Experimental and Theoretical Data on the Mechanism by Which Red

Article pubs.acs.org/JAFC

Experimental and Theoretical Data on the Mechanism by Which Red Wine Anthocyanins Are Transported through a Human MKN-28 Gastric Cell Model Hélder Oliveira,† Iva Fernandes,*,† Natércia F. Brás,‡ Ana Faria,†,#,⊥ Victor De Freitas,† Conceiçaõ Calhau,#,∥ and Nuno Mateus† †

REQUIMTE/LAQV and ‡REQUIMTE/UCIBIO, Department of Chemistry and Biochemistry, Faculty of Sciences, University of Porto, 4169-007 Porto, Portugal # Department of Biochemistry (U38-FCT), Faculty of Medicine, University of Porto, 4200-319 Porto, Portugal ⊥ Faculty of Nutrition and Food Sciences, University of Porto, 4200-465 Porto, Portugal ∥ CINTESIS Center for Research in Health Technologies and Information Systems, Faculty of Medicine, University of Porto, 4200-450 Porto, Portugal S Supporting Information *

ABSTRACT: The gastric absorption of red wine anthocyanins was evaluated using a gastric MKN-28 cell barrier model. Anthocyanin transport was not affected by the presence of 4% ethanol and decreased with the increase of pH. Gastric cells pretreated with anthocyanins were found to increase anthocyanin transport. The presence of D-(+)-glucose was found to decrease anthocyanin uptake, suggesting the involvement of glucose transporters. RT-PCR assays revealed that GLUT1, GLUT3, and MCT1 transporters were expressed in MKN-28 cells. Computational studies were performed to provide a structural characterization of the binding site of hGLUT1 to glucose or different anthocyanins under different forms. Docking results demonstrated that anthocyanins can bind to glucose transporters from both intracellular and extracellular sides. Anthocyanins seem to enter into the transporter by two main conformations: B ring or glucose. From MD simulations, hGLUT1 was found to form complexes with all anthocyanins tested in the different protonation states. KEYWORDS: dynamic rearrangements, gastric absorption, MKN-28, anthocyanins, wine

■

Some of the animal models used include rat6 and porcine gastric mucosa,7 this latter being the most similar model to human. Primary cultures of guinea pig gastric mucous epithelial cells8 and one human gastric cancer cell line, NCI-N87,9 are the only available cell line models. Some food phenolics can be absorbed from cultured gastric epithelial monolayers10,11 or rat stomach.6,12−14 Likewise, anthocyanins can also be absorbed in rat stomach or human gastric cell models.5,15−17 The possible involvement of bilitranslocase in the gastric transport was previously proposed, but the in vitro studies were conducted at pH 7.2,18 hence, with anthocyanin forms that are not likely to be present in the acidic conditions of the stomach.19 Although some evidence concerning polyphenols gastric absorption is already published, the main results were obtained with rats, so the human mechanism involved in the gastric absorption is still mostly unknown. On this matter, and as a result of the previously rapid plasma appearance of anthocyanins, it is crucial to understand their gastric bioavailability within a wine matrix and also understand

INTRODUCTION Several epidemiological studies have shown the positive association of red wine ingestion with human health benefits. A moderate daily consumption of red wine has been proposed to contribute to the lower incidence of coronary heart disease in France despite the ingestion of high levels of saturated fat.1 Additional epidemiological studies from diverse populations have revealed that individuals who usually consume moderate amounts of wine experience a 20−30% reduction in all-cause mortality, particularly cardiovascular mortality.2,3 There is growing evidence from studies performed in animals and humans that supports a connection between regular moderate wine drinking and improved health. The beneficial effect of red wine has been attributed to the presence of polyphenolic compounds including anthocyanins. Although their consumption may easily reach 200 mg per day, the bioavailability of anthocyanins at the intestinal level has been reported to be quite low ( 150 Ω·cm2 (determined at 37 °C). In transport experiments HBSS, pH 7.4, was the main component of the basolateral medium. In the gastric cell model the apical medium was acidified to 5.0 by adding solid 2-(N-morpholino)ethanesulfonic acid (MES) to give a concentration of 25 mM and then adjusting the pH with 5 M HCl. Medium was removed and cells were washed with Hanks’ medium, pH 7.4. Compound solution in Hanks, with a final concentration of 50 μg/mL, was added to the apical side of the cells and Hanks containing 2% FBS was added to the basolateral compartment. Transepithelial transport was followed as a function of time. A total of 150 μL was taken from the basolateral side and replaced by fresh medium (Hanks containing 2% FBS) at 30, 60, and 120 min of incubation and also at 180 min for the MKN-28 cell line. Each time sample (150 μL) was acidified with HCl to a final concentration of 0.06 M. All samples, from both apical and basolateral sides, were acidified and frozen (−18 °C) to ensure that the cumulative amounts of each compound that were later quantified were not altered during sample delay until uHPLC analysis. Red wine anthocyanins were quantified using the malvidin-3-glucoside calibration curve Abs (520 nm) = 8.725 × concn (μM), R2 = 0.9789.

