Bioconjugafe Chem. 1994,5, 539-546
539
Expression of Oligohistidine-TaggedRicin B Chain in Spodoptera frugiperda Lawrence B. Afrin, Heather Gulick, Joseph Vesely, Mark Willingham, a n d Arthur E. Frankel* Departments of Medicine and Pathology, Medical University of South Carolina, Charleston, South Carolina 29425. Received June 7, 1994@
DNA encoding ADPGH6G was fused to the 5’-end of RTB DNA and subcloned as a BamHI-EcoRI DNA cassette into the baculovirus transfer vector, pAcGP67A. Spodopteru frugiperda Sfs cells were cotransfected with ~AcGP~~A-ADPGH~G-RTB DNA and BaculoGold AcNPV DNA, and recombinant baculovirus was isolated by two cycles of limiting dilution assay followed by dot blot analysis with 32P-dCTPrandom primer labeled RTB DNA. Recombinant virus was purified and amplified to obtain stocks at titers of lo7 infectious particledml. Sf9 cells grown in serum-free medium were then infected a t a n moi of 3 in the presence of 25 mM a-lactose. After 5 days, supernatants and cell pellets were harvested and assayed by a n asialofetuin ELISA for recombinant RTB protein. Fusion RTB protein was produced in the supernatant a t 5 mg/L and in the cell pellet a t 1 mgL. Recombinant protein was purified to ’80% homogeneity using either a monoclonal antibody affinity matrix with alkaline elution or a Ni2+-NTA matrix with imidazole elution. The purified protein bound asialofetuin similarly to plant RTB. N-terminal sequencing confirmed the oligohistidine tag. SDS-PAGE confirmed the 1,000 Da increase in mass relative to “wild-type”recombinant RTB produced in Sfs cells. Immunoblots confirmed reactivity with polyclonal and monoclonal antibodies to plant RTB. The fusion protein reassociated with plant RTA similarly to plant RTB. The recombinant reassociated heterodimer not only demonstrated cytotoxicity to HPB-MLT human leukemia cells (ID50 10-l2M) similar to ricin and reassociated plant RTA-plant RTB but also bound Ni2+-NTA resin, suggesting preservation of function of RTA, RTB, and the new ligand fused to RTB. Thus, the recombinant fusion of new ligands to RTB may represent a novel and practical method for developing new immunotoxins.
INTRODUCTION
An immunotoxin is a conjugate of a targeting ligand (e.g., antibodies, cytokines, etc.) covalently linked to a moiety which intoxicates the targeted cell (I). For example, ricin toxin A chain (RTA) has been conjugated t o an antibody directed against the lymphocyte surface marker CD22 to produce an immunotoxin targeting B lymphocytes (2), and Pseudomonas exotoxin (PE) has been linked to OVB3, a monoclonal antibody directed against a cell surface antigen on ovarian carcinomas ( 3 ) . The ID50 (concentrations of immunotoxin which reduce cellular protein synthesis by 50%)for anti-CD22-RTA on the Daudi B lymphoma cell line was M, which was similar to the ID5o of ricin on Daudi cells M). Similarly, the ID50)sof OVB3-PE and PE were both 10-l2 M on the OVCAR3 ovarian carcinoma cell line. Many immunotoxins with i n vitro activity have also demonstrated preclinical in vivo activity. SCID mice bearing human Daudi tumors were treated with four intravenous injections of anti-CD22-RTA. Survival was doubled from 45 to 87 days representing a four log kill of tumor cells ( 4 ) . Nude mice with growing human OVCAR-3 ascites tumors were given three intraperitoneal injections of OVB3-PE ( 3 ) . Median survival was quadrupled from 50 to 193 days. Several immunotoxins with demonstrated preclinical activity have also been evaluated in humans with consistently less encouraging results than seen in animal models. Extending the previously cited examples, two to 12 doses of anti-CD22-RTA were infused intrave-
* To whom correspondence should be addressed: Hollings Cancer Center Room 311, Medical University of South Carolina, 171 Ashley Avenue, Charleston, SC 29425. Abstract published in Advance ACS Abstracts, October 1, 1994. @
1043-1802/94/2905-0539$04.50/0
nously into patients with refractory B-cell lymphoma (5). One complete response and five partial responses occurred out of 24 patients but the responses were transient lasting 1-3 months and the dose-limiting toxicity, vascular leak syndrome, was observed early. Twenty-three patients with refractory ovarian cancer were treated with intraperitoneal escalating doses of OVB3-PE (6). No responses were seen, and dose-limiting toxic encephalopathy occurred in three patients. Many factors were postulated to bear influence on these observed clinical outcomes, including (a) limited tumor penetration due to the large sizes of the immunotoxin conjugates (7), (b) cross-reactive, nonspecific binding of the ligand or toxin moieties to bystander cells with consequent damage to normal tissues (5, 6,8), (c) conjugate heterogeneity due to varying chemical modifications (91, and (d) altered toxin structure in the conjugate, causing diminished cytosolic translocation efficiency (10). In the setting where both toxin and ligand are peptides (as in the above examples), one approach to overcoming some of these barriers is to genetically engineer an amide linkage between the two moieties. Such a recombinant gene not only allows for expression of a homogeneous product (a “fusion toxin”) but also provides a base line model for pursuing systematic investigation of mutations which might improve targeting specificity, translocation efficiency, or other pharmacologic parameters. Examples of fusion toxins developed to date include the diphtheria toxin (DT) fusions with IL-2 (DB486IL-2 and DB3891L2) (11,121 and PE with the single chain antibody to the IL-2 receptor (anti-Tac(Fv)-PE40) (13). DAB4861L-2 and DAB3dL-2 had an ID50 of lo-” M on the human T leukemia cell line, HUTlO2. Similarly, anti-Tac(Fv)PE40 had an ID50 of 10-l2 M on HUT102 cells. In contrast, anti-Tac monoclonal antibody chemically linked to PE40 or RTA had IDSO’sof M on the same 0 1994 American Chemical Society
Afrin et al.
