused by overlapping PCR using the oligos Palr2339F1051mb and Palr2339R1803b. The spacer, which had the compatible cohesive ends, was inserted into AarI-linearized pCpf1 by T4 DNA ligase, and subsequently the homologous repair template, was inserted into the intermediate plasmid at the BglII-BamHI site via seamless cloning,43 resulting in the editing plasmid pCpf1-ΔhetR. The hetN (gene id: alr5358) deletion plasmid pCpf1-Sp-ΔhetN was constructed in a similar way except that the spacer sequence was annealed with the oligonucleotides cr_alr5358R279F and cr_alr5358R279R, and the homologous repair template was prepared with the primer pairs Palr5358F1037m/Palr5358R1m and Palr5358F865/ Palr5358R2045. Construction of the Plasmid for Making the Conditional Mutant of polA. To generate the repair template, a region upstream the ribosomal binding site (RBS) of polA (−900 to −38 with respect to the start codon) amplified using the oligonucleotides Palr1254F900m, Palr1254R38m and Priboswitch2 (the 3′-end of Priboswitch2 overlaps with the 5′-end of
Palr1254R38m by 20 bps), and a region downstream the RBS (1 to 825 with respect to the start codon) amplified using the oligonucleotides Palr1254F1 and Palr1254R825 was fused by overlapping PCR using the oligonucleotides Palr1254F900m and Palr1254R825. Note that a theophylline riboswitch (ggtgataccagcatcgtcttgatgcccttggcagcaccctgctaaggaggtaacaacaagatg) was introduced into the repair template through the overlapping PCR. A sequence of two spacers was prepared by annealing the complementary oligonucleotides cr2_alr1254F14mF, cr2_alr1254F14mR, cr1_alr1254R13mF, and cr1_alr1254R13mR. The repair template and the spacer sequence were sequentially cloned into pCpf1 at the sites of BglII-BamHI and AarI−AarI, resulting in the mutation plasmid pCpf1-TRS-polA. Construction of the Plasmid for Large Chromosomal Region Deletion. The plasmid pDel43-V was made for the deletion of a 43 kb region from the Anabaena chromosome; pDel109-SV was for the deletion of a 109 kb region; pDel119V and pDel119-O were for the deletion of a 119 kb region. To construct pDel43-V, the homologous repair template, which was the fusion of the upstream and the downstream regions, respectively, amplified from Anabaena chromosome with the primer pairs Pall2649F158/Pall2649R1158 and Pall2641F1751a/Pall2641R2799, was first inserted into the vector pCpf1-Sp at the BglII-BamHI site via seamless cloning. Then the spacer sequence generated by annealing the complementary oligonucleotides cr1_all2649R1200F and cr2_all2649R1200R was inserted between the two AarI sites by T4 DNA ligase. All other plasmids were constructed in a similar way. For pDel109-SV, the homologous repair template was obtained with the primer pairs Palr2680F7416/Palr2680R8487 and Pall2641F1751b/Pall2641R2799, and the spacers were generated by annealing the complementary oligonucleotides cr1_all2641R1589F, cr1_all2641R1589R, cr2_all2649R1200F, and cr2_all2649R1200R. For pDel119V, the homologous repair template was obtained with the primer pairs Palr2680F7416/Palr2680R8487 and Palr2634F287m/Palr2634R788, and the spacer was generated by annealing the complementary oligonucleotides cr1_all2649R1200F/cr2_all2649R1200R. pDel119-O shared the same homologous repair template with pDel119-V, but it contained a different spacer that was generated by annealing the complementary oligonucleotides cr1_alr2680F7348F and cr2_alr2680F7348R. Construction of Cyanobacterial Strains. The methods of conjugation and exconjugants selection followed a previously described procedure.28,45 For each conjugation, 10 mL of Anabaena cells (OD750 = 0.5) and 10 mL of E. coli DB10B (OD600 = 0.8) carrying pRL433, pRL623, and the editing plasmid were used. Each conjugation was carried out on two BG11 agar plates. When the editing plasmid contained the resistance gene nptII, neomycin was added to a final concentration of 100 μg mL−1 in the conjugation plates; when the editing plasmid contained the resistance gene aadA, 5 μg mL−1 spectinomycin and 2.5 μg mL−1 streptomycin were added in the conjugation plates. Normally, about 50 to 200 colonies could grow up on each plate within 2 weeks when the conjugation plates were incubated under the light intensity of 30 μmol m−2 s−1 at the temperature of 30 °C. The colonies were then streaked on BG11 agar plates containing 25 μg mL−1 neomycin or 2.5 μg mL−1 spectinomycin/1.25 μg mL−1 streptomycin. When the patches became green, their genotypes were examined by two pairs of PCR primers, with one pair for 178