Table 1. Sequences (Forward and Reverse) and Annealing Temperature (AT) for Each Primer transporter

primer

GLUT1

forward reverse

GLUT2

forward reverse

GLUT3

forward reverse

sequence

AT (°C)

5′ GAT GAT GCG GGA GAA GAA GGT 3′ 5′ ACA GCG TTG ATG CCA GAC AG 3′

65

5′ CAG GAC TAT ATT GTG GGC TAA 3′ 5′ CTG ATG AAA AGT GCC AAG T 3′

65

5′ CTT CCC CTC CGC TGC TCA CTA 3′ 5′ CAA AAG TCC TGC CAC GGG TCT 3′

64

SGLT1

forward reverse

5′ TGG CAA TCA CTG CCC TTT A 3′ 5′ TGC AAG GTG TCC GTG TAA AT 3′

60

hMCT1

forward

5′ CAC CGT ACA GCA ACT ATA CG 3′ 5′ CAA TGG TCG CCT CTT GTA GA 3′

60

5′ CTC CCG GTG TTC TAC AAA CTG 3′ 5′ GGG CAG GGG CAT AAA TAA C 3′

65

reverse

hSMCT1

forward reverse

Diagnostics, USA). Cycling conditions were as follows: denaturation (95 °C for 10 min), amplification and quantification (95 °C for 10 s, annealing temperature (AT) for 10 s, and 72 °C for 10 s, with a single fluorescence measurement at the end of the 72 °C for 10 s segment) repeated for 45 cycles, and a final melting at 95 °C 10 s, 65 °C 60 s, and 97 °C for 1 s. The following human-specific primers were used: HPRT-1 (AT = 59 °C) sense 5′ TGCTGACCTGCTGGATTACA 3′ and antisense 5′ TTTATGTCCCCTGTTGACTGG 3′. Data were analyzed using LightCycler 96 SW analysis software v1.1. The Cq values obtained were transformed into relative quantification data using 2(−ΔCq).20 Anthocyanin/GLUT1 Computational Methods. Two crystallographic structures, extracted from the Protein DataBank (PDB), were B

DOI: 10.1021/acs.jafc.5b00412 J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Article

Journal of Agricultural and Food Chemistry used: (i) an outward-facing conformation of Escherichia coli’s D-xylose:, H1 symporter (XylE) complexed with D-glucose (PDB code 4GBZ, resolution = 2.89 Å); and (ii) an inward-facing conformation of the human GLUT1 (hGLUT1) receptor (PDB code 4PYP, resolution = 3.17 Å).21 The former structure is a homologue to the well-known human glucose transporters GLUT1−4. All of these receptors contain a typical major facilitator superfamily fold of 12 transmembrane segments (TMs), with amino and carboxy termini both located on the intracellular side. The 12 TMs are organized into three distinct domainsthe N, C, and ICH domains. TM7 and TM10 belonging to the C domain are both discontinuous helices, which may facilitate conformational changes during substrate transport.22 Molecular docking studies were conducted with three different anthocyanins (Cy3glc, Dp3glc, and Mv3glc) in hemiketal, flavilium cation, and anionic quinoidal base forms. The structures were modeled with the GaussView software (Carnegie Office Park Gaussian Inc., Pittsburgh, PA, USA). The receptor PDB structures were protonated with the X-Leap tool of the AMBER 12.0 software,23 considering their physiological protonation state. The docking procedure was performed with VsLab24 that uses the Autodock software.25 A total of 50 poses were generated, employing a genetic algorithm. The docking pocket was defined by the AutoGrid tool. The box dimensions were 23.2 × 20.6 × 21.7 Å. The docking structures were ranked energetically, and the best scores were taken as starting structures for the subsequent molecular dynamics (MD) simulations. In the MD simulations, the receptors were parametrized with the ff99SB force field from the AMBER software. The parameters for the anthocyanins were derived following a standard protocol26 using the Antechamber module.27 The parameters were derived from the GAFF force field,28 and atomic single-point charges were calculated using the Gaussian 09 software29 and employing the RESP algorithm.30 The MD simulations were performed with the AMBER 12.0 software. Counter ions were added to neutralize the overall charge of the system. The X-Leap program was used for this purpose. An explicit solvation model with TIP3P water molecules was used, filling a truncated rectangular box with a minimum of 12 Å distance between the box edges and the model. Each structure was minimized in two stages. Subsequently, a 100 ps equilibration followed by a 25 ns production MD simulation was carried out. The Langevin temperature equilibration scheme was used to maintain the temperature at 310.15 K,31 and periodic boundary conditions were imposed. Bond lengths involving hydrogen atoms were constrained using the SHAKE algorithm,32 and the equations of motion were integrated with a 2 fs time step using the Verlet leapfrog algorithm. The particle-mesh Ewald (PME) method was used to treat long-range interactions,33 and the nonbonded interactions were truncated with a 10 Å cutoff. All of the MD results were analyzed with the Ptraj module of Amber 12.0. Statistical Analysis. All values are expressed as the arithmetic means ± SEM. Statistical significance of the difference between various treatments was evaluated by two-way analysis of variance (ANOVA) and by one-way analysis of variance between each group for the different incubation times, followed by the Bonferroni’s correction for multiple comparisons. Differences were considered to be statistically significant (*) when p < 0.05.

■

absorption also deserves investigation because these compounds are consumed as part of a normal diet. In particular, red wine is composed by a complex mixture of polyphenols (anthocyanins, tannins, catechins, etc.), alcohol, and monosaccharides (glucose and frutose), so it is not surprising that the total anthocyanin absorption may be affected by some of these parameters. All transport experiments were performed in a transwell plate system introducing the Hanks buffer, pH 5, in which the wine extract (50 μg/mL) was previously dissolved, in the donor chamber. The Hanks buffer, 2% SFB and pH 7.4, was placed in the receptor chamber. At predetermined intervals, aliquots of 150 μL were removed from the basolateral chamber and analyzed by HPLC-DAD. The anthocyanin profile of the red wine extract used is composed by six main anthocyanins (Figure 1).

Figure 1. HPLC chromatogram of the red wine extract recorded at 520 nm. Peaks: 1, delphinidin-3-O-glucoside (Dp3glc); 2, petunidin-3O-glucoside (Pt3glc); 3, peonidin-3-O-glucoside (Pn3glc); 4, malvidin3-O-glucoside (Mv3glc); 5, malvidin-3-O-acetylglucoside (Mv3actglc); 6, malvidin-3-O-coumaroylglucoside (Mv3cumglc).

All anthocyanins present in the apical side of the transwell insert were detected in the basolateral side of this gastric barrier (data not shown). Considering the ingestion of a glass of red wine containing 12% alcohol (v/v), this ethanol percentage will suffer a dilution within the gastric fluids, so the influence of 4% may be considered likely reliable in vivo. The effect of DMSO (wine stock solution solvent) and 4% ethanol (individually or coadministered) on the monolayer TEER was assayed. No effect was observed on cell viability or on monolayer integrity (data not shown). In the presence of 4% ethanol no significant differences were observed in the transport efficiency of the total wine anthocyanins (Figure 2). There are some studies referring to anthocyanins that claim no influence of ethanol on their intestinal absorption34,35 The increase in the apical pH for values around 7.4 (similar to intestinal conditions) was associated with a reduction in the transport efficiency with statistical difference after 180 min

RESULTS AND DISCUSSION

Gastric Transport of Red Wine Anthocyanins. A human adenocarcinoma gastric cell line, MKN-28, was previously developed as a model of human gastric barrier, useful for examining mechanisms of nutraceuticals transport. The transport of anthocyanins was studied in this cell model, and it could be concluded that their transport efficiency increases with incubation time, although no differences were observed among the three anthocyanins studied (Dp3glc, Cy3glc, and Mv3glc).16 Besides the importance that this barrier has for anthocyanins due to their rapid appearance in plasma, the possible interference of food components in anthocyanin gastric C


Article

Journal of Agricultural and Food Chemistry

Figure 2. Transport efficiency of total red wine anthocyanins through MKN-28 barrier (apical → basolateral). The experiments were conducted with apical pH 5.0 and basolateral pH 7.4, unless otherwise indicated. The influence of 4% ethanol, pretreatment with red wine anthocyanins (3 h at third and fifth growing days), and apical pH (pH 5 vs 7.4) on total red wine transport efficiency was determined. Results are presented as transport efficiency (%) (mean ± SEM). Transport efficiency percentages were calculated as (compound concentrations at the basolateral side over time)/(compound concentrations at the apical side at 0 h) × 100. Significantly different from control for the same incubation time: ∗, p < 0.05; ∗∗, p < 0.01; ∗∗∗, p < 0.001. Significantly different between the different incubation times: #, p < 0.001.

Figure 3. Transport efficiency of total red wine anthocyanins through MKN-28 barrier (apical → basolateral) in the presence of 20−500 mM D-glucose. Results are presented as transport efficiency (%) (mean ± SEM). Transport efficiency percentages were calculated as (compound concentrations at the basolateral side over time)/ (compound concentrations at the apical side at 0 h) × 100. Significantly different from control for the same incubation time: ∗, p < 0.05; ∗∗, p < 0.01; ∗∗∗, p < 0.001. Significantly different between the different incubation times: #, p < 0.001.

This will be studied by using a theoretical approach, as further discussed. Characterization of Transporters Expression in MKN28 Cell Line. Monocarboxylated transporter and organic anion transporter are expressed in intestine and liver but also in stomach.36 To explore the possible involvement of transporters in the absorption across MKN-28, the expression of some transporters was evaluated by RT-PCR. It was concluded that not only MKN-28 expresses glucose transporters 1 (GLUT1) and 3 (GLUT3) but also monocarboxylated transporter 1 (MCT1) (Figure 4). The expression of glucose transporter 2 (GLUT2), sodium-coupled monocarboxylated transporter 1 (SMCT1), and sodium−glucose transporter 1 (SGLT1) was not observed. Molecular Docking on XylE and hGLUT1 Receptors. A molecular docking of Cy3glc, Dp3glc, and Mv3glc on hemiketal, flavilium cation, and anionic quinoidal base forms against GLUT transporters was performed. Because the X-ray structure of XylE was complexed with a glucose (glc) molecule, a docking procedure using this unit was first performed to validate the protocol. Figure S1 in the Supporting Information (SI) shows the superimposition between the best docking result and the crystallographic geometry, in which a high similarity in the glc pose is observed with a root-mean-square deviation (RMSd) of 2.03 Å. This small RMSd value and the negative ΔG binding obtained for glucose (−6.6 kcal/mol) validates this docking procedure. A similar process was applied to dock all anthocyanins into the XylE receptor. The values of ΔG binding obtained for all molecules are presented in Table 2. We observe that all negative free binding energy values were compatible with a favorable association between the polyphenols and XylE. Although all free energy values are similar, it was observed that the Cy3glc and Dp3glc molecules interact more strongly with the receptor than Mv3glc. This may be justified by the high number of hydroxyl groups present in the first two anthocyanins, which can establish strong hydrogen-bond interactions with the amino acids of the periplasmic side of the receptor. It is also possible to see that all docking solutions of hemiketal forms bind to the periplasmic side of XylE by glucose

(Figure 2). This result highlights the importance of pH on the anthocyanin transport efficiency that may be related not only to the main anthocyanin forms present but also to the influence on the possible transporters involved in their transport. For the pretreatment study, transwell cells were incubated during 3 h with red wine anthocyanins (with the same concentration applied on the seventh day) at the third and fifth days postplating. After that incubation, the apical and basolateral medis were renewed. The pretreatment of the transwell system with anthocyanins during cell growth resulted in an increase in anthocyanin uptake for values above 30 min of incubation (Figure 2). This result may be associated with a cellular adaptation to the presence of anthocyanins that could induce, for instance, an increase in the expression of some type of transporters. Effect of D -(+)-Glucose. To evaluate the possible implication of glucose transporters in anthocyanin absorption, a range of glucose concentrations (5.5−500 mM) were coadministered to the apical side of the transwell system. According to the results obtained, for concentrations >40 mM glucose, the transport efficiency of anthocyanins is significantly decreased, remaining constant and around 1% during the 3 h of incubation time (Figure 3). This decrease in anthocyanin uptake may result from a competition for the same transporter. In fact, the presence of glucose in the anthocyanin moiety may account for the selective interaction between GLUTs and anthocyanins. To test the possible implication of glucose transporters in anthocyanin absorption, besides adding their natural substrate, the effects of a glucose transporter inhibitor, cytocalasin B (50 μM), were also evaluated. For incubation time >60 min, the anthocyanins transport was significantly reduced (Figure 2). A similar behavior was observed in a previously work with the Caco-2 cell line.4 However, this is not the only molecular determining factor because all anthocyanin forms have glucose in their constitution, and it was seen that anthocyanin uptake was reduced by pH, which alters the anthocyanidin moiety and makes anthocyanin’s access to the transporter core difficult. D


Article


Figure 5. General structures of anthocyanins in flavylium cation, hemiketal, and anionic quinoidal base forms. R1 and R2 = H, OH, or OCH3.

proposal for the molecular mechanism by which the anthocyanins cross the cellular membrane through hGLUT receptors. Figure 7 shows the main residues involved in the binding of anthocyanins to hGLUT1 receptor in both conformations (considering the corresponding residues of the outward-open form of XylE). In the literature, it was proposed that only the C domain is implied in the association of glucose to both XylE and hGLUT1, whereas the N domain works as a secondary place.21,22 However, these docking results show that the residues involved in the binding of anthocyanins to hGLUT1 belong to both C and N domains. This could be explained due to the larger size of anthocyanins compared to glucose. Molecular Dynamics (MD) Simulations. The two best docking solutions (S1 and S2) for each anthocyanin, in the three different protonation states, bound to the inward-open hGLUT1 were used as starting structures for the subsequent MD simulations. These two solutions were chosen because the anthocyanins can interact with the binding pocket by different groups (AC, B, or glc units). The unique exception was the Mv3glc hemiketal, in which the binding modes observed in S1 and S2 were very similar. Hence, MD simulations of 25 ns were carried out for the 17 different hGLUT1−anthocyanin complexes. The analysis of the results revealed that all anthocyanins remained in the binding pocket throughout the simulations. Figure S2 in the SI shows the superimposition of the initial pose and the average pose along the MD simulation for Cy3glc flavilium cation, in which we can see that both poses are similar. The same was observed for the other complexes. The RMSd values for the protein backbone complexed with the

Figure 4. Transporter expression in MKN-28 cell line evaluated by qRT-PCR: glucose transporters 1 (GLUT1), 2 (GLUT2), and 3 (GLUT3), monocarboxylated transporter 1 (MCT1), sodium-coupled monocarboxylated transporter 1 (SMCT1); and sodium−glucose transporter 1 (SGLT1).

or the B ring, which suggests that both units have a key role in the entrance of anthocyanins. However, the flavilium cation form of anthocyanins appears to enter on XylE mainly by the AC moiety (Figure 5). This could be explained by the positive charge present in the C ring that is not found in the other forms. Table 3 shows the values of ΔG binding obtained from the docking of the same anthocyanin molecules to the hGLUT1. In all protonation states, the AC moiety of anthocyanins is the one that interacts more deeply with the inward-facing conformation of hGLUT1. This fact reinforces the entrance by the opposite side (B and Glc groups) previously observed for the outwardfacing conformation. These results suggest that there are two main conformations of anthocyanins during their entrance from the extracellular side to the outward-facing receptor, which implies that these compounds access the intracellular side mainly by the AC group. To summarize this, Figure 6 shows a

Table 2. Values of ΔGbinding Obtained for the Anthocyanins Docked to the XylE Receptora ligand

ΔGbinding (kcal/mol)

internal group

ligand


internal group

ligand


internal group

hemiketal Cy S1 hemiketal Cy S2

−9.07 −8.03

B ring B ring

cation Cy S1 cation Cy S2

−9.46 −9.45

B ring AC ring

anion Cy S1 anion Cy S2

−9.18 −8.22

AC ring B ring

hemiketal Dp S1 hemiketal Dp S2

−8.13 −7.09

Glc B ring

cation Dp S1 cation Dp S2

−8.85 −8.41

AC ring Glc

anion Dp S1 anion Dp S2

−8.49 −7.87

AC ring Glc

hemiketal Mv S1 hemiketal Mv S2

−7.36 −6.35

Glc Glc

cation Mv S1 cation Mv S2

−8.99 −8.09

AC ring Glc

anion Mv S1 anion Mv S2

−8.55 −7.43

AC ring Glc

a

The most internal group of the polyphenols reaching the receptor is also depicted. S1 and S2 are the two best solutions obtained from the docking protocol. E


Article

Journal of Agricultural and Food Chemistry Table 3. Values of ΔGbinding Obtained for the Anthocyanins Docked to the hGLUT1 Receptora ligand


internal group

ligand


internal group

ligand


internal group

hemiketal Cy S1 hemiketal Cy S2

−11.71 −10.26

AC ring AC ring

cation Cy S1 cation Cy S2

−10.96 −10.01

AC ring AC ring

anion Cy S1 anion Cy S2

−10.78 −9.86

B ring AC ring

hemiketal Dp S1 hemiketal Dp S2

−11.84 −10.11

AC ring Glc

cation Dp S1 cation Dp S2

−11.04 −9.94

AC ring AC ring

anion Dp S1 anion Dp S2

−10.77 −9.55

AC ring B ring

hemiketal Mv S1 hemiketal Mv S2

−10.39 −9.69

Glc B ring

cation Mv S1 cation Mv S2

−9.35 −9.34

AC ring AC ring

anion Mv S1 anion Mv S2

−9.56 −8.55

AC ring B ring

a

The most internal group of the polyphenols reaching the receptor is also depicted. S1 and S2 are the two best solutions obtained from the docking protocol.

the average structure over the whole simulation, the root-meansquare fluctuation (RMSf) values were also calculated for the protein, by residue, and are shown in Figure S4 in the SI. It was possible to observe an RMSf pattern conserved in all complexes. All of the residues within the binding pocket showed a minimal flexibility, which suggests that they maintain a rigid position during the simulation to reinforce the strong interaction with the several anthocyanins tested. Structural information on the hGLUT1 binding pocket, in particular the hydrogen bonds established between the anthocyanins and the neighboring residues, were analyzed and are shown in Table S1. The van der Waals contacts established between the polyphenolic rings and the aliphatic side chains are also presented. It was seen that the main hydrogen bonds occur between the hydroxyl groups of anthocyanins and the side chains of Glu380, Asn317, Asn411, Asn415, Tyr292, and Thr30 residues. The major moiety of all anthocyanins involved in hydrogen-bond interactions seems to be glucose, which emphasizes its key role in anthocyanins transport. We have verified the presence of many hydrophobic interactions (stacking effect of π−π interactions) between the rings of anthocyanins and the high number of aromatic residues present in the periplasmic side of hGLUT1 (Phe379, Trp412, Trp388, Phe72, Phe291, His160). Figure S5 in the SI exemplifies the main hydrophilic and hydrophobic interactions established between the hemiketal Cy3glc and the residues of hGLUT1. All of these interactions strongly contribute to the high stability of the complex formed between the anthocyanins and hGLUT1. Interestingly, Glu380 is the one that interacts with all anthocyanins by one of the shortest hydrogen bonds and has a high time occupancy during the MD simulations, which suggests that this residue has a key role in anthocyanin transport. This result agrees with the proposal by Deng et al.21 The number of water molecules within the periplasmic side of hGLUT1 during each MD simulation was also determined. The average numbers of water molecules within a radius of 3 and 5 Å around each anthocyanin were 6 and 9, which confirms that the binding pocket is highly accessible to the solvent. This solvation effect facilitates the binding of anthocyanins because they are highly water-soluble pigments. These results obtained through computational studies do not superimpose with those obtained experimentally. Indeed, they show that all three forms of anthocyanins have similar affinities to hGLUT1, whereas a decrease of anthocyanin uptake was observed experimentally at pH 7.4. The information yielded from the theoretical studies constitutes very useful data to mechanistically understand the affinity between anthocyanins and glucose transporters. Nevertheless, other variables such as

Figure 6. Proposal for the molecular mechanism by which the anthocyanins cross the cellular membrane through GLUT receptors.

Figure 7. Representation of the main residues involved in the binding of anthocyanins to the hGLUT1 receptor. Cy3glc is represented with lines and colored in red; N, C, and ICH are represented in cartoons and colored in green, blue, and yellow, respectively; residues from N and C are represented in sticks and colored in black and orange, respectively.

anthocyanins during the MD simulations are represented in Figure S3 in the SI. It can be observed that these RMSd values are quite small (oscillating between 1.5 and 2.5 Å), which reveals the higher stability of the complexes. To obtain a measure of the movement of a subset of the system relative to F


Article


(13) Crespy, V.; Morand, C.; Besson, C.; Manach, C.; Demigne, C.; Remesy, C. Quercetin, but not its glycosides, is absorbed from the rat stomach. J. Agric. Food Chem. 2001, 50, 618−621. (14) Murota, K.; Terao, J. Quercetin appears in the lymph of unanesthetized rats as its phase II metabolites after administered into the stomach. FEBS Lett. 2005, 579, 5343−5346. (15) El Mohsen, M. A.; Marks, J.; Kuhnle, G.; Moore, K.; Debnam, E.; Srai, S. K.; Rice-Evans, C.; Spencer, J. P. E. Absorption, tissue distribution and excretion of pelargonidin and its metabolites following oral administration to rats. Br. J. Nutr. 2006, 95, 51−58. (16) Fernandes, I.; De Freitas, V.; Reis, C.; Mateus, N. A new approach on the gastric absorption of anthocyanins. Food Funct. 2012, 3, 508−516. (17) He, J.; Wallace, T. C.; Keatley, K. E.; Failla, M. L.; Giusti, M. M. Stability of black raspberry anthocyanins in the digestive tract lumen and transport efficiency into gastric and small intestinal tissues in the rat. J. Agric. Food Chem. 2009, 57, 3141−3148. (18) Passamonti, S.; Vrhovsek, U.; Mattivi, F. The interaction of anthocyanins with bilitranslocase. Biochem. Biophys. Res. Commun. 2002, 296, 631−636. (19) Fernandes, I.; Faria, A.; Calhau, C.; de Freitas, V.; Mateus, N. Bioavailability of anthocyanins and derivatives. J. Funct. Foods 2014, 7, 54−66. (20) Schmittgen, T. D.; Kenneth, J. L. Analyzing real-time PCR data by the comparative CT method. Nat. Protoc. 2008, 3, 1101−1108. (21) Deng, D.; X, C.; Sun, P.; Wu, J.; Yan, C.; Hu, M.; Yan, N. Crystal structure of the human glucose transporter GLUT1. Nature 2014, 510, 121−125. (22) Sun, L.; Zeng, X.; Yan, C.; Sun, X.; Gong, X.; Rao, Y.; Yan, N. Crystal structure of a bacterial homologue of glucose transporters GLUT1−4. Nature 2012, 490, 361−369. (23) Case, D. A.; Darden, T. A.; Cheatham, T. E.; Simmerling, C. L.; Wang, J.; Duke, R. E.; Luo, R.; Walker, R. C.; Zhang, W.; Merz, K. M.; Roberts, B.; Hayik, S.; Roitberg, A.; Seabra, G.; Swails, J.; Goetz, A. W.; Kolossváry, I.; Kollman, P. A. AMBER 2012, 2012. (24) Cerqueira, N. M. F. S. A.; Ribeiro, J.; Fernandes, P. A.; Ramos, M. J. VsLab − an implementation for virtual high-throughput screening using AutoDock and VMD. Int. J. Quantum Chem. 2011, 111, 1208−1212. (25) Morris, G. M.; Huey, R.; Lindstrom, W.; Sanner, M. F.; Belew, R. K.; Goodsell, D. S.; Olson, A. J. AutoDock 4.2. J. Comput. Chem. 2009, 16, 2785−2791. (26) Brás, N. F.; G, R.; Fernandes, P. A.; Mateus, N.; Ramos, M. J.; De Freitas, V. Understanding the binding of procyanidins to pancreatic elastase by experimental and computational methods. Biochemistry 2010, 49, 5097−5108. (27) Wang, J.; Wang, W.; Kollman, P. A.; Case, D. A. Automatic atom type and bond type perception in molecular mechanical calculations. J. Mol. Graphics Modell. 2006, 26, 247−260. (28) Wang, J.; Wolf, R. M.; Caldwell, J. W.; Kollman, P. A.; Case, D. A. Development and testing of a general AMBER force field. J. Comput. Chem. 2004, 25, 1157−1174. (29) Frisch, M. J.; Trucks, G. W.; Schlegel, H. B.; Scuseria, G. E.; Robb, M. A.; Cheeseman, J. R.; Scalmani, G.; Barone, V.; Mennucci, B.; Petersson, G. A.; Nakatsuji, H.; Caricato, M.; Li, X.; Hratchian, H. P.; Izmaylov, A. F.; Bloino, J.; Zheng, G.; Sonnenberg, J. L.; Hada, M.; Ehara, M.; Toyota, K.; Fukuda, R.; Hasegawa, J.; Ishida, M.; Nakajima, T.; Honda, Y.; Kitao, O.; Nakai, H.; Vreven, T.; Montgomery, J. A., Jr.; Peralta, J. E.; Ogliaro, F.; Bearpark, M.; Heyd, J. J.; Brothers, E.; Kudin, K. N.; Staroverov, V. N.; Kobayashi, R.; Normand, J.; Raghavachari, K.; Rendell, A.; Burant, J. C.; Iyengar, S. S.; Tomasi, J.; Cossi, M.; Rega, N.; Millam, M. J.; Klene, M.; Knox, J. E.; Cross, J. B.; Bakken, V.; Adamo, C.; Jaramillo, J.; Gomperts, R.; Stratmann, R. E.; Yazyev, O.; Austin, A. J.; Cammi, R.; Pomelli, C.; Ochterski, J. W.; Martin, R. L.; Morokuma, K.; Zakrzewski, V. G.; Voth, G. A.; Salvador, P.; Dannenberg, J. J.; Dapprich, S.; Daniels, A. D.; Farkas, Ö .; Foresman, J. B.; Ortiz, J. V.; Cioslowski, J.; Fox, D. J. Gaussian; Gaussian, Inc.: Wallingford, CT, USA. 2009.

cellular environment and biomembrane structural issues have to be taken into consideration in further studies.

■

ASSOCIATED CONTENT

S Supporting Information *

Additional figures obtained according to the docking protocol and the MD simulations described under Materials and Methods as well as a table of hydrogen-bond interactions between anthocyanins and the hGLUT1 receptor. This material is available free of charge via the Internet at http://pubs.acs.org.

■

AUTHOR INFORMATION

Corresponding Author

*(I.F.) E-mail: [email protected]. Phone: +351.220402562. Funding

This work was supported by FCT (Fundaçaõ para a Ciência e Tecnologia) (POCI, FEDER, Programa Comunitário de Apoio), by one Post-Doc grant (SFRH/BPD/86173/2012), by one IF starting grant (IF/01355/2014), by a Ph.D. grant (PD/BD/106062/2015), and by one project grant (PTDC/ AGR-TEC/2227/2012). Notes

The authors declare no competing financial interest.

■

REFERENCES

(1) Renaud, S.; Gueguen, R. The French paradox and wine drinking. Novartis Found. Symp. 1998, 216, 208−217. (2) German, J. B.; Walzem, R. L. The health benefits of wine. Annu. Rev. Nutr. 2000, 20, 561−593. (3) Ruf, J. C. Overview of epidemiological studies on wine, health and mortality. Drugs Exp. Clin. Res. 2003, 29, 173−179. (4) Faria, A.; Pestana, D.; Azevedo, J.; Martel, F.; De Freitas, V.; Azevedo, I.; Mateus, N.; Calhau, C. Absorption of anthocyanins through intestinal epithelial cells − putative involvement of GLUT2. Mol. Nutr. Food Res. 2009, 53, 1430−1437. (5) Talavera, S.; Felgines, C.; Texier, O.; Besson, C.; Lamaison, J. L.; Remesy, C. Anthocyanins are efficiently absorbed from the stomach in anesthetized rats. J. Nutr. 2003, 133, 4178−4182. (6) Zhao, Z.; Egashira, Y.; Sanada, H. Ferulic acid is quickly absorbed from rat stomach as the free form and then conjugated mainly in liver. J. Nutr. 2004, 134, 3083−3088. (7) Green, B. G.; Dalton, P.; Cowart, B.; Shaffer, G.; Rankin, K.; Higgins, J. Evaluating the ‘labeled magnitude scale’ for measuring sensations of taste and smell. Chem. Senses 1996, 21, 323−334. (8) Kavvada, K. M.; Murray, J. G.; Moore, V. A.; Coombes, A. G. A.; Hanson, P. J. A collagen IV matrix is required for guinea pig gastric epithelial cell monolayers to provide an optimal model of the stomach surface for biopharmaceutical screening. J. Biomol. Screening 2005, 10, 495−507. (9) Lemieux, M.; Bouchard, F.; Gosselin, P.; Paquin, J.; Mateescu, M. A. The NCI-N87 cell line as a gastric epithelial barrier model for drug permeability assay. Biochem. Biophys. Res. Commun. 2011, 412, 429− 434. (10) Farrell, T. L.; Dew, T. P.; Poquet, L.; Hanson, P.; Williamson, G. Absorption and metabolism of chlorogenic acids in cultured gastric epithelial monolayers. Drug Metab. Dispos. 2011, 39, 2338−2346. (11) Tracy, L. T. L. F.; Tristan, P. T. P. D.; Laure, L. P.; Peter, P. H.; Gary, G. W. Absorption and metabolism of chlorogenic acids in cultured gastric epithelial monolayers. Drug Metab. Dispos. 2011, 39, 2338−2346. (12) Konishi, Y.; Zhao, Z.; Shimizu, M. Phenolic acids are absorbed from the rat stomach with different absorption rates. J. Agric. Food Chem. 2006, 54, 7539−7543. G


Article

Journal of Agricultural and Food Chemistry (30) Bayly, C. I.; Cieplak, P.; Cornell, W. D.; Kollman, P. A. A wellbehaved electrostatic potential based method using charge restraints for deriving atomic charges: the RESP model. J. Phys. Chem. 1993, 97, 10269−10280. (31) Izaguirre, J. A.; Catarello, D. P.; Wozniak, J. M.; Skeel, R. D. Langevin stabilization of molecular dynamics. J. Chem. Phys. 2001, 114, 2090−2098. (32) Ryckaert, J. P.; Ciccotti, G.; Berendsen, H. J. C. Numericalintegration of Cartesian equations of motion of a system with constraints − molecular-dynamics of n-alkanes. J. Comput. Phys. 1977, 23, 327−341. (33) Salomon-Ferrer, R.; Case, D. A.; Walker, R. C. An overview of the Amber biomolecular simulation package. WIREs Comput. Mol. Sci. 2012, 3, 198−210. (34) Bub, A.; Watzl, B.; Heeb, D.; Rechkemmer, G.; Briviba, K. Malvidin-3-glucoside bioavailability in humans after ingestion of red wine, dealcoholized red wine and red grape juice. Eur. J. Nutr. 2001, 40, 113−120. (35) Andlauer, W.; Stumpf, C.; Frank, K.; Furst, P. Absorption and metabolism of anthocyanin cyanidin-3-glucoside in the isolated rat small intestine is not influenced by ethanol. Eur. J. Nutr. 2003, 42, 217−223. (36) Neuhoff, S.; Ungell, A.-L.; Zamora, I.; Artursson, P. pHDependent passive and active transport of acidic drugs across Caco-2 cell monolayers. Eur. J. Pharm. Sci. 2005, 25, 211−220.

H


Experimental and Theoretical Data on the Mechanism by Which Red

Recommend Documents