540 Bioconjugate Chem., Vol. 5, No. 6, 1994
HUT102 cells (13,14). Thus, this fusion protein was 10100-foldmore potent in vitro than its chemically coupled conjugate counterpart. Few comparisons have been made between fusion toxins and antibody-toxin chemical conjugates in animal models (15-18). Nude mice bearing human epidermoid carcinoma cells transfected with a plasmid encoding the IL-2 receptor a subunit (4 days postinoculation) were treated with three daily doses of anti-Tac(Fv)-PE38KDEL or a chemical conjugate between anti-Tac(1gG) and truncated PE. The fusion toxin was able to cure mice whereas the chemical conjugate had much less antitumor activity. C57BIJ6 mice inoculated with murine CP3 leukemia cells were treated 24 h later with 10 daily doses of DAB4861L-2 or DAB389IL-2. DAB486IL-2 doubled mean survival time from 30 to 60 days, while DAB3891L-2cured 90% of the animals. Using a different animal model for anti-CD25-RTA, the L540 human Hodgkin’s disease cell line was inoculated into SCID mice, followed by anti-CD25-RTA treatment 24 h later. This regimen resulted in a cure rate of 70%. Small phase H I clinical trials have been conducted with DAB486IL-2, DAB3891L-2,and anti-CD5-RTA in cutaneous T cell lymphoma (CTCL) and with anti-Tac-PE in adult T cell leukemia (ATL). Again, better activity was observed with the fusion toxins. DAB4861L-2given by five daily intravenous boluses to patients with CTCL produced one complete response and two partial responses in five patients lasting 4 months to over 3 years (19). DAB389IL-2 given similarly produced five partial responses in 11 patients with CTCL (20). The chemical conjugate anti-CD5-RTA was given daily intravenously for 10 days to CTCL patients (21). Only four of 14 patients showed partial responses lasting 3-8 months, and toxicity related to vascular leak syndrome was significant. AntiTac antibody conjugated to PE yielded no responses in four patients and produced early dose-limiting hepatotoxicity (22). Fusion toxins based on ricin may have advantages over DT- and PE-based fusion proteins. Ricin is a class I1 ribosome inactivating protein naturally found in the castor bean seed of the plant Ricinus communis. The toxin is a heterodimer consisting of an enzymatically toxic A chain (RTA) disulfide-linked to a lectin B chain (RTB) which has two galactose-specific binding sites (23). The mechanism of ricin cytotoxicity, namely the N-glycosylation of the 28s ribosomal RNA a t the binding site for elongation factors (24),is distinct and independent from that of DT and PE (ADP-ribosylation of elongation factor 2 (25)). Thus, ricin-based fusion toxins are non-crossresistant with DT- and PE-based chimeric proteins. Additionally, ricin-based fusion toxins should not exhibit a similar immunogenicity profile as compared with fusion proteins containing either DT o r PE. DNA encoding the ricin gene was simultaneously isolated from both a genomic library and a cDNA library (26,27). Preproricin DNA has no introns, thus simplifying construction of gene expression vectors. RTA has been expressed in bacteria (28) and yeast (291,while RTB has been expressed in bacteria (301,yeast (311, Xenopus oocytes (32), mammalian COS cells (33), and recently, Spodoptera frugiperda Sf9 insect cells (34). Ricin-based fusion toxins developed to data include RTA fused to protein A (35), RTA-IL-2 (36), and proricin containing a n alternate Factor X cleavable linker peptide (37). Problems encountered with ricin-based fusion toxins thus far have included inadequate intracellular heterodimer cleavage and poor production yields. We have approached the design of ricin-based fusion toxins by production and modification of recombinant RTB (rRTB) which can be reassociated with native RTA.
The recombinant heterodimer can then be purified and tested. To this end, we subcloned the RTB gene into a baculovirus expression vector a t the 3’ end of the gp67 signal peptide leader DNA (34). rRTB was isolated in Sf9 culture supernatant a t 3 mgL. Purification was performed by means of a n immunoaffinity matrix. The purified rRTB bound galactose and reassociated with plant RTA to form heterodimers equally cytotoxic as native ricin. We now describe the introduction of a new ligand a t the N-terminus of RTB by genetic modification. This site was chosen because X-ray crystallographic studies of ricin show the N-terminus of RTB to lie in disordered structure (accessible to the solvent) and without apparent interaction with either the RTA-RTB interface or the galactose-binding sites on RTB (38). To be potentially useful, any introduced ligand must retain its original function, and thus for our first such construction we chose a ligand whose function would be simple to test and simultaneously might demonstrate the applicability of a purification method for RTB-based chimeric proteins distinct from the usual immunologically based approaches. This report documents the production of ADPGHsG-RTB (oligohistidine-tagged or His-tag RTB) a t a level comparable to that of rRTB and also demonstrates preservation in His-tag RTB-RTA of both cytotoxicity and ligandbinding functions (oligohistidine affinity for nickel as well a s RTB affinity for galactose). These results not only suggest a novel and practical method for developing recombinant ricin-based immunotoxins but also demonstrate that the oligohistidine-nickel affinity system can be used in the purification of such toxins. EXPERIMENTAL. PROCEDURES
Reagents. Materials used for construction and characterization of pAcGP67A-GHsG-RTB were the same as those used for construction and characterization of pAcGP67A-RTB (34). Additionally, Ni2+-NTA resin was obtained from Qiagen (Chatsworth, CA), and imidazole was obtained from Sigma (St. Louis, MO). TFTBl hybridoma producing monoclonal antibody to RTB was obtained from the American Type Culture Collection (Rockville, MD). Construction of pAcGP67A-GHBG-RTB. A baculovirus transfer vector was prepared containing DNA encoding a gp67 signal peptide followed by ADPGH6GRTB. The construction was based on the previously described baculovirus transfer vector pAcGP67A-RTB (34). To construct the RTB variant DNA, a polymerase chain reaction (PCR) was performed as previously described (34) using two oligonucleotide primers (5’-
GCTCATGAGGATCCCGGGCATCATCACCACCACCACGGAGCTGATGTTTGTATGGAC-3’ and 5‘-GAGTTn”rGGT“GCCGGGTCCCAG-3’) which introduce sequences encoding GH6G a t the 5’ end and sequences encoding two stop codons and a n EcoRI site a t the 3’ end. Oligonucleotides were synthesized on an Applied Biosystems 380B DNA synthesizer and desalted with n-butanol. The PCR product was purified and EcoRIIBamHIrestricted according to the manufacturer’s instructions and then subcloned into pAcGP67A. This DNA was then transformed into INVaF cells, and clones were selected on LB-ampicillin plates. Dideoxy sequencing confirmed the correct construction. pAcPG67A-GH6G-RTB DNA was then purified by cesium chloride density gradient centrifugation. Construction, Isolation, and Amplification of Recombinant Baculovirus. As previously detailed for pAcGP67A-RTB (34),standard techniques were used in the maintenance of an Sf9 cell line as well as construction
Bioconjugate Chem., Vol. 5, No. 6,1994 541
Expression of Oligohistidine-Tagged Ricin B Chain
and isolation of recombinant baculovirus by homologous recombination between pAcGP67A-GHGG-RTB and BaculoGold DNA. In dot blot assays of limiting dilutions, positive wells were identified and the corresponding supernatants reassayed by limiting dilution until all wells were positive up to a dilution. Recombinant virus in supernatants was then amplified by infecting Sf9 cells a t a multiplicity of infection (moi) of 0.1 and collecting supernatants a t day 7 for another round of amplification. Three rounds of amplification were performed. Expression and Purification of His-tag RTB. Amplified virus a t a titer of 107/mLwas added to Sf9 cell cultures (moi = 1.5-3) in a manner identical to that done previously for the expression of rRTB (34). Also, methods detailed previously for harvesting, concentration, and dialysis of rRTB culture supernatant as well as lysing and storage of cell pellets (34)were again used, without alteration, in this work with His-tag RTB. Immunoaffinity column preparation (monoclonal anti-RTB antibody P2) was also identical. Of note, just as found for rRTB (34),His-tag RTB eluted with 0.1 M triethylamine pH 11.0 (and was immediately neutralized with 1/10 volume of 1M sodium phosphate pH 4.8). RTB protein concentration was determined by absorbance a t 280 nm based on an absorbance of 1.44 for a 1 mg/mL solution of plant RTB and a 1 cm pathlength. Characterization of His-tag RTB. Except for nickel affinity testing, all characterization of His-tag RTB and reassociated His-tag RTB-RTA heterodimer was performed as described previously for rRTB (34). The molecular weight of His-tag RTB was determined by 15% reducing SDS-PAGE. The N-terminal sequence of Histag RTB was determined by Edman degradation. Immunological characterization was performed by immunofluorescent microscopy (monoclonalanti-RTB antibodies P2 and P10) and immunoblots (polyclonal anti-RTB antibodies and monoclonal anti-RTB antibodies P2, P10, and TFTB1). Lectin activity was tested via the previously described asialofetuin ELISA (34) as well as passage over a lactosyl acrylamide matrix (elution performed with NTEA buffer (50 mM NaC1, 25 mM Tris pH 8, 1 mM EDTA, 0.01% sodium azide) plus 50 mM a-lactose, also as previously described for rRTB (34)). Eluted fractions were assayed for optical density a t 280 nm and binding to asialofetuin by the same ELISA assay as referenced above. To assess immunoreactivity under nondenaturing conditions, an ELISA was performed identically to the asialofetuin ELISA except the plate coat was done with monoclonal antibody (P2, P10, or TFTB1) a t 10 pglmL. To characterize His-tag RTB-RTA heterodimer reassociation, 30 pg of His-tag RTB, rRTB, or plant RTB (pRTB)was mixed with 90 pg of plant RTA in NTEA plus 50 mM lactose and placed on a n orbital shaker for 4 h a t room temperature. The reaction mixture was then analyzed by a ricin ELISA as previously described (34). Heterodimer cytotoxicity to HPB-MLT human T leukemia cells was then assessed via a standard L3H]1eucine incorporation-based assay as described previously (341, using dilutions of ricin, plant RTA (pRTA)-pRTB, rRTBpRTA, His-tag RTB-pRTA, or pRTA or His-tag RTB alone. Wells receiving dilutions of media alone served as controls. All assays were performed in triplicate. In some experiments, duplicate samples were incubated in the presence of 50 mM a-lactose. The ID50 was the concentration of protein which inhibited protein synthesis by 50% compared to control. Nickel-Binding of rRTB, His-tag RTB, and Recombinant Heterodimers. Media supernatants from Sf9 cells infected with RTB or His-tag RTB encoding
recombinant baculovirus were collected, adjusted to 0.01% sodium azide, concentrated by vacuum dialysis, dialyzed against 1 M NaC1, 25 mM Tris pH 8, 0.01% sodium azide, and 25 mM a-lactose (HNTAL-"H" for high salt concentration). Samples were then ultracentrifuged at 1OOOOOg for 1 h and adjusted to 5 mM P-mercaptoethanol and 1%Tween-20. rRTB-pRTA and His-tag RTB-pRTA reassociated heterodimers were diluted into 5 mL of HNTAL and adjusted to 1%Tween-20. Four 1 mL Ni2+/nitrilotriacetic acid (NTA)/agarose matrices were prepared per supplier's instructions and equilibrated with 10 mL of HNTAL. Supernatants or recombinant reassociated heterodimers were passed over the columns four times, and then the columns were washed with 10 mL of HNTAL. Nickel-binding proteins were then eluted with HNTAL containing 10,20,30,40, 50,100,200,500, and 1000 mM imidazole. Eluates were assayed for RTB or heterodimer by the asialofetuin ELISA or ricin ELISA, respectively. Immunoblots of eluate fractions from rRTB and His-tag RTB supernatants were performed as described above. RESULTS
Production of Recombinant Baculovirus. pAcGP67A-GHGG-RTB DNA was cotransfected with BaculoGold AcNPV DNA into Sf9 insect cells. Day 5 supernatants had a viral titer of 105/mL by limiting dilution assay. Supernatant was selected from a positive well a t dilution, and the limiting dilution assay was repeated to yield a titer of 107/mL. Virus amplification was then performed on a positive well a t dilution. Supernatants collected from all three stages of virus amplification (5,50, and 150 mL) continued to show virus titers of 107/mL. Expression of His-tag RTB. Day 5 supernatants from Sf9 cells infected a t a n moi of 1.5-3 were assayed by the asialofetuin ELISA. His-tag RTB was present a t 5.8 pg/mL. Cell lysates yielded 1.4 pg of His-tag RTB/ mL cell culture. Immunofluorescent staining of 48 h postinfection Sf9 cells revealed intracellular accumulation of His-tag RTB (Figure 1). purification and Characterization of His-tag RTB. The total concentration of protein in the Ex-Cell 400 Sf9 postinfection supernatants was 6 mg/mL, and His-tag RTB represented 0.1% of the total protein. We initiated a purification scheme to enrich the recombinant product nearly 1000-fold. First, the supernatants were concentrated 10-fold by vacuum dialysis with 10 000 M,-cutoff membranes. Yields of His-tag RTB after vacuum dialysis were close to 100%. After dialysis into NTEA plus 25 mM a-lactose and ultracentrifugation, 80% of the recombinant protein remained soluble and biologically active. Binding of His-tag RTB to the P2 monoclonal antibody affinity matrix was then tested. Less than 5% of the recombinant protein loaded remained in the column flowthrough. His-tag RTB eluted with pH 11triethylamine and was neutralized with sodium phosphate buffer. Approximately 200-400 pg of His-tag RTB from 100 mL of supernatants was recovered after immunoaffinity chromatography. Thus, the yield of His-tag RTB from starting supernatants was 60-80%. The protein remained biologically active stored a t -20 "C in the triethylamine-sodium phosphate buffer. SDS-PAGE showed His-tag RTB as the major band with minor bands corresponding to the P2 monoclonal antibody heavy and light chains which eluted to a minor degree from the matrix (Figure 2). Purity was in excess of 75% for each preparation based on densitometry performed on Coomassie-stained SDS-PAGE gels.
Afrin et al.
542 Bioconjugate Chem., Vol. 5, No. 6, 1994
B
A
.
-
49.5
325 27.5
18.5
1
2
3
1 2
3
Figure 2. 15% reducing SDS-PAGE of immunoafinity puri-
Figure 1. Immunofluorescence of Sf9 insect cells infected with AcNPV baculovirus or recombinant baculovirus. Cells were attached to poly-lysine coated tissue culture dishes and fixed with 3.7% formaldehyde in PBS followed by 0.1% Triton X-100 in PBS, washed with 2 mg/mL of BSA in PBS and then PBS plus BSA plus monoclonal antibody P10 a t 10 &mL. The cells were then washed with PBS and incubated with affinity purified goat anti-mouse Ig coupled to rhodamine (Jackson ImmunoResearch) at 25 ,ug/mL, rewashed, and postfured in 3.7% formaldehyde in PBS. Sf9 cells infected with AcNPV baculovirus showed no fluorescence (data not shown). (A) Sf9 cells infected with recombinant baculovirus examined at 200 x under phase contrast. (B) Sf9 cells infected with recombinant baculovirus examined for fluorescence.
The molecular weight of insect His-tag RTB was 34 500 Da based on reducing Coomassie-stained SDS-PAGE gels and the prestained low molecular weight protein standards from BioRad. This compares with a molecular weight of 33 500 Da for insect rRTB. The N-terminal sequence of the His-tag RTB was shown to be ADPGHsGA. Immunoblots of His-tag RTB, rRTB, and pRTB with polyclonal rabbit antiricin antibody (Figure 2B) and murine monoclonal antibodies P2, P10, and TFTB1 all yielded a single strong band at molecular weight of 34500 Da (data not shown). An ELISA testing the immunoreactivity of each of pRTB, rRTB, and His-tag RTB with each of P2, P10, and TFTBl showed that P2 bound His-tag RTB 46% and 71% as well as pRTB or rRTB, respectively. The relative binding affinities for P10 were 41% and loo%, respectively, and for TFTB1, 10% and 22% (data not shown). His-tag RTB bound asialofetuin and lactose on a molar basis 80-100% as well as pRTB. Asialofetuin binding was assessed by ELISA, lactose binding was measured by yields of His-tag RTB in fractions from the lactosyl acrylamide matrix. Fifty percent of pRTB or His-tag RTB bound to immobilized lactose and was eluted with 50 mM lactose. Characterization of Recombinant Heterodimers. Incubation of His-tag RTB at M with pRTA at 3 x M for 4 h at room temperature yielded 50% reassociated heterodimer. Similar levels of reassociation were seen using pRTB or rRTB with pRTA at the same concentrations. The heterodimer concentrations were quantitated by ricin ELISA. The ID50)s of ricin, reassociated pRTB-RTA, reassoci-
fied His-tag RTB and rRTB. Recombinant protein for His-tag RTB was prepared a s described in the text. rRTB protein was isolated a s previously described (33). (A) Coomassie stained gel. Lane 1: BioRad prestained low molecular weight protein standards (106, 80, 49.5,32.5, 27.5, and 18.5 kDa). Lane 2: rRTB. Lane 3: His-tag RTB. (B) Immunoblot using rabbit polyclonal antiricin antibody. Lane 1: BioRad prestained low molecular weight protein standards. Lane 2: rRTB. Lane 3: His-tag RTB. The double-band appearance of rRTB and Histag RTB on Coomassie stained gels reflect two major glycosylation patterns of RTB produced in Sf9 cells (33). The Coomassie stained gel shows the approximately 1000 Da increase in mass of His-tag RTB relative to rRTB. The faint band in both Coomassie stained gels and immunoblots at approximately 60 000 Da represents homodimers resulting from incomplete reduction during incubation with P-mercaptoethanol-containing sample buffer prior to SDS-PAGE. The monoclonal antibody immunoblots gave similar patterns a s the polyclonal antibody immunoblot (data not shown).
ated rRTB-RTA, and reassociated His-tag RTB-RTA were all approximately 7 x M, with a two-log increase in ID50 seen in each case in the presence of 50 mM a-lactose (Figure 3). His-tag RTB alone was completely nontoxic at the concentrations tested. Nickel-Bindingof His-tagRTB and Recombinant Heterodimers. Day 5 supernatants of Sf9 cells infected with recombinant baculovirus encoding rRTB or His-tag RTB were harvested, vacuum concentrated, dialyzed into HNTAL, and ultracentrifuged. Supernatants were then adjusted to 1% Tween-20 and 5 mM @-mercaptoethanol, passed four times through Ni2+-NTA agarose, washed, and eluted with increasing concentrations of imidazole. Asialofetuin ELISA (Figure 4),Coomassie-stained gels, and immunoblots demonstrated complete binding of Histag RTB to the Ni2+-NTA matrix and elution with 20 mM imidazole or greater. The greatest yield was at 30 mM imidazole, and the highest purity (95%) was at 40100 mM imidazole. In contrast, rRTB from supernatants failed to bind to Ni2+-NTA and was not observed in fractions eluted with 20 mM or greater imidazole. In recombinant heterodimer testing, 200 pg of His-tag RTB-RTA or rRTB-RTA was diluted into separate 5 mL quantities of HNTAL with 1%Tween-20 (but without B-mercaptoethanol) and passed four times over freshly prepared nickel affinity matrices. After each matrix was washed with HNTAL, elutions were again performed with increasing concentrations of imidazole. His-tag RTB-RTA bound identically to His-tag RTB, while rRTB-RTA behaved similarly to rRTB and failed to bind to the nickel matrix (Figure 5).
Bioconjugate Chem., Vol. 5,No. 6, 1994 543
Expression of Oligohistidine-Tagged Ricin B Chain HPB-MLT Cell Cytotoxicity Assorted ricin variants with and without lactose
10 0
1
4 -13.00
-12.00
-1 1 .oo
-10.00
-9.00
-8.00
Toxin Concentration (log M) Ricin w/ lactose Ricin His-RTB/RTA w/ lactose His-RTBIRTA A RTA RTA w/ lactose His-RTB w/ lactose V His-RTB Figure 3. HPB-MLT cell cytotoxicity. 2 x lo5 cells were incubated with varying concentrations of heterodimers, RTA, or His-tag RTB in the presence or absence of 50 mM a-lactose for 20 h at 37 “C, 5% COz, and then 1pCi/well of [3H]leucinewas added for 4 h. Cells were harvested on glass fiber filters and washed. Filters were dried and counted in a liquid scintillation counter: 0,ricin; 0 , His-tag RTB-RTA, A, RTA, V, His-tag RTB; . , ricin plus 50 mM a-lactose; 0 ,His-tag RTB-RTA plus 50 mM a-lactose; A, RTA plus 50 mM a-lactose; V, His-tag RTB plus 50 mM a-lactose. 0 0
.
DISCUSSION
Recombinant baculovirus encoding His-tag RTB was isolated after only two rounds of selection. The rapid generation and selection of recombinant baculovirus was facilitated by using a n AcNPV derivative with a deletion in ORF1629 (39). The transfer vector contains sequences which complement the essential downstream gene, and thus only recombinant baculoviruses are viable. We observed similar efficient selection for recombinant baculovirus encoding RTB (34). Levels of expression and secretion of His-tag RTB into infected insect cell supernatants were comparable to that previously observed with rRTB and far higher than previously reported levels of recombinant RTB from eukaryotic expression systems including yeast, monkey kidney, and Xenopus (32-33). The 4-fold higher level of His-tag RTB in media versus intracellular levels suggests efficient secretion and processing of the recombinant protein with the gp67 leader peptide and minimal proteolytic degradation in the medium after release. Also, the N-terminal sequence of His-tag RTB was ADPGHsGA. These results further support eEcient and proper processing of the gp67 leader peptide, as the predicted cleavage site a t the C-terminal end of this leader is between the adjacent alanines in HSFAADP. These results agree with those observed for rRTB (34). The oligohistidine tag did not alter the stability or proteolytic sensitivity of the recombinant product. Immunoaffinity chromatography was used as a single step purification method for His-tag RTB. The high overall yields and homogeneity of the product suggest that monoclonal antibody affinity matrices are well suited for isolation of recombinant proteins from baculovirusinfected insect cell supernatants. Alkaline conditions for
elution were also found optimal for purification of rRTB (34) and may be generally useful for proteins with low PI’S. The observed molecular weight of 34 500 Da corresponds to the predicted molecular weight of 34 478 Da, consisting of ADP-RTB, two MangGlcNacz oligosaccharides, and the GHsG N-terminal peptide sequence. Reducing SDS-PAGE was performed using equivalent amounts of His-tag RTB, rRTB, and pRTB. The proteins were transferred to nitrocellulose and probed with polyclonal antibody to ricin and three different monoclonal antibodies to RTB. Immunoreactivity of His-tag RTB was minimally different from pRTB or rRTB. Further, ricin ELISA yielded similar reading on equivalent amounts of pRTB-RTA, rRTB-RTA, and His-tag RTB-RTA. These results suggest His-tag RTB is folded similarly to rRTB and pRTB. The only secondary structural elements in RTB are R-loops and are formed within each subdomain of RTB. They consist of compact, contiguous peptide segments with a “loop-shaped path in threedimensional space. The R-loops are stabilized by sets of hydrogen bonds between the backbone nitrogen and carbonyl oxygen atoms. Q-loops in the a and p subdomains have disulfide bonds securing the neck of the loops. RTB also has a core with residues contributed by hydrophobic residues from each subdomain. All of the amino acid residues critical both to core formation and Q-loop stabilization are distant from the N-terminus. The oligohistidine tag comprising the N-terminus was not expected to interrupt RTB folding and the evidence supports this prediction. The lectin activity of His-tag RTB was similar to rRTB and pRTB. Again, the sugar binding sites in subdomains la and 2 y of RTB are structurally distant from the
544 Bioconjugate Chem., Vol. 5, No. 6, 1994
Afrin et al.
Nickel Affinity: His-tag RTB vs. rRTB Asialofetuin ELISA
Pre
FT
W
20
10
40
30
50
100
200
1000
500
Eluate FractiordImidazoleConc. (mM)
MHis-tag RTB 0rRTB Figure 4. Binding of recombinant lectins to Ni2+-NTA-agarose. Supernatants from Sf9 cells infected with recombinant baculovirus encoding His-tag RTB or rRTB were concentrated, dialyzed into HNTAL, ultracentrifuged, adjusted to 1%Tween-20 and 5 mM B-mercaptoethanol, and passed four times over a 1 mL Ni2+-NTA-agarose column. The column was washed with HNTAL and then eluted with increasing concentrations of imidazole in HNTAL. Total RTB in the different fractions was measured by the asialofetuin ELISA described in the text. Lightly shaded bars are rRTB fractions. Darkly shaded bars are His-tag RTB fractions: Pre, material prior to passage on the matrix; FT, flowthrough or material which did not bind the nickel matrix, W, HNTAL wash following passage of recombinant protein; 10-1000,5 mL eluates from the nickel matrix with the specified imidazole concentration (mM).
Nickel Affinity of Heterodimers Asialofetuin ELISA
Pre
FT
W
10
20
30
40
.J, IO0 200
I
I
500
1000
Eluate FractiodImidazole Conc. (mM) His-tag RTB-RTA
17rRTB-RTA
Figure 5. Binding of recombinant heterodimers to Ni2+-NTA-agarose.
Two hundred pg each of His-tag RTB-RTA and rRTBRTA were separately diluted into 5 mL of HNTAL, adjusted to 1%Tween-20, passed through 1mL of Ni2+-NTA-agarose columns, washed with HNTAL, and eluted with increasing concentrations of imidazole in HNTAL. Total heterodimer concentration in the different fractions was measured by the ricin ELISA described in the text. Lightly shaded bars are rRTB-RTA fractions. Darkly shaded bars are His-tag RTB-RTA fractions: Pre, material prior to passage on the matrix, FT, flowthrough or material which did not bind the nickel matrix; W, HNTAL wash following passage of recombinant protein; 10-1000 5 mL eluates from the nickel matrix with the specified imidazole concentration (mM).
N-terminus. Thus, the addition of 11 amino acid residues to the N-terminus should not modify lectin activity, and our results support this hypothesis. Accurate measurements of sugar binding affinity require 10-1000 ,ug of
protein for equilibrium dialysis measurements or the BIAcore surface plasmon resonance system (40). With scaleup of the recombinant baculovirus-Sf9 expression system, adequate quantities of recombinant RTB proteins
Expression of Oligohistidine-Tagged Ricin B Chain
are now available for comparative studies in different laboratories and potentially for efforts to crystallize the proteins and determine structure-function relationships. Plant RTA reassociated equally well with His-tag RTB, rRTB, and pRTB. Amino acid residues critical for interaction of RTB with RTA include C4, which forms a disulfide bridge with C259 of RTA. The disulfide bond functions to maintain chain association a t very low toxin concentrations. The ability of the ricin ELISA to measure intact His-tag RTB-RTA a t ng/mL concentration and the cytotoxicity of His-tag RTB-RTA to HPB-MLT cells a t M suggests the disulfide bond is intact in the recombinant heterodimer. Most of the interactions of RTB and RTA are due to hydrophobic interactions between aliphatic sidechains and aromatic rings, although some polar contacts are made. Interface RTB residues include A l , D2, D94, V141, F140, K219, F218, N220, P260, and F262, all of which are preserved in Histag RTB. The first three amino acid residues of RTB in ricin crystals have less ordered structure and spend a significant fraction of time floating in the solvent. The 11amino acid oligohistidine tag was expected to remain free in the solvent and not bond with amino acid residues in the area of contact with RTA. The similar free energy for the association of His-tag RTB with RTA and pRTB with RTA corroborates these hypotheses. The potent cytotoxicity of His-tag RTB-RTA suggests that the fusion of the oligohistidine peptide to the N-terminus of RTB did not affect cell intoxication. Since the translocating and enzymatic domains of ricin appear to reside on RTA (23,41),we anticipated full cytotoxicity for the His-tag RTB-RTA heterodimer. The lower potencies for Xenopus proricin with a factor X cleavage site, E. coli RTA with a diphtheria toxin disulfide loop fused to protein A, and E. coli RTA fused directly to protein A was likely due to poor cleavage and release of RTA intracellularly (35-37). In contrast, the linkage of RTA to His-tag RTB uses the native disulfide bond and RTA-RTB interface and displays cytotoxicity similar to native ricin. Further, the recombinant protein expressed within insect cells is recovered at much higher yields than Xenopus proricin. Potentially useful fusion ricin toxins must demonstrate the new ligand specificity on the heterodimer. We tested His-tag RTB alone, rRTB alone, His-tag RTB-RTA, and rRTB-RTA for binding to a nickel affinity matrix. Both free His-tag RTB and His-tag RTB-RTA bound nickel and were eluted with 20-100 mM imidazole buffers. In contrast, rRTB and rRTB-RTA, which lack oligohistidine sequences, failed to bind nickel. These observations are similar to other insect-derived recombinant proteins with introduced oligohistidine tags (42, 43). Taken together, these results suggest that, as with the oligohistidine tag reported here, a new N-terminal ligand is likely to be free in the solvent and accessible for novel binding specificities. These results also suggest that oligohistidine-tagging of an N-terminal RTB fusion peptide might provide a purification method (nickel affinity) which may be particularly useful if RTB mutants are engineered which fail to bind both sugar and the common anti-RTB antibodies. The preparation of milligram quantities of fully active ricin fusion protein with intact novel specificity makes possible genetic engineering of ricin similar to that reported previously for DT (12) and PE (13). Other peptide ligands can be substituted for the oligohistidine tag (or interposed between the oligohistidine tag and RTB) and the fusion protein reassociated with pRTA or rRTA t o provide a smaller and more homogeneous product for therapeutic studies.
Bioconjugate Chem., Vol. 5, No. 6,1994 545 ACKNOWLEDGMENT
This work was supported by NIH grant ROlCA54116 and a n American Cancer Society Clinical Oncology Fellowship Award. I wish to acknowledge the assistance of the Protein Chemistry Facility and Oligonucleotide Synthesis Facility a t MUSC. We also thank Dr. Walter Blattler for the P2, P10, and aBR12 monoclonal antibodies. LITERATURE CITED (1) Pastan, I., and FitzGerald, D. (1991) Recombinant toxins for cancer therapy. Science 254, 1173-1177. (2) Shen, G., Li, J., Ghetie, M., Ghetie, V., May, R., Till, M., Brown, A., Relf, M., Knowles, P., Uhr, J.,Janossy, G., Amlot, P., Vitetta, E., and Thorpe, P. (1988) Evaluation of four CD22 antibodies as ricin A chain-containing immunotoxins for the in vivo therapy of human B-cell leukemias and lymphomas. Znt. J . Cancer 42, 792-797. (3) FitzGerald, D., Idziorek, T., Batra, J.,Willingham, M., and Pastan, I. (1990) Antitumor activity of a thioether-linked immunotoxin: OVBB-PE. Bioconjugate Chem. 1 , 264-268. (4) Ghetie, M., Richardson, J., Tucker, T., Jones, D., Uhr, J., and Vitetta, E. 1991. Antitumor activity of Fab’ and IgGanti-CD22 immunotoxins in disseminated human B lymphoma grown in mice with severe combined immunodeficiency disease: effect on tumor cells in extranodal sites. Cancer Res. 51, 5876-5880. (5) Amlot, P., Stone, M., Cunningham, D., Fay, J., Newman, J.,Collins, R., May, R., McCarthy, M., Richardson, J.,Ghetie, V., Ramilo, O., Thorpe, P., Uhr, J., and Vitetta, E. (1993) A phase I study of an anti-CD22-deglycosylated ricin A chain immunotoxin in the treatment of B-cell lymphomas resistant to conventional therapy. Blood 82, 2624-2633. (6) Pai, L., Bookman, M., Ozols, R., Young, R., Smith, J., Longo, D., Gould, B., Frankel, A., McClay, E., Howell, S., Reed, E., Willingham, M., FitzGerald, D., and Pastan, I. (1991) Clinical evaluation of intraperitoneal Pseudomonas exotoxin immunoconjugate OVB3-PE in patients with ovarian cancer. J . Clin. Oncol. 9, 2095-2103. (7) Hertler, A., Schlossman, D., Borowitz, M., Laurent, G., Jansen, F., Schmidt, C., and Frankel, A. (1988) A phase I study of T101-ricin A chain immunotoxin in refractory chronic lymphocytic leukemia. J . Biol. Response Modif. 7, 97- 113. ( 8 ) Gould, B., Borowitz, M., Groves, E., Carter, P., Anthony, D., Weiner, J., and Frankel, A. (1989) A phase I study of a continuous infusion anti-breast cancer immunotoxin: report of a targeted toxicity not predicted by animal studies. JNCZ 81, 775-781. (9) Grossbard, M., Lambert, J., Goldmacher, V., Blattler, W., and Nadler, L. (1992) Correlation between in vivo toxicity and preclinical in vitro parameters for the immunotoxin anti-B4blocked ricin. Cancer Res. 52, 4200-4207. (10)Manske, J., Buchsbaum, D., and Vallera, D. (1989) The role of ricin B chain in the intracellular trafficking of antiCD5 immunotoxins. J . Zmmunol. 142, 1755-1766. (11) Williams, D., Parker, K., Bacha, P., Bishai, W., Borowski, M., Genbauffe, F., Strom, T., and Murphy, J. (1987) Diphtheria toxin receptor binding domain substitution with interleukin-2: genetic construction and properties of a diphtheria toxin-related interleukin-2 fusion protein. Protein Eng. 1, 493-498. (12) Williams, D., Snider, C., Strom, T., and Murphy, J. (1990) Structure/function analysis of interleukin-2 toxin (DAB486IL-2). J . Biol. Chem. 265, 11885-11889. (13) Chaudhary, V., Queen, C., Junghans, R., Waldmann, T., FitzGerald, D., and Pastan, I. (1989) A recombinant immunotoxin consisting of two antibody variable domains fused to Pseudomonas exotoxin. Nature 339, 394-397. (14) Kronke, M., Depper, J., Leonard, W., Vitetta, E., Waldmann, T., and Greene, W. (1985) Adult T cell leukemia: a potential target for ricin A chain immunotoxins. Blood 65, 1416-1421. (15) Friedman, P., McAndrew, S., Gawlak, S., Chace, D., Trail, P., Brown, J., and Siegall, C. (1993) BR96 sFv-PE40, a potent
546 Bioconjugate Chem., Vol. 5, No. 6,1994 single-chain immunotoxin that selectively kills carcinoma cells. Cancer Res. 53, 334-339. (16) Kreitman, R., Bailon, P., Chaudhary, V., FitzGerald, D., and Pastan, I. (1994) Recombinant immunotoxins containing anti-Tac(Fv) and derivatives of Pseudomonas exotoxin produce complete regression in mice of an interleukin-2 receptorexpressing human carcinoma. Blood 83, 426-434. (17) Bacha, P., Forte, S., McCarthy, D., Estis, L., Yamada, G., and Nichols, J. (1991) Impact of interleukin-2-receptortargeted cytotoxins on a unique model of murine interleukin2-receptor-expressing malignancy. Znt. J . Cancer 49,96-101. (18) Winkler, U., Gottstein, C., Schon, G., Kapp, U., Wolf, J., Hansmann, M., Bohlen, H., Thorpe, P., Diehl, V., and Engert, A. (1994) Successful treatment of disseminated human Hodgkin’s disease in SCID mice with deglycosylated ricin A-chain immunotoxins. Blood 83,466-475. (19) Hesketh, P., Caguioa, P., Koh, H., Dewey, H., Facada, A., McCaffrey, R., Parker, K., Nylen, P., and Woodworth, T. (1993) Clinical activity of a cytotoxic fusion protein in the treatment of cutaneous T-cell lymphoma. J . Clin. Oncol. 11, 1682-1690. (20) LeMaistre, C., Kuzel, T., Foss, F., Hesketh, P., Saleh, M., Platanias, L., Schwartz, G., Craig, F., Tolsonk, K., and Woodworth, T. (1994) DAB389IL-2 is well tolerated at doses inducing responses in IL-2 receptor expressing lymphomas. Blood 82, Suppl. 1, 137a. (21) LeMaistre, C., Rosen, S., Frankel, A., Kornfeld, S., Saria, E., Meneghetti, C., Drajesk, J.,Fishwild, D., Scannon, P., and Byers, V. (1991) Phase I trial of H65-RTA immunoconjugate in patients with cutaneous T-cell lymphoma. Blood 78, 1173- 1182. (22) Waldman, T., Pastan, I., Gansow, O., and Junghans, R. (1992) The multichain interleukin-2 receptor: a target for immunotherapy. Ann. Intern. Med. 116, 148-160. (23) Olsnes, S., and Pihl, A. (1973) Different biological properties of the two constituent peptide chains of ricin, a toxic protein inhibiting protein synthesis. Biochemistry 12,31213126. (24) Endo, Y., and Tsurugi, K. (1987) RNA N-glycosidase activity of ricin A-chain. J . Biol. Chem. 262, 8128-8130. (25) Middlebrook, J., and Dorland, R. (1984) Bacterial toxins: cellular mechanisms of action. Microbiol. Rev. 48, 199-221. (26) Halling, K., Halling, A., Murray, E., Ladin, B., Houston, L., and Weaver, R. (1985) Genomic cloning and characterization of a ricin gene from Ricinus communis. Nucleic Acids Res. 13, 8019-8032. (27) Lamb, F., Roberts, L., and Lord, J. (1985) Nucleotide sequence of cloned cDNA for preproricin. Eur. J . Biochem. 148, 265-270. (28) Piatak, M., Lane, J., Laird, W., Bjorn, M., Wang, A., and Williams, M. (1988) Expression of soluble and fully functional ricin A chain in Escherichia coli is temperature-sensitive. J . Biol. Chem. 263, 4837-4843.
Afrin et al. (29) Frankel, A., Schlossman, D., Welsh, P., Hertler, A., Withers, D., and Johnston, S. (1989) Selection and characterization of ricin toxin A-chain mutations in Saccharomyces cerevisiae. Mol. Cellular Biol. 9, 415-420. (30) Hussain, K., Bowler, C., Roberts, L., and Lord, J. (1989) Expression of ricin B chain in Escherichia coli. FEBS Lett. 244, 383-387. (31) Richardson, P., Roberts, L., Gould, J., Smith, A., and Lord, M. (1987) The expression of ricin B-chain in Saccharomyces cerevisiae. Biochem. SOC.Trans. 15, 903-904. (32) Richardson, P., Gilmartin, P., Colman, A., Roberts, L., and Lord, J. (1988) Expression of functional ricin B chain in Xenopus oocytes. BiolTechnology 6, 565-570. (33) Chang, M., Russell, D., Uhr, J., and Vitetta, E. (1987) Cloning and expression of recombinant, functional ricin B chain. Proc. Natl. Acad. Sci. U S A . 84, 5640-5644. (34) Frankel, A,, Gulick, H., Afrin, L., Vesely, J., and Willingham, M. (1994) Expression of ricin B chain in Spodoptera frugiperda. Biochem. J . (in press). (35) Kim, J . , and Weaver, R. Construction of a recombinant expression plasmid encoding a staphylococcal protein A-ricin A fusion protein. Gene 68, 315-321. (36) OHare, M., Brown, A,, Hussain, K., Gebhardt,A., Watson, G., Roberts, L., Vitetta, E., Thorpe, P., and Lord, J. (1990) Cytotoxicity of a recombinant ricin A-chain fusion protein containing a proteolytically-cleavable spacer sequence. FEBS Lett. 273, 200-204. (37) Westby, M., Argent, R., Pitcher, C., Lord, J., and Roberts, L. (1992) Preparation and characterization of recombinant proricin containing an alternative protease-sensitive linker sequence. Bioconjugate Chem. 3, 375-381. (38) Rutenber, E., and Robertus, J. (1991) Structure of ricin B-chain at 2.5 Angstrom resolution. Proteins 10, 260-269. (39) Kitts, P., and Possee, R. (1993) A method for producing recombinant baculovirus expression vectors a t high frequency. BioTechniques 14, 810-816. (40) Mayo, C., and Hallock, R. (1989) Immunoassay based on surface plasmon oscillations. J . Zmmunol. Methods 120,105114. (41) Herschman, H. (1984) The role of binding ligand in toxic hybrid protiens: a comparison of EGF-ricin, EGF-ricin Achain and ricin. Biochem. Biophys. Res. Commun. 124,551557. (42) Taussig, R., Quarmby, L., and Gilman, A. (1993) Regulation of purified type I and type I1 adenylcyclases by G protein subunits. J . Biol. Chem. 268, 9-12. (43) Gearing, K., Gottlicher, M., Teboul, M., Widmark, E., and Gustafsson, J. (1993) Interaction of the peroxisome-proliferator-activated receptor and retinoid X receptor. Proc. Natl. Acad. Sei. U S A . 90, 1440-1444.