DOI: 10.1021/acssynbio.8b00437 ACS Synth. Biol. 2019, 8, 170−180
Research Article
ACS Synthetic Biology checking if the desired modification had been introduced, and the other pair for checking if any nonmodified chromosomal copy still existed (as exampled in Figure 2, Figure 4, and Figure 5). All the mutation strains of single gene deletion or large region deletion were created in the same way. To make hetR/hetN double mutant by iterative editing, a hetR deletion strain was first created by transferring pCpf1ΔhetR into Anabaena by conjugation (the exconjugants being selected with 100 μg mL−1 neomycin), then hetN deletion was introduced by transferring pCpf1-Sp-ΔhetN into the hetR mutant through conjugation, with the exconjugant being selected with 5 μg mL−1 streptomycin and 2.5 μg mL−1 streptomycin. To make the double mutant by simultaneous editing, pCpf1-ΔhetR and pCpf1-Sp-ΔhetN were cotransferred into Anabaena by conjugation, with the exconjugants being selected with 100 μg mL−1 neomycin, 5 μg mL−1 streptomycin, and 2.5 μg mL−1 streptomycin. To construct the polA conditional mutant, the mutation plasmid pCpf1-TRS-polA was transferred into Anabaena by conjugation, and the exconjugants were selected in the BG11 plates containing 100 μg mL−1 neomycin and 2 mM theophylline, and verified by PCR and Sanger sequencing. Testing the Viability of TRS-polA Strain. The exponentially growing culture of TRS-polA was washed with BG11 and resuspended in the same culture medium to the density of OD700 = 0.5. This cell suspension was used as the starter to make a 4-point serial dilutes (dilution factor = 2) using BG11. Finally, 3 μL of each dilute was spotted onto BG11 plates supplemented with or without 2 mM theophylline, respectively. Anabaena wild type strain was treated in the same way as the control. The plates were incubated in an incubator with illumination (30 °C, 30 μmol m−2 s−1). Pictures were taken when the spots of the most diluted wild type cells became visible. Curing of the Editing Plasmid. The strains having the desired genotypes were subjected to plasmid curing when necessary. The procedure to remove a pCpf1 or pCpf1-Sp derived editing plasmid followed a previously described procedure.21 Briefly, the strain to be cured was grown in antibiotic-free liquid BG11 medium for about 10 generations, then the long filaments of cells were sonicated into single cells or short filaments (less than five cells per filament on average), and the cells were then spread onto the antibiotic-free BG11 plate. The colonies grown up from the plate were examined by PCR to select those that had lost the editing plasmid. For curing a sacB-containing editing plasmid, the edited strain was grown in antibiotic-free liquid BG11 medium for about five generations, then the long filaments were sonicated and spread onto the BG11 plate supplemented with 5% sucrose. The plasmid loss in the cells of the colonies grown up from the sucrose plate was confirmed by PCR.
■
■
verification of the polA conditional mutant by Sanger sequencing (PDF) Oligonucleotides used in this study, information on the 26 genes deleted using the “two-spacers” strategy (XLSX)
AUTHOR INFORMATION
Corresponding Author
*E-mail:
[email protected]. ORCID
Ju-Yuan Zhang: 0000-0003-1421-7537 Author Contributions #
T.-C.N. and G.-M.L. contributed equally to this work. T.-C.N. and G.-M.L. constructed and tested the editing vectors. T.C.N. tested the plasmid curing efficiency of the sacB containing plasmids. G.-M.L. constructed the large genomic region deletion strains. G.-M.L. and L.-R.X. tested the double editing using two editing plasmids. L.-R.X. constructed the conditional mutant strain of polA. Z.-Q.W. and W.-Y.X. performed gene deletion using the “two-spacers” strategy. J.-Y.Z. designed the experiments. J.-Y.Z. and C.-C.Z. analyzed the data and wrote the manuscript. Notes
The authors declare no competing financial interest.
■
ACKNOWLEDGMENTS We thank Dr. Shao-Ran Zhang at Huazhong Agricultural University for insightful discussions about the application of CRISPR systems in cyanobacteria. This work was founded by the Featured Institute Service Projects from the Institute of Hydrobiology, the Chinese Academy of Sciences (Grant No.: Y85Z061601 and Y65Z021501), the Key Research Program of Frontier Sciences of the Chinese Academy of Sciences (Grant No.: QYZDJ-SSW-SMC016), the Recruitment Program of Global Experts of China (Grant No.: Y523011).
■
REFERENCES
(1) Knott, G. J., and Doudna, J. A. (2018) CRISPR-Cas guides the future of genetic engineering. Science 361, 866−869. (2) Shrivastav, M., De Haro, L. P., and Nickoloff, J. A. (2008) Regulation of DNA double-strand break repair pathway choice. Cell Res. 18, 134−147. (3) Rulten, S. L., and Grundy, G. J. (2017) Non-homologous end joining: common interaction sites and exchange of multiple factors in the DNA repair process. BioEssays 39, 1600209. (4) Jinek, M., Chylinski, K., Fonfara, I., Hauer, M., Doudna, J. A., and Charpentier, E. (2012) A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science 337, 816−821. (5) Cong, L., Ran, F. A., Cox, D., Lin, S., Barretto, R., Habib, N., Hsu, P. D., Wu, X., Jiang, W., Marraffini, L. A., and Zhang, F. (2013) Multiplex genome engineering using CRISPR/Cas systems. Science 339, 819−823. (6) Zetsche, B., Gootenberg, J. S., Abudayyeh, O. O., Slaymaker, I. M., Makarova, K. S., Essletzbichler, P., Volz, S. E., Joung, J., van der Oost, J., Regev, A., Koonin, E. V., and Zhang, F. (2015) Cpf1 is a single RNA-guided endonuclease of a class 2 CRISPR-Cas system. Cell 163, 759−771. (7) Jiang, W., Brueggeman, A. J., Horken, K. M., Plucinak, T. M., and Weeks, D. P. (2014) Successful transient expression of Cas9 and single guide RNA genes in Chlamydomonas reinhardtii. Eukaryotic Cell 13, 1465−1469. (8) Jiang, Y., Qian, F., Yang, J., Liu, Y., Dong, F., Xu, C., Sun, B., Chen, B., Xu, X., Li, Y., Wang, R., and Yang, S. (2017) CRISPR-Cpf1
ASSOCIATED CONTENT
S Supporting Information *
The Supporting Information is available free of charge on the ACS Publications website at DOI: 10.1021/acssynbio.8b00437. Microscopic images of the hetR mutant strain, diagram explaining “iterative editing” and “simultaneous editing”, the efficiency of spontaneous loss of editing plasmid by Anabaena cells in antibiotic-free medium, genotype 179
DOI: 10.1021/acssynbio.8b00437 ACS Synth. Biol. 2019, 8, 170−180
Research Article
ACS Synthetic Biology assisted genome editing of Corynebacterium glutamicum. Nat. Commun. 8, 15179. (9) Ferenczi, A., Pyott, D. E., Xipnitou, A., and Molnar, A. (2017) Efficient targeted DNA editing and replacement in Chlamydomonas reinhardtii using Cpf1 ribonucleoproteins and single-stranded DNA. Proc. Natl. Acad. Sci. U. S. A. 114, 13567−13572. (10) Knoot, C. J., Ungerer, J., Wangikar, P. P., and Pakrasi, H. B. (2018) Cyanobacteria: promising biocatalysts for sustainable chemical production. J. Biol. Chem. 293, 5044−5052. (11) Suga, M., Akita, F., Hirata, K., Ueno, G., Murakami, H., Nakajima, Y., Shimizu, T., Yamashita, K., Yamamoto, M., Ago, H., and Shen, J. R. (2015) Native structure of photosystem II at 1.95 Å resolution viewed by femtosecond X-ray pulses. Nature 517, 99−103. (12) Herrero, A., Stavans, J., and Flores, E. (2016) The multicellular nature of filamentous heterocyst-forming cyanobacteria. FEMS Microbiol. Rev. 40, 831−854. (13) Hu, B., Yang, G., Zhao, W., Zhang, Y., and Zhao, J. (2007) MreB is important for cell shape but not for chromosome segregation of the filamentous cyanobacterium Anabaena sp. PCC 7120. Mol. Microbiol. 