Fabrication of multiple-layered hydrogel scaffolds with elaborate

Subscriber access provided by La Trobe University Library

Applications of Polymer, Composite, and Coating Materials

Fabrication of multiple-layered hydrogel scaffolds with elaborate structure and good mechanical properties via 3D-printing and ionic reinforcement Xiaotong Wang, Changzheng Wei, Bin Cao, Lixia Jiang, Yongtai Hou, and Jiang Chang ACS Appl. Mater. Interfaces, Just Accepted Manuscript • DOI: 10.1021/acsami.8b04116 • Publication Date (Web): 02 May 2018 Downloaