Fabrication of Calcium Phosphate Microflowers and Their Extended

Subscriber access provided by PEPPERDINE UNIV

Article

The Fabrication of Calcium Phosphate Microflowers and their Extended Application in Bone Regeneration Taoran Tian, Jinfeng Liao, Tengfei Zhou, Shiyu Lin, Tao Zhang, Si-Rong Shi, Xiaoxiao Cai, and Yunfeng Lin ACS Appl. Mater. Interfaces, Just Accepted Manuscript • DOI: 10.1021/acsami.7b09176 • Publication Date (Web): 23 Aug 2017 Downloaded from http://pubs.acs.org on August 23, 2017

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

ACS Applied Materials & Interfaces is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 37

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Applied Materials & Interfaces

The Fabrication of Calcium Phosphate Microflowers and their Extended Application in Bone Regeneration Taoran Tian, Jinfeng Liao, Tengfei Zhou, Shiyu Lin, Tao Zhang, Si-Rong Shi, Xiaoxiao Cai, and Yunfeng Lin* State Key Laboratory of Oral Diseases, West China Hospital of Stomatology, Sichuan University, Chengdu, Sichuan Province, P.R. China, 610041 *Correspondence Author: Tel: 86-28-85503487 Fax: 86-28-85503487 Email: [email protected] KEYWORDS: bone regeneration, microflowers, calcium phosphate, osteogenesis, rat calvarial defect model

ACS Paragon Plus Environment

1


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 37

ABSTRACT: The structure of materials is known to play an important role in material function. Nowadays, flower-like structures have gained attention for studies not only in analytical chemistry, but also in biomaterials design. In this study, flower-like structures were applied in bone regeneration in the form of calcium phosphate microflowers. The material was synthesized by a simple and environmentally friendly method. We characterized the structure and properties of the microflower using various methods. Cytotoxicity and osteogenesis-related gene regulations of the microflower were investigated in vitro. Cell uptake was observed by immunofluorescence. Rat calvarial critical-size defect models were successfully established to further confirm the enhanced bone regeneration ability of this material. We expect that this novel study will be of practical importance for the extended application of flower-like materials and provide new insights into the optimization of the morphology of calcium phosphate materials.


2

Page 3 of 37

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Introduction Section Flower-like microstructures refer to hierarchical structures with a flower-like morphology that span many length scales.1 Owing to their specific hierarchical morphologies, the merits of flower-like structures are mainly described as their high surface area, hierarchically structured porosity, and enhanced ability of absorption and confinement.2 Thus, extensive studies and applications of these materials are found in catalysis and analytical science for years.3-6 Considering the merits of flower-like structures, we intend to fabricate a new calcium phosphate microflower and extend its application to the field of tissue engineering.2,7,8 In the process of bone regeneration, scaffold materials not only act as templates and microenvironments, but also act intensively with osteogenesis-related cells via surface interaction.9,10 In the same length scale, cells could behave differently on materials with different morphologies.11,12 The process of angiogenesis of hard tissue is influenced by the extracellular matrix,13,14 and some hierarchical structures could promote biomimetic mineralization while others do not.15 Our interest lies in the way that how a scaffold having a specific flower-like morphology, with a diameter of several micrometers, could influence bone regeneration. To fabricate a material with specific morphology, calcium phosphates (CaP, such as CaHPO4, Ca2P2O7, etc.) could be of use.16 Though widely applied in clinical practice, researchers have been striving to explore a better form of CaP to promote bone regeneration, especially at the nanoscale.17-20 Numerous efforts have been devoted to the controllable preparation of CaP with diverse morphologies and hierarchical structures, such as organic matrix-mediated mineralization,21,22 electrolytic deposition,23 laser deposition,24 and hydrothermal synthesis.25 However, only several methods can be used to fabricate flower-like structures.26-28


3


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 4 of 37

Based on previous literature,27 our group developed a modified one-pot preparation protocol and obtained comparable results. In our method, gelatin was used to form the template nanocomplex upon the addition of the cross-linker tripolyphosphate (TPP). In the process of cross-linking, TPP-hydrolyzed products (mainly phosphate ions) were absorbed by the crosslinked gelatin-TPP nanocomplex. Thereafter, a CaCl2 solution was dropped into the prepared gelatin-TPP nanocomplex template, leading to anisotropic growth of CaP crystals on the gelatinTPP nanocomplex network. During the process, flower-like CaP crystals were formed. To investigate the structure, the successfully obtained CaP microflowers were characterized by scanning electron microscopy (SEM), transmission electron microscopy (TEM), X-ray diffraction (XRD), Fourier transform infrared (FTIR) spectroscopy, and Brunauer-Emmett-Teller (BET) surface area analysis. In addition, we investigated the potential application of CaP microflowers in bone regenerative medicine. Biocompatibility and osteogenesis promotion were verified in vitro, followed by evaluation using rat critical-size calvarial defect models of 5 mm to further elaborate the ability of this material to promote bone healing in vivo. Our study only revealed the tip of the iceberg. Considering the scale-up potential and powder nature of this material, numerous applications could be endowed, such as bone substitute, drug delivery vehicle, and additive biofabrication of bone tissue. In all, the ability of CaP microflowers to induce osteogenic differentiation as well as osteogenesis was scrutinized both in vitro and in vivo. This study could potentially shed light on an innovative CaP structure in bone regenerative medicine and related fields.

Results


4

Page 5 of 37

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Preparation and characterization of the CaP microflowers For the fundamental mechanism of the preparation, Wang’s group has described in details.27 Based on the known reaction process, we developed a modified preparation protocol and received comparable results. The preparation process is illustrated in Scheme 1. The first step is the formation of a nanocomplex made of gelatin and TPP. In this step, one part of TPP served as a cross-linker. By ionotropic cross-linking, the negatively charged TPP ions were combined with the positively charged gelatin modules, forming gelatin-TPP nanocomplexes. Another part of TPP was hydrolyzed, and the products, which were believed to be pyrophosphate and orthophosphate ions, were adsorbed onto the nanocomplex. By the time the CaCl2 solution was dropped into the as-prepared nanocomplex solution, the growth of CaP crystals has begun and was guided by the nanocomplex. Upon the addition of the CaCl2 solution, turbidity was observed, and disappeared immediately upon stirring. The controlled mineralization of the aforementioned microflowers took minutes of stirring in oil bath.


5


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 6 of 37

Scheme 1. The preparation process of flower-like calcium phosphate microstructures. TPP serves not only as cross-linker, but also the provider of phosphate ions (TPP with blue dots, hydrogen ions, represents hydrolyzed TPP). The mineralization process of calcium phosphate (black dots), guided by the gelatin-TPP nanocomplex, final leads to the formation of the flowerlike structure.

Next, different characterization methods were used to investigate the structures and properties of the controllable synthesized microflowers. The morphology of the product was observed by SEM (Figure 1 a, b). A flower-like structure was made up of several nanosheets combined in a rather parallel manner. Gaps (with widths of approximately 0–200 nm) could be seen between two nanosheets, endowing porosity to the flower-like structure. Observed from SEM images, the microflowers were fabricated with an average diameter of 2.70 ± 0.22 µm, and could be stacked together to form clusters. The diameter has also been confirmed by dynamic light scattering (DLS) analysis, which was determined to be 2.91 µm (Pdi: 0.648, data not show). Fragments of microflowers could be seen between well-established ones in small numbers. The structure of microflowers was further observed by TEM (Figure 1 c, d). In the TEM images, nanosheets were attached together in a given order, forming a porous structure with an even higher porosity in the middle of the microflower. An accurate mineralization time was essential for the preparation. Controlling other synthesis procedures, we took samples out after 5 min, 15 min, and 60 min of stirring (Figure 1 e, f, g). SEM images revealed that after 5 min of stirring, microflowers began to form. Nanosheets stuck together and formed numerous biconcave disks. The red blood cell resembled morphology exposed the high porosity area in the middle, as discovered by previous TEM observations. Upon an increase of mineralization time, nanosheets


6

Page 7 of 37

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


filled the biconcave disks and established more well-defined microflowers. When the mineralization time was prolonged to 60 min, aggregates of thick nanosheets appeared and no typical microflowers could be seen. The time-elapsed observation of the mineralization process revealed the growth pattern of the microflowers, and the optimized mineralization time was determined to be 15 min. As compared to the microflowers fabricated by chitosan-TPP nanocomplexes, the dispersibility of the gelatin-TPP origin microflowers was preferable, since they tended to separate from each other rather than aggregating together.

Figure 1. Morphology observation of the microflowers. (a, b) SEM patterns indicate the wellestablished flower-like structure of calcium phosphate as prepared. (c, d) TEM images further reveal a porous structure in the middle of the microsphere. (e, f, g) SEM observation of different mineralization times: e, 5 min; f, 15 min; g, 60 min.

The microflowers were further analyzed by energy-dispersive X-ray spectroscopy (EDS), XRD, and FTIR. EDS patterns and mapping in Figure 2a revealed the elemental distribution and composition of the as-prepared material. The distributions of P, O, and Ca suggested an


7


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 8 of 37

anisotropic growth of CaP crystals. The carbon-rich EDS pattern confirmed the existence of gelatin inside the microflowers. Surface crystal structures were further analyzed by XRD. The patterns in Figure 2b show that the synthesized sample was indexed to the standard patterns of dicalcium pyrophosphate tetrahydrate and tricalcium phosphate (Ca2P2O7·4H2O, PDF #44-0762; Ca3(PO4)2, PDF #09-0169). The peaks of the sample were quite high and narrow, which indicated the superior crystallinity of the sample. The FTIR spectrum of the lyophilized sample is shown in Figure 2c. The bands at 756.0 cm1

and 698.1 cm-1 correspond to symmetrical bridge stretching of the P-O bond (νs POP). The

adsorptions at 1170.6 cm-1 and 1101.2 cm-1 belong to stretching vibrations associated with P-O (νas PO3). In addition, the adsorption at 1004.7 cm-1 is due to symmetrical terminal P-O stretching vibrations (νs PO3).29 The adsorptions at 3430.8 cm-1 and 1645 cm-1 are due to intermolecular and weakly H-bonded OH caused by water of crystallization.30 Bands at 1243 cm-1 and 908.3 cm-1 resulted from the symmetrical stretching vibration of the phosphate group, and the adsorption at 536.1 cm-1 is due to in-plane rocking vibration of the phosphate group.31 Thus, typical FTIR bands of Ca2P2O7 and Ca3(PO4)2 could be clearly identified. N2 adsorption-desorption patterns revealed the pore size distribution and porosity of the microflowers. As displayed in Figure 2d and 2e, the adsorption isotherm was type V, H3 according to Brunauer-Deming-Deming-Teller classification. The presence of a hysteresis loop at lower relative pressure (0.6 < P/P0 < 0.8) indicated that mesoporous structures existed within the microflowers. Along with higher relative pressure, more N2 adsorption was observed, which was probably formed at the interparticle mesoporous and macroporous spaces between microflowers. The adsorption isotherm indicated the existence of a multiple-level pore size distribution, which had biomimetic properties and was beneficial to bone regeneration.32 The


8

Page 9 of 37

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


adsorption isotherm was in accordance with SEM observations. The pores had a wide diameter distribution from 1 nm to 100 nm, with a peak at 15.9 nm. The BET specific surface area was determined to be 21.55 m2/g. The porous and hierarchical nature of the acquired microflowers might endow numerous applications, such as drug and gene delivery.

Figure 1. Characterizations of the prepared microflowers. (a) EDS element mapping and patterns of the prepared microflowers. (b) XRD patterns indicated that the crystal structures of


9


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 10 of 37

the microflowers were mainly composed of Ca2P2O7·4H2O and Ca3(PO4)2. Results are consistent with FTIR spectrum (c). (d, e) Nitrogen absorption-desorption test validated the porosity. Here we have successfully prepared a flower-like CaP structure. With its unique morphology, structural merits, proven biocompatibility, and multi-level porosity, the acquired material might have an influence on the osteogenesis process both in vitro and in vivo.

The influence of the microflower on osteogenesis in vitro Before applying microflowers into animal models, we performed several in vitro experiments to explore the potential influence of microflowers on osteogenesis. Sprague-Dawley (SD) rat mesenchymal stem cells (MSCs) were employed to investigate the cytotoxicity of the CaP microflowers. As we can see in Figure 3, the cytotoxicity was measured by cell counting kit-8 (CCK-8, Dojindo, Kumamoto, Japan) to be acceptable (RGR, relative growth ratio > 90%) at a low microflower concentration (≤50 µg/mL). A steep downward RGR slope was observed when the concentration was increased to 100 µg/mL (with statistically significant difference compared to control, P = 0.0015, n = 4). When the diameter of the CaP materials (CaP coating or CaP particles) was on the scale of micrometers, inhibition of proliferation had been demonstrated by many researchers.33-35 The proliferation properties of osteogenesis-related cells on CaP particles could be influenced by many factors, such as surface charge, diameter, morphology, component, and concentration.36,37 In our study, the toxicity might be contributed by the excessive uptake of the material. Through uncertain uptake mechanism, cells had little control of the amount of uptake, leading to an overdose of CaP material. The hypothesis was based on the microscopic observations of cells incubated with microflowers (Figure S1). Despite the concentrations, annular areas lacking material were formed around osteoblasts after 24 h of


10

Page 11 of 37

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


incubation. On the contrary, the annular areas were not obvious when L929 cells were placed in the same condition. More interestingly, micropinocytosis, which is a non-selective transport mechanism, is believed to be the dominant mechanism for calcium phosphate particles.33 Furthermore, the dose-dependent cytotoxicity could be seen in osteogenesis-related cells such as MSCs and osteoblasts, but not in L929 (Figure S2). The morphologies and particle sizes of different materials might play a role in choosing endocytosis pathways, and different cells might respond differently to a certain material. The selective uptake of CaP microflowers suggests a different uptake mechanism of this flower-like material for osteogenesis-related cells.38,39

Figure 3. Cytotoxicity and qPCR analysis of MSCs. (a) Cytotoxicity of the CaP microflowers


11


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 12 of 37

was measured by CCK-8. A decreasing tendency of viability was recorded when the concentration of the CaP microflowers was above 100 µg/mL. (b, c) Osteogenesis-specific gene expression was measured by qPCR on day 3 and day 14. Fold changes were compared to control (* P < 0.05, ** P < 0.005).

Cell uptake behavior was further confirmed by confocal laser microscopy (Figure 4a). In the first period between 4 to 6 h, fluorescence was not obvious in the cells, while green fluorescence could be clearly observed after incubation for 12 h. The green fluorescence was mainly located around the nuclei. One thing should be noticed is that the concentration of microflower used for the observation was 10 µg/mL, meaning there were not many materials supplied for cells to uptake, to form huge intracellular vesicles, and thereby producing strong fluorescence signal. On the other hand, the green fluorescence appeared after 12 h of incubation did suggest the existence of microflower intracellular transport. Knowing this is important not only for understanding the mechanism of biological functions of microflowers have on cells, but also their potential as drug delivery carriers. Our observations were in accordance with those in previous studies. Schmidt et al. reported a time-dependent approach of CaP nanoshells to the nuclei using 120-nm nanoshells. The average distance of nanoshell clusters from the periphery to the cell nucleus was found to decrease linearly from 12 to 48 h.33 The cell uptake process was further verified by 3D confocal reconstruction (Figure 4b). It is obvious that the green fluorescence of materials covered the entire layer of the cell’s cross-section, suggesting that materials were located in the cells.


12

Page 13 of 37

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 4. Immunofluorescence images reveal the location of microflowers after cell uptake. (a) Confocal microscopy was performed at three time points after adding FITC-labeled


13


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 14 of 37

microflowers into the culture medium. An obvious aggregation of green fluorescence could be seen after 12 h of culture. (b) Three-dimensional reconstructions further verified cell uptake.

Furthermore, the influence on osteogenesis was investigated by evaluating on gene levels. Results are shown in Figure 3b and 3c. Having a known threshold of toxicity from the results of CCK-8 evaluation, a microflower suspension at 10 µg/mL was applied to the growth medium. MSCs were seeded and collected after incubation for 3 days and 14 days. Five osteogenesisrelated genes were analyzed by quantitative real-time PCR. Clear upregulation of RUNX2 and BMP2 were seen on day 3 (P = 0.0045, n = 4; P = 0.0001, n = 4). The nearly four-fold (3.79 ± 0.84) upregulation of RUNX2 indicated an enhanced osteoblast differentiation of the MSCs.40 Considering the observation of cell uptake, microflower uptake occurred in a relatively quick manner. In this way, it is worthy to note the upregulation of RUNX2 by day 3, which means the quick uptake of materials alone, without any other growth factor, at a proper concentration promoted early osteogenesis. On day 14, four of five genes were upregulated with statistically significant differences (n = 3; RUNX2: 1.58 ± 0.34 folds, P = 0.0412; OPN: 4.39 ± 2.75 folds, P = 0.0196; BMP2: 6.24 ± 1.91 folds, P = 0.0089; BMP4: 1.87 ± 0.49 folds, P = 0.0376). Among the genes, osteopontin (OPN) expression was upregulated by 4 folds, suggesting a high biomineralization process due to the effect of the microflowers.41,42

Microflowers promoted healing in rat calvarial critical-size defects The calvarial critical-size defect was established with a 5-mm diameter defect in a rat model. No inflammation or infection was observed during the experimental period. Time points of 4


14

Page 15 of 37

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


weeks and 8 weeks were chosen to evaluate the function of flower-like CaP materials in the early stages of bone healing. Micro-computed tomography (microCT) was applied to measure bone healing. Figure 5a shows reconstructions of two typical samples using blue-white-red scale. The color scale was used to display bone mineral density (BMD) from 10 to 600 mg HA/ccm, providing an intuitive impression of newly formed bone. We could see that bone healing was processed in a centripetal manner. It is obvious that bone formation in the presence of microflowers was better than that in the control group. Besides void areas, it can be seen from the reconstructed images that blue dots (representing tissues with low BMD) in the microflower group stretched from the edge of the void to the center. On the other hand, these same dots were located mainly at the periphery areas in the control group at 4 weeks. The result represented different speeds of bone healing, especially in the early stage. By week 8, the blue-white-red color scale suggested that defects in the microflower group had been covered by immature mineralized tissue, while voids remained in the control group. Quantitative analysis further validated the results (Figure 5b). By week 4, the BMD of newly formed tissues in the control group remained as low as 285.2 ± 41.8 mg HA/ccm. While for defects filled with microflowers, the BMD reached 525.5 ± 114.0 mg HA/ccm with statistically significant difference (P = 0.0266, n = 3) compared with the control group. By week 8, both groups reached a higher BMD value of approximately 600 mg HA/ccm. The strong promotion of bone healing in the early stage in the presence of microflowers is thus exhibited. As for the bone volume/tissue volume (BV/TV) ratio, the same early-stage bone healing could be observed. By week 4, bone filled 31.2 ± 5.42% of the defects in the microflower group, while only 11 ± 3.87% of the defects were restored in the control group (P = 0.0063, n = 3). By week 8, although the


15


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 16 of 37

percentages were of significant difference (P = 0.0135, n = 3), the bone healing process slowed down, as a further 4.9% of the defects were filled in the experimental group while another 6.5% were filled in the control group. Combined with the reconstruction observations, the materials seemed to strongly promote bone formation in the early stage (4 weeks).

Figure 5. MicroCT analysis of rat calvarial critical-size defects. (a) Reconstruction of calvarial bones. BMD from 10 to 600 mg HA/ccm were reconstructed by blue-white-red scale. Red circles indicate original defects of 5 mm. (b) Quantitative analysis of samples acquired. (* P < 0.05)

The histological observation consisted of hematoxylin-eosin (H&E) and Masson’s Trichrome staining. No significant sign of inflammatory reaction or immunologic response was noticed in either group. As we can see, all defects were healing from the edge to the center in a


16

Page 17 of 37

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


centripetal manner. Furthermore, defects that were filled with microflowers healed more quickly than those in the control group. For H&E staining, the interruption of bone tissue continuity made it easy to identify the original defect margins, which are marked by blue dashed lines in Figure 6. For defects filled with microflowers, extensive bone regeneration occurred in 4 weeks. No significant sign of material residue can be identified. A bony bridge began to form, while some connective tissue remained in the middle of the defect. The existence of plenty of blood vessels as well as newly formed trabeculae aligned by osteoblasts suggested that active new bone formation occurred in the first 4 weeks.43 However, in the control group, defects were filled mainly by dense granulation tissue. After 8 weeks of healing, a bony bridge appeared to connect the defect margins, and more mature bone structures could be identified. Cortical-like lamellar bone combined with woven bone and bone marrow space appeared. On the contrary, limited new bone formation was observed in the margin area of the control defect, which was mainly filled with connective tissues. Masson’s Trichrome staining further confirmed the extent of new bone formation and maturation (Figure 7). In the control group, defects mainly became blue-stained fibrous tissues. In the microflowers group, newly formed woven bone (blue-stained) filled large areas of the defect at week 4. At week 8, more arranged bone structures obviously appeared (as red-stained cortical-like lamella bone and blue-stained woven bone located at the middle of newly formed bone). H&E and Masson’s Trichrome staining both confirmed the enhanced bone regeneration ability of the microflowers. In defects filled with microflowers, bone tissue formed more quickly, and mature bone structures can be identified in 8 weeks. The histological observations were in


17


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 18 of 37

accordance with the microCT results. However, it should be aware that although no abnormality was observed in existing histological examinations, owing to the quick-degradation of this material, no direct assessment data regarding biocompatibility of the microflower could be acquired. It should also be noted that our current work did not approach to the mechanical properties of the regenerated calvarial bone.44-46 All of these might set limitations as well as future potential research opportunities to scale the real application of microflowers in vivo.

Figure 6. Histological evidence of H&E staining for enhanced bone healing. Blue dashed lines indicate defect margins. (a) Middle of defect in control group. (b) Margin of defect in control group. (c) Middle of defect filled with microflowers. (d) Margin of defect filled with microflowers. ct, connective tissue; rb, regenerated bone; hb, host bone; bm, bone marrow. Black arrow, blood vessels.


18

Page 19 of 37

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 7. Masson’s Trichrome staining of early-stage bone formation. Blue dashed lines in panoramic views indicate defect margins. (a) High magnification of defect in control group. (b) High magnification of defect in defect filled with microflowers.

Discussion Flower-like structures are known as promising biomaterials because of their high surface area, hierarchically structured porosity, and enhanced ability of adsorption and confinement. Based on these characteristics, previous studies mainly focused on dye absorption, enzyme


19


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 20 of 37

immobilization and protection, and drug delivery.27,47 Combining flower-like structures with CaP materials, our study has innovatively applied this structure in bone regeneration. First, we successfully prepared CaP microspheres with specialized flower-like morphology. As observed by XRD and FTIR, the prepared material was mainly composed of Ca2P2O7·4H2O and Ca3(PO4)2, which were proven to have osteoinductive and osteoconductive abilities.48 SEM images showed that nanoflakes were highly organized and assembled into 3D structures to form microflowers. The aggregated structure gave rise to slit-shaped pores, which contributed to the pore distribution (ranging from 10 nm to 100 nm) and BET specific surface area of 21.55 m2/g.52,53 Furthermore, the scale-up potential of this material was also verified in our study. Both in vitro and in vivo experiments suggested that this flower-like CaP material had the potential to promote osteogenesis. Through an uncertain mechanism, microflowers could enter osteogenesis-related cells and cause dose-dependent cytotoxicity, which is assumed to be a result of an over-uptake of CaP microflowers. Nonetheless, whether material uptake occurs in an active transport mechanism requires further studies.38 On the contrary, within a controlled concentration, microflowers could promote osteogenesis and osteogenic differentiation. By qPCR analysis, we documented gene upregulation of RUNX2 and BMP2 by day 3, and of RUNX2, OPN, BMP2, and BMP4 by day 14. It is important to note that the upregulation of these osteogenic genes occurred at a relatively low microflower concentration (10 µg/mL).35,54 Furthermore, the healing process in the rat critical-size defect model suggested that defects filled with microflowers, without any cytokines or cells, tended to heal faster compared with the controls, especially in the early stage of bone healing. MicroCT analysis revealed that the BMD of regenerated tissues was higher in defects filled with microflowers compared with the controls, indicating an earlier and quicker mineralization process induced by the material. As observed at


20

Page 21 of 37

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


week 4, 31.2 ± 5.42% of the void was regenerated in defects filled with microflowers, which was comparable to and even higher than the results reported in existing literatures.49-51 Histological observations were in accordance with our microCT results. In the defects filled with microflowers, H&E staining indicated the presence of numerous blood vessels and osteoblasts in regenerated tissues. Masson’s Trichrome staining further revealed tenser and more mature collagen alignment at both time points. In defects with voids, spaces were mainly filled by connective tissues.

Conclusions In this work, we have successfully extended the application of flower-like structures to the field of bone regenerative medicine. Using well-prepared CaP microflowers, we have demonstrated osteogenesis promotion both in vitro and in vivo. At appropriate concentrations, the CaP microflowers can serve as a stimulus promoting osteogenesis in vitro. The microflowers alone, without any cells or cytokines, could serve as a scaffold material and boost bone healing. Combined with the drug loading capacity, the multi-functional CaP microflowers show numerous potentials in regenerative medicine. Nevertheless, the comparisons with other wellestablished materials, such as bovine xenografts, need to be further explored. Notwithstanding its limitation, this study offers insights into the morphology optimization of CaP materials and provides a glimpse into the potential of flower-like structures in bone regeneration. The facile, environmentally friendly preparation process and scale-up potential of this material may endow more practical attempts in future studies and applications.


21


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 22 of 37

Experimental Section Fabrication and characterization of CaP microflowers The CaP microflowers were prepared according to a previously reported method with modifications.27 Gelatin solution was acquired by dissolving 6 mg of gelatin into 3 mL of H2O. After that, 1.2 mL of TPP solution at 100 mg/mL was added into the gelatin solution upon stirring for 10 min at 15 °C. As mentioned by previous studies, TPP could hydrolyze into pyroand orthophosphate ions (P2O74-, PO43-) in aqueous solution, and thereby provide phosphate ions for following reactions.55,56 The resulting solution was then transferred into an oil bath at 30 °C, and 4.2 mL of 100 mM CaCl2 solution was dropped into the mixture with stirring. After 15 min, the microflowers were acquired by centrifugation at 764 ×g for 5 min. The preparation process is facile and environmentally friendly. The morphology of the prepared microflowers was observed by SEM (HITACHI S-4800, Tokyo, Japan) at an accelerating voltage of 20 kV.57 TEM images were recorded on a JEM2100F microscope with a field-emissive gun operated at 200 kV and with a point resolution of 0.24 nm. The structure of the CaP microflowers was analyzed via an X’Pert Pro X-ray diffractometer (Philip, Netherlands) with Cu Kα1 radiation (λ = 1.5406 Å). The diffraction patterns were obtained in the range of 10° < 2θ < 80° in step scans at 0.02° per step and 2° per min. The surface properties and composition of the CaP materials were recorded by FTIR spectroscopy in the range of 4000–400 cm-1 on a Thermo Nicolet IS10 FTIR spectrometer using a KBr pellet. The BET surface areas of the materials were measured by N2 adsorption at the liquid-nitrogen temperature (77 K). The CaP microflowers were pretreated at 300 °C for 3 h in vacuum, and a surface area analyzer (Quantachrome Autosorb-1) was used to determine the BET surface areas.


22

Page 23 of 37

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Cell culture Five-day-old SD rats were bought from the Sichuan University Animal Experimental Center to collect rat osteoblasts. The animal ethics guidelines were followed in all operational processes. Osteoblasts were collected from calvarias and cultured under a standard humidified atmosphere of 5% CO2 at 37 °C. Regular growth medium consisted of Dulbecco’s Modified Eagle Medium with high glucose (Hyclone, Pittsburgh, USA), 10% fetal bovine serum, and 100 U/mL penicillin/streptomycin (Hyclone, Pittsburgh, USA). MSCs were purchased from Cyagen (Cyagen, Santa Clara, USA) and cultured in the same humidified atmosphere using OriCellTM MSC Growth Medium (Cyagen, Santa Clara, USA).

Cytotoxicity assay Cells were seeded on a 96-well plate at a density of 5000 cells/well. After incubation for 24 h, growth medium was replaced by microflower suspensions at different concentrations (0 µg/mL, 1 µg/mL, 5 µg/mL, 10 µg/mL, 15 µg/mL, 20 µg/mL, 50 µg/mL, 100 µg/mL, 200 µg/mL, 400 µg/mL, and 600 µg/mL). After incubation for another 24 h, cell activities were measured by CCK-8 according to the manufacturer’s instructions.58

Immunofluorescence of CaP microflower uptake Confocal laser microscopy was used to examine osteoblastic uptake of CaP microflowers after 4, 6, and 12 h of incubation. The osteoblasts were chosen for they play a critical and direct role in the process of bone healing. As terminally differentiated cells of MSCs, osteoblasts make up the majority of cellular component of bone. In brief, osteoblasts were cultured in glass-


23


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 24 of 37

bottom dishes in regular growth medium for 24 h, and then the medium was replaced by an FITC-labeled microflower suspension of 10 µg/mL. The FITC-labeled microflower suspension was prepared by mixing the microflowers in FITC solution (H2O, 20 µg/mL) for 24 h following centrifugation and washing (764 ×g for 5 min). After further incubation for 4, 6, and 12 h, cells were rinsed with PBS for 15 min. Cold paraformaldehyde solution (4%) was used to fix the treated cells. Then, 0.5% Triton X-100 was used to permeabilize the osteoblasts for 10 min. Thereafter, the cells were washed with PBS and blocked with 5% sheep serum at 37 °C for 1 h. Phalloidin was used to stain F-actin for 15 min, and DAPI was used to stain the nuclei for 10 min. Finally, images were captured using a confocal laser microscope (TCS SP8; Leica, Wetzlar, Germany).59

Quantitative real-time PCR Considering the importance of osteogenic differentiation of stem cells in the early stage of bone healing, MSCs were applied for qPCR analysis. MSCs were cultured in a microflower suspension (MSC Growth Medium, 10 µg/mL) for 3 and 14 days before RNA was collected using the RNeasy Plus Mini Kit (Qiagen, Venlo, Netherlands) with a genomic DNA eliminator. The purified total RNA of each sample was applied to prepare cDNA using a cDNA synthesis kit (Mbi, Glen Burnie, MD, USA) in a final volume of 20 µL. Following the manufacturer’s protocol, quantitative real-time PCR was carried out with the SYBR Premix Ex Taq II PCR Kit (TAKARA, Shiga, Japan) using iCycler (Bio-Rad, Munich, Germany). The final 25-µL reaction mix contained 1 µmol/L of the forward and reverse primers (Table 1) and 2 µL of sample cDNA.60 The reaction was initiated by activating the polymerase with pre-incubation for 5 s at 95 °C, followed by 39 cycles of denaturation for 5 s at 95 °C, annealing for 30 s at 60 °C, and


24

Page 25 of 37

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


extension for 5 s at 72 °C to achieve amplification. The copy numbers of each gene were determined by the cycle threshold (∆CT) method using glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as the internal control and normalized standard.61 Table 1. Primers used in real-time RT-PCR analysis. Genes

Forward primers

Reverse primers

GAPDH

TGGCCTCCAAGGAGTAAGAA

TGTGAGGGAGATGCTCAGTG

RUNX2

CCGAACTGGTCCGCACCGAC

CTTGAAGGCCACGGGCAGGG

ALP

CCTGACTGACCCTTCCCTCT

CAATCCTGCCTCCTTCCACT

OPN

GATCGATAGTGCCGAGAAGC

TGAAACTCGTGGCTCTGATG

BMP2

TCAAGCCAAACACAAACAGC

CCACGATCCAGTCATTCCA

BMP4

GACTTCGAGGCGACACTTCT

AGCCGGTAAAGATCCCTCAT

Evaluation of bone regeneration using the rat critical-size calvarial defect All of the experiments performed were approved by the Subcommittee on Research and Animal Care of Sichuan University. The establishment of rat critical-size calvarial defects was under the guidance of Patrick’s protocol.62 Six 12-week-old male Sprague-Dawley rats (average weight: 300–350 g) were purchased from the Sichuan University Animal Experimental Center. The sample size was chosen according to previous studies.63,64 Upon arrival, the animals were kept under a controlled environment and fed with a standard diet for seven days. Animals were randomly divided into two groups. After general anesthesia, a partial area of the rat from the bridge of the snout between the eyes to the caudal end of the calvarium was shaved and cleaned. The rats were then transferred onto a heating pad set to 37 °C during operation. Local anesthesia


25


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 26 of 37

was applied with 0.5 mL of 1% (wt/vol) lidocaine with 1:100000 epinephrine. A 1.5-cm incision was then made down to the periosteum using a scalpel. Thereafter, the periosteum covering the calvarium was sharply divided down the midline. The calvarium was revealed by gently pushing the periosteum laterally. Using a trephine, two symmetrical full-thickness calvarial bone defects of 5 mm were created on the flat surfaces between the coronal and lambdoid sutures of the cranium. The trephine operated at 1500 rpm under saline irrigation. The defects were then filled with CaP microflower powder or left empty as controls. Thereafter, the periosteum and skin were closed separately using interrupted sutures. Penicillin at 10000 U/day was administered to all animals immediately after surgery and continued for three days. Three animals were sacrificed by barbiturate overdose after 4 and 8 weeks. The calvarium of each rat was excised, trimmed, and fixed in 10% neutral-buffered formalin at 4 °C. Bone formation within the defects was quantitatively evaluated by high-resolution microCT imaging. After fixation, specimens were scanned using a Scanco Medical µCT 50 system (Scanco Medical AG, Brüttisellen, Switzerland) at a spatial resolution of 15 µm (1-mm aluminum filter, 100 kV, 100 mA) ad 500 projections/180°. A blue-white-red color scale reconstruction was made to present BMD ranging from 10 to 600 mg HA/ccm, providing a precise impression on early bone healing and subsequent mineralization. For quantitative analysis, a cylindrical area of approximately 5 mm in diameter and 1 mm in height was chosen as the volume of interest (VOI) after volumetric reconstruction using built-in software. BMD as well as BV/TV percentages were analyzed within the selected VOIs. Immediately after microCT imaging, all specimens were decalcified and embedded in paraffin. Sections were made and subjected to H&E and Masson’s Trichrome staining.


26

Page 27 of 37

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Observation and documentation were carried out by Scanscope CS (Aperio, CA, USA), images were captured using ImageScope software.

Statistical analysis All values were represented in the form of mean ± SD. Independent Student’s t-test (two-tailed) was applied to analyze statistical significance. Statistical significance was confirmed when a Pvalue of less than 0.05 was calculated. NOTES: The authors declare no competing financial interest.

ACKNOWLEDGMENT This study was supported by the National Natural Science Foundation of China (81671031, 81402860) and Sichuan Province Youth Science and Technology Innovation Team (2014TD0001).

ABBREVIATIONS CaP, calcium phosphate, such as CaHPO4, Ca2P2O7, etc. TPP, tripolyphosphate. FITC, fluorescein isothiocyanate. CCK8, cell counting kit 8. SD, Sprague-Dawley rat. MSC, mesenchymal stem cell. RGR, relative growth ratio.


27


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 28 of 37

GAPDH, glyceraldehyde-3-phosphate dehydrogenase. RUNX2, runt-related transcription factor 2. OPN, osteopontin. BMD, bone mineral density. BV/TV, bone volume/tissue volume.

Supporting Information Optical microscopic observation of osteoblasts incubated with microflower suspensions, cytotoxicity of microflower to osteoblasts and L929 cells.


28

Page 29 of 37

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


REFERENCES 1.

Kharisov, B. I. A Review for Synthesis of Nanoflowers. Recent Pat. Nanotechnol. 2008, 2, 190–200.

2.

Wang, K. W.; Zhu, Y. J.; Chen, X. Y.; Zhai, W. Y.; Wang, Q.; Chen, F.; Chang, P. J.; Duan, Y. R. Flower-like Hierarchically Nanostructured Hydroxyapatite Hollow Spheres: Facile Preparation and Application in Anticancer Drug Cellular Delivery. Chem. Asian J. 2010, 5, 2477–2482.

3.

Zeng, J.; Xia, Y. Hybrid nanomaterials. Not Just a Pretty Flower. Nat. Nanotechnol. 2012, 7, 415–416.

4.

Xu, H.; Li, Q.; Zhang, L.; Zeng, B.; Deng, D.; Lv, Y. Transient Cataluminescence on Flowerlike MgO for Discrimination and Detection of Volatile Organic Compounds. Anal. Chem. 2016, 88, 8137–8144.

5.

Zhang, L.; Wang, W.; Chen, Z.; Zhou, L.; Xu, H.; Zhu, W. Fabrication of Flower-like Bi2WO6 Superstructures as High Performance Visible-Light Driven Photocatalysts. J. Mater. Chem. 2007, 17, 2526–2532.

6.

Ge, J.; Lei, J.; Zare, R. N. Protein-Inorganic Hybrid Nanoflowers. Nat. Nanotechnol. 2012, 7, 428–432.

7.

Tian, T.; Guo, B.; Liao, J.; Zhang, T.; Ma, Q.; Zhang, Q.; Cai, X. Characterization, Specific Demand and Application of Nanomaterials in Bone Regeneration. J. Nanosci. Nanotechnol. 2016, 16, 9381–9392.

8.

Park, J. K.; Kim, Y. J.; Yeom, J.; Jeon, J. H.; Yi, G. C.; Je, J. H.; Hahn, S. K. The Topographic

Effect

of

Zinc

Oxide

Nanoflowers

on

Osteoblast

Growth

and

Osseointegration. Adv. Mater. 2010, 22, 4857-4861.


29


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

9.

Page 30 of 37

Zhang, T.; Gong, T.; Xie, J.; Lin, S.; Liu, Y.; Zhou, T.; Lin, Y. Softening Substrates Promote Chondrocytes Phenotype via RhoA/ROCK Pathway. ACS Appl. Mater. Interfaces 2016, 8, 22884–22891.

10. Liao, J; Cai, X; Tian, T.; Shi, S.; Xie, X.; Ma, Q.; Li, G.; Lin, Y. The Fabrication of Biomimetic Biphasic CAN-PAC Hydrogel with a Seamless Interfacial Layer Applied in Osteochondral Defect Repair. Bone Res. 2017, 5, 17018. 11.

Kalia, P.; Vizcay-Barrena, G.; Fan, J. P.; Warley, A.; Di, S. L.; Huang, J. Nanohydroxyapatite Shape and Its Potential Role in Bone Formation: An Analytical Study. J. R. Soc., Interface 2014, 11, 20140004.

12. Schürmann, M.; Wolff, A.; Widera, D.; Hauser, S.; Heimann, P.; Hütten, A.; Kaltschmidt, C.; Kaltschmidt, B. Interaction of Adult Human Neural Crest-Derived Stem Cells with A Nanoporous Titanium Surface Is Sufficient to Induce Their Osteogenic Differentiation. Stem Cell Res. 2014, 13, 98–110. 13. Xue, C.; Xie, J.; Zhao, D.; Lin, S.; Zhou, T.; Shi, S.; Shao, X.; Lin, Y.; Zhu, B.; Cai, X. The JAK/STAT3 Signalling Pathway Regulated Angiogenesis in An Endothelial Cell/AdiposeDerived Stromal Cell Co-Culture, 3D Gel Model. Cell Prolif. 2017, DOI: 10.1111/cpr.12307. 14. Zhao, D.; Xue, C.; Lin, S.; Shi, S.; Li, Q.; Liu, M.; Cai, X.; Lin, Y. Notch Signaling Pathway Regulates Angiogenesis via Endothelial Cell in 3D Co-Culture Model. J. Cell. Physiol. 2017, 232, 1548–1558. 15. Newcomb, C. J.; Bitton, R.; Velichko, Y. S.; Snead, M. L.; Stupp, S. I. The Role of Nanoscale Architecture in Supramolecular Templating of Biomimetic Hydroxyapatite Mineralization. Small 2013, 8, 2195–2202.


30

Page 31 of 37

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


16. Barrère, F.; van Blitterswijk, C. A.; de Groot, K. Bone Regeneration: Molecular and Cellular Interactions with Calcium Phosphate Ceramics. Int. J. Nanomed. 2006, 1, 317–332. 17. Cai, Y.; Tang, R. Calcium Phosphate Nanoparticles in Biomineralization and Biomaterials. J. Mater. Chem. 2008, 18, 3775–3787. 18. Nejadnik, M. R.; Yang, X.; Bongio, M.; Alghamdi, H. S.; Van den Beucken, J. J.; Huysmans, M. C.; Jansen, J. A.; Hilborn, J.; Ossipov, D.; Leeuwenburgh, S. C. Self-Healing Hybrid Nanocomposites Consisting of Bisphosphonated Hyaluronan and Calcium Phosphate Nanoparticles. Biomaterials 2014, 35, 6918–6929. 19. Ardeshirylajimi, A.; Farhadian, S.; Jamshidi Adegani, F.; Mirzaei, S.; Soufi Zomorrod, M.; Langroudi, L.; Doostmohammadi, A.; Seyedjafari, E.; Soleimani, M. Enhanced Osteoconductivity of Polyethersulphone Nanofibres Loaded with Bioactive Glass Nanoparticles in In Vitro and In Vivo Models. Cell Prolif. 2015, 48, 455–464. 20. Gong, T.; Xie, J.; Liao, J.; Zhang, T.; Lin, S.; Lin, Y. Nanomaterials and Bone Regeneration. Bone Res. 2015, 3, 123–129. 21. Gajjeraman, S.; Narayanan, K.; Hao, J.; Qin, C.; George, A. Matrix Macromolecules in Hard Tissues Control the Nucleation and Hierarchical Assembly of Hydroxyapatite. J. Biol. Chem. 2007, 282, 1193–1204. 22. Liu, Y.; Mai, S.; Li, N.; Yiu, C. K.; Mao, J.; Pashley, D. H.; Tay, F. R. Differences Between Top-Down and Bottom-Up Approaches in Mineralizing Thick, Partially Demineralized Collagen Scaffolds. Acta Biomater. 2011, 7, 1742–1751. 23. Kazemzadeh-Narbat, M.; Kindrachuk, J.; Duan, K.; Jenssen, H.; Hancock, R. E.; Wang, R. Antimicrobial Peptides on Calcium Phosphate-Coated Titanium for The Prevention of Implant-Associated Infections. Biomaterials 2010, 31, 9519–9526.


31


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 32 of 37

24. Kim, H.; Camata, R. P.; Chowdhury, S.; Vohra, Y. K. In Vitro Dissolution and Mechanical Behavior of C-Axis Preferentially Oriented Hydroxyapatite Thin Films Fabricated by Pulsed Laser Deposition. Acta Biomater. 2010, 6, 3234–3241. 25. Mi, P.; Kokuryo, D.; Cabral, H.; Kumagai, M.; Nomoto, T.; Aoki, I.; Terada, Y.; Kishimura, A.; Nishiyama, N.; Kataoka, K. Hydrothermally Synthesized PEGylated Calcium Phosphate Nanoparticles Incorporating Gd-DTPA for Contrast Enhanced MRI Diagnosis of Solid Tumors. J. Controlled Release 2014, 174, 63–71. 26. Kovach, I.; Kosmella, S.; Prietzel, C.; Bagdahn, C.; Koetz, J. Nano-porous Calcium Phosphate Balls. Colloids Surf. B. Biointerfaces 2015, 132, 246–252. 27. Wang, X.; Shi, J.; Li, Z.; Zhang, S.; Wu, H.; Jiang, Z.; Yang, C.; Tian, C. Facile One-Pot Preparation of Chitosan/Calcium Pyrophosphate Hybrid Microflowers. ACS Appl. Mater. Interfaces 2014, 6, 14522–14532. 28. Zheng, J.; Xiao, W.; Fan, Y.; Xu, X.; Zhang, K.; Xie, D.; Luo, R.; Yang, X.; Chen, B. ElectroDeposited Calcium Phosphate Compounds on Graphene Sheets: Blossoming flowers. Mater. Lett. 2016, 179, 122–125. 29. Ming, C. Q.; Greish, Y. Crystallization Behavior of Silica-Calcium Phosphate Biocomposites: XRD and FTIR Studies. J. Mater. Sci. Mater. Med. 2004, 15, 1227–1235. 30. Joshi, V. S.; Joshi, M. J. FTIR Spectroscopic, Thermal and Growth Morphological Studies of Calcium Hydrogen Phosphate Dihydrate Crystals. Cryst. Res. Technol. 2010, 38, 817–821. 31. Taş, A. C. Molten Salt Synthesis of Calcium Hydroxyapatite Whiskers. J. Am. Ceram. Soc. 2001, 84, 295–300. 32. Ma, P. X. Biomimetic Materials for Tissue Engineering. Adv. Drug Del. Rev. 2008, 60, 184– 198.


32

Page 33 of 37

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


33. Schmidt, S. M.; Moran, K. A.; Tweed Kent, A. M.; Slosar, J. L.; Webber, M. J.; McCready, M. J.; Deering, C.; Veranth, J. M.; Ostafin, A. Uptake of Calcium Phosphate Nanoshells by Osteoblasts and Their Effect on Growth and Differentiation. J. Biomed. Mater. Res., Part A 2008, 87, 418–428. 34. Guo, X.; Gough, J. E.; Xiao, P.; Liu, J.; Shen, Z. Fabrication of Nanostructured Hydroxyapatite and Analysis of Human Osteoblastic Cellular Response. J. Biomed. Mater. Res., Part A 2007, 82, 1022–1032. 35. Shi, Z.; Huang, X.; Cai, Y.; Tang, R.; Yang, D. Size Effect of Hydroxyapatite Nanoparticles on Proliferation and Apoptosis of Osteoblast-Like Cells. Acta Biomater. 2009, 5, 338–345. 36. Yi, H.; Ur Rehman, F.; Zhao, C.; Liu, B.; He, N. Recent Advances in Nano Scaffolds for Bone Repair. Bone Res. 2016, 4, 16050. 37. Shao, X. R.; Wei, X. Q.; Song, X.; Hao, L. Y.; Cai, X. X.; Zhang, Z. R.; Peng, Q.; Lin, Y. F. Independent Effect of Polymeric Nanoparticle Zeta Potential/Surface Charge, on Their Cytotoxicity and Affinity to Cells. Cell Prolif. 2015, 48, 465–474. 38. Sokolova, V.; Kozlova, D.; Knuschke, T.; Buer, J.; Westendorf, A. M.; Epple, M. Mechanism of The Uptake of Cationic and Anionic Calcium Phosphate Nanoparticles by Cells. Acta Biomater. 2013, 9, 7527–7535. 39. Ardeshirylajimi, A.; Mossahebimohammadi, M.; Vakilian, S.; Langroudi, L.; Seyedjafari, E.; Atashi, A.; Soleimani, M. Comparison of Osteogenic Differentiation Potential of Human Adult Stem Cells Loaded on Bioceramic-Coated Electrospun Poly (L-Lactide) Nanofibres. Cell Prolif. 2015, 48, 47–58. 40. Bruderer, M.; Richards, R.; Alini, M.; Stoddart, M. Role and Regulation of RUNX2 in Osteogenesis. Eur. Cells Mater. 2014, 28, 269–286.


33


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 34 of 37

41. Wu, Y.; Xia, L.; Zhou, Y.; Xu, Y.; Jiang, X. Icariin Induces Osteogenic Differentiation of Bone Mesenchymal Stem Cells in A MAPK-Dependent Manner. Cell Prolif. 2015, 48, 375–384. 42. Wu, M.; Chen, G.; Li, Y. P. TGF-Beta and BMP Signaling in Osteoblast, Skeletal Development, and Bone Formation, Homeostasis and Disease. Bone Res. 2016, 4, 16009. 43. Liu, W.; Kang, N.; Dong, Y.; Guo, Y.; Zhao, D.; Zhang, S.; Zhou, L.; Seriwatanachai, D.; Liang, X.; Yuan, Q. Effect of Resorbable Collagen Plug on Bone Regeneration in Rat Critical-Size Defect Model. Implant Dent. 2016, 25, 163–170. 44. Lohmann, P.; Willuweit, A.; Neffe, A. T.; Geisler, S.; Gebauer, T. P.; Beer, S. Bone regeneration induced by a 3D architectured hydrogel in a rat critical-size calvarial defect. Biomaterials. 2017, 113, 158-169. 45. Zhang, Y.; Cui, Z.; Kong, H.; Xia, K.; Pan, L.; Li, J. One-shot immunomodulatory nanodiamond agents for cancer immunotherapy. Adv. Mater. 2016, 28, 2699-2708. 46. Ju, W.; Hao, S.; Luo, T.; Tao, Z.; Xin, Y.; Wang, B. Keratose/poly (vinyl alcohol) blended nanofibers: fabrication and biocompatibility assessment. Mater. Sci. Eng., C. 2017, 72, 212. 47. Pon-On, W.; Charoenphandhu, N.; Teerapornpuntakit, J.; Thongbunchoo, J.; Krishnamra, N.; Tang, I. M. In Vitro Study of Vancomycin Release and Osteoblast-Like Cell Growth on Structured Calcium Phosphate-Collagen. Mater. Sci. Eng., C 2013, 33, 1423–1431. 48. Elliott, J. C. Calcium Phosphate Biominerals. Rev. Mineral. Geochem. 2002, 48, 427–453. 49. Dasgupta, S.; Bandyopadhyay, A.; Bose, S. Reverse Micelle Mediated Synthesis of Calcium Phosphate Nanocarriers for Controlled Release of Bovine Serum Albumin (BSA). Acta Biomater. 2009, 5, 3112–3121. 50. Gérvas, J. Synthesis and Characterisation of Magnesium Substituted Calcium Phosphate


34

Page 35 of 37

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Bioceramic Nanoparticles Made via Continuous Hydrothermal Flow Synthesis. J. Mater. Chem. 2008, 18, 5900–5908. 51. Hu, Q.; Tan, Z.; Liu, Y.; Tao, J.; Cai, Y.; Zhang, M.; Pan, H.; Xu, X.; Tang, R. Effect of Crystallinity of Calcium Phosphate Nanoparticles on Adhesion, Proliferation, and Differentiation of Bone Marrow Mesenchymal Stem Cells. J. Mater. Chem. 2007, 17, 4690–4698. 52. Zhao, S.; Zhang, J.; Zhu, M.; Zhang, Y.; Liu, Z.; Tao, C.; Zhu, Y.; Zhang, C. ThreeDimensional Printed Strontium-Containing Mesoporous Bioactive Glass Scaffolds for Repairing Rat Critical-Sized Calvarial Defects. Acta Biomater. 2015, 12, 270–280. 53. Bateman, J. P.; Safadi, F. F.; Susin, C.; Wikesjö, U. M. Exploratory Study on The Effect of Osteoactivin on Bone Formation in The Rat Critical-Size Calvarial Defect Model. J. Periodontal Res. 2012, 47, 243–247. 54. Pripatnanont, P.; Praserttham, P.; Suttapreyasri, S.; Leepong, N.; Monmaturapoj, N. Bone Regeneration

Potential

of

Biphasic

Nanocalcium

Phosphate

with

High

Hydroxyapatite/Tricalcium Phosphate Ratios in Rabbit Calvarial Defects. Int. J. Oral Maxillofac. Implants. 2015, 31, 294–303. 55. Kandori, K.; Noguchi, Y.; Fukusumi, M.; Morisada, Y. Preparation of Spherical and Balloonlike

Calcium

Phosphate

Particles

from

Forced

Hydrolysis

of

Ca(OH)2−Triphosphate Solution and Their Adsorption Selectivity of Water. J. Phys. Chem. C 2010, 114, 6440−6445. 56. Lampronti, G. I.; Artioli, G.; Oliva, L.; Ongaro, A.; Maretto, S.; Bonino, F.; Barbera, K.; Bordiga, S. Role of Phosphate Species and Speciation Kinetics in Detergency Solutions. Ind. Eng. Chem. Res. 2012, 51, 4173−4180.


35


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 36 of 37

57. Fu, N.; Liao, J.; Lin, S.; Sun, K.; Tian, T.; Zhu, B.; Lin, Y. PCL-PEG-PCL Film Promotes Cartilage Regeneration in Vivo. Cell Prolif. 2016, 49, 729–739. 58. Shao, X.; Lin, S.; Peng, Q.; Shi, S.; Wei, X.; Zhang, T.; Lin, Y. Tetrahedral DNA Nanostructure: A Potential Promoter for Cartilage Tissue Regeneration via Regulating Chondrocyte Phenotype and Proliferation. Small 2017, DOI: 10.1002/smll.201602770. 59. Shi, S.; Qiang, P.; Shao, X.; Jing, X.; Lin, S.; Tao, Z.; Li, Q.; Li, X.; Lin, Y. Self-Assembled Tetrahedral DNA Nanostructures Promote Adipose-Derived Stem Cell Migration via lncRNA XLOC 010623 and RHOA/ROCK2 Signal Pathway. ACS Appl. Mater. Interfaces 2016, 8, 19353–19363. 60. Shi, S.; Xie, J.; Zhong, J.; Lin, S.; Zhang, T.; Sun, K.; Fu, N.; Shao, X.; Lin, Y. Effects of Low Oxygen Tension on Gene Profile of Soluble Growth Factors in Co-Cultured AdiposeDerived Stromal Cells and Chondrocytes. Cell Prolif. 2016, 49, 341–351. 61. Zhong, J.; Guo, B.; Xie, J.; Deng, S.; Fu, N.; Lin, S.; Li, G.; Lin, Y.; Cai, X. Crosstalk Between Adipose-Derived Stem Cells and Chondrocytes: When Growth Factors Matter. Bone Res. 2016, 4, 15036. 62. Spicer, P. P.; Kretlow, J. D.; Young, S.; Jansen, J. A.; Kasper, F. K.; Mikos, A. G. Evaluation of Bone Regeneration Using the Rat Critical Size Calvarial Defect. Nat. Protoc. 2012, 7, 1918–1929. 63. Ma, X.; Wang, Y.; Guo, H.; Wang, J. Nano-Hydroxyapatite/Chitosan Sponge-Like Biocomposite For Repairing of Rat Calvarial Critical-Sized Bone Defect. J. Bioact. Compat. Polym. 2011, 26, 335–346. 64. Tiwari, J. N.; Seo, Y. K.; Yoon, T.; Wang, G. L.; Cho, W. J.; Yousuf, M.; Harzandi, A. M.; Kang, D. S.; Kim, K. Y.; Suh, P. G. Accelerated Bone-Regeneration by Two Photon


36

Page 37 of 37

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Photoactivated Carbon Nitride Nanosheets. ACS Nano 2017, 11, 742–751.

Graphic Abstract


37

Fabrication of Calcium Phosphate Microflowers and Their Extended

Recommend Documents