63, 1640−1652. (14) Zheng, X. Y., and O’Shea, E. K. (2017) Cyanobacteria maintain constant protein concentration despite genome copy-number variation. Cell Rep. 19, 497−504. (15) Jiang, W., Bikard, D., Cox, D., Zhang, F., and Marraffini, L. A. (2013) RNA-guided editing of bacterial genomes using CRISPR-Cas systems. Nat. Biotechnol. 31, 233−239. (16) Altenbuchner, J. (2016) Editing of the Bacillus subtilis genome by the CRISPR-Cas9 system. Appl. Environ. Microbiol. 82, 5421− 5427. (17) Huang, H., Zheng, G., Jiang, W., Hu, H., and Lu, Y. (2015) One-step high-efficiency CRISPR/Cas9-mediated genome editing in Streptomyces. Acta Biochim. Biophys. Sin. 47, 231−243. (18) Wang, Y., Zhang, Z. T., Seo, S. O., Lynn, P., Lu, T., Jin, Y. S., and Blaschek, H. P. (2016) Bacterial genome editing with CRISPRCas9: deletion, integration, single nucleotide modification, and desirable ″Clean″ mutant selection in Clostridium beijerinckii as an example. ACS Synth. Biol. 5, 721−732. (19) Li, H., Shen, C. R., Huang, C. H., Sung, L. Y., Wu, M. Y., and Hu, Y. C. (2016) CRISPR-Cas9 for the genome engineering of cyanobacteria and succinate production. Metab. Eng. 38, 293−302. (20) Wendt, K. E., Ungerer, J., Cobb, R. E., Zhao, H., and Pakrasi, H. B. (2016) CRISPR/Cas9 mediated targeted mutagenesis of the fast growing cyanobacterium Synechococcus elongatus UTEX 2973. Microb. Cell Fact. 15, 115. (21) Ungerer, J., and Pakrasi, H. B. (2016) Cpf1 is a versatile tool for CRISPR genome editing across diverse species of cyanobacteria. Sci. Rep. 6, 39681. (22) Buikema, W. J., and Haselkorn, R. (1991) Characterization of a gene controlling heterocyst differentiation in the cyanobacterium Anabaena 7120. Genes Dev. 5, 321−330. (23) Yoon, H. S., and Golden, J. W. (1998) Heterocyst pattern formation controlled by a diffusible peptide. Science 282, 935−938. (24) Koksharova, O. A., and Wolk, C. P. (2002) A novel gene that bears a DnaJ motif influences cyanobacterial cell division. J. Bacteriol. 184, 5524−5528. (25) Swiat, M. A., Dashko, S., den Ridder, M., Wijsman, M., van der Oost, J., Daran, J. M., and Daran-Lapujade, P. (2017) FnCpf1: a novel and efficient genome editing tool for Saccharomyces cerevisiae. Nucleic Acids Res. 45, 12585−12598. (26) Callahan, S. M., and Buikema, W. J. (2001) The role of HetN in maintenance of the heterocyst pattern in Anabaena sp. PCC 7120. Mol. Microbiol. 40, 941−950. (27) Orozco, C. C., Risser, D. D., and Callahan, S. M. (2006) Epistasis analysis of four genes from Anabaena sp. strain PCC 7120 suggests a connection between PatA and PatS in heterocyst pattern formation. J. Bacteriol. 188, 1808−1816. (28) Cai, Y. P., and Wolk, C. P. (1990) Use of a conditionally lethal gene in Anabaena sp. strain PCC 7120 to select for double
recombinants and to entrap insertion sequences. J. Bacteriol. 172, 3138−3145. (29) Lehman, I. R., Bessman, M. J., Simms, E. S., and And Kornberg, A. (1958) Enzymatic synthesis of deoxyribonucleic acid. I. Preparation of substrates and partial purification of an enzyme from Escherichia coli. J. Biol. Chem. 233, 163−170. (30) Okazaki, R., Arisawa, M., and Sugino, A. (1971) Slow joining of newly replicated DNA chains in DNA polymerase I-deficient Escherichia coli mutants. Proc. Natl. Acad. Sci. U. S. A. 68, 2954−2957. (31) Sharma, R. C., and Smith, K. C. (1987) Role of DNA polymerase I in postreplication repair: a reexamination with Escherichia coli delta polA. J. Bacteriol. 169, 4559−4564. (32) Duigou, S., Ehrlich, S. D., Noirot, P., and Noirot-Gros, M. F. (2005) DNA polymerase I acts in translesion synthesis mediated by the Y-polymerases in Bacillus subtilis. Mol. Microbiol. 57, 678−690. (33) De Lucia, P., and Cairns, J. (1969) Isolation of an E. coli strain with a mutation affecting DNA polymerase. Nature 224, 1164−1166. (34) Bayliss, C. D., van de Ven, T., and Moxon, E. R. (2002) Mutations in polI but not mutSLH destabilize Haemophilus inf luenzae tetranucleotide repeats. EMBO J. 21, 1465−1476. (35) Fukushima, S., Itaya, M., Kato, H., Ogasawara, N., and Yoshikawa, H. (2007) Reassessment of the in vivo functions of DNA polymerase I and RNase H in bacterial cell growth. J. Bacteriol. 189, 8575−8583. (36) Nakahira, Y., Ogawa, A., Asano, H., Oyama, T., and Tozawa, Y. (2013) Theophylline-dependent riboswitch as a novel genetic tool for strict regulation of protein expression in Cyanobacterium Synechococcus elongatus PCC 7942. Plant Cell Physiol. 54, 1724−1735. (37) Ma, A. T., Schmidt, C. M., and Golden, J. W. (2014) Regulation of gene expression in diverse cyanobacterial species by using theophylline-responsive riboswitches. Appl. Environ. Microbiol. 80, 6704−6713. (38) Standage-Beier, K., Zhang, Q., and Wang, X. (2015) Targeted large-scale deletion of bacterial genomes using CRISPR-nickases. ACS Synth. Biol. 4, 1217−1225. (39) Zhao, D., Feng, X., Zhu, X., Wu, T., Zhang, X., and Bi, C. (2017) CRISPR/Cas9-assisted gRNA-free one-step genome editing with no sequence limitations and improved targeting efficiency. Sci. Rep. 7, 16624. (40) Hong, W., Zhang, J., Cui, G., Wang, L., and Wang, Y. (2018) Multiplexed CRISPR-Cpf1-Mediated genome editing in Clostridium dif ficile toward the understanding of pathogenesis of C. diff icile infection. ACS Synth. Biol. 7, 1588−1600. (41) Jeanjean, R., Talla, E., Latifi, A., Havaux, M., Janicki, A., and Zhang, C. C. (2008) A large gene cluster encoding peptide synthetases and polyketide synthases is involved in production of siderophores and oxidative stress response in the cyanobacterium Anabaena sp. strain PCC 7120. Environ. Microbiol. 10, 2574−2585. (42) Stanier, R. Y., Kunisawa, R., Mandel, M., and Cohen-Bazire, G. (1971) Purification and properties of unicellular blue-green algae (order Chroococcales). Bacteriol. Rev. 35, 171−205. (43) Benoit, R. M., Ostermeier, C., Geiser, M., Li, J. S., Widmer, H., and Auer, M. (2016) Seamless Insert-Plasmid assembly at high efficiency and low cost. PLoS One 11, No. e0153158. (44) Prentki, P., and Krisch, H. M. (1984) In vitro insertional mutagenesis with a selectable DNA fragment. Gene 29, 303−313. (45) Elhai, J., Vepritskiy, A., Muro-Pastor, A. M., Flores, E., and Wolk, C. P. (1997) Reduction of conjugal transfer efficiency by three restriction activities of Anabaena sp. strain PCC 7120. J. Bacteriol. 179, 1998−2005.
180
DOI: 10.1021/acssynbio.8b00437 ACS Synth. Biol. 2019, 8, 170−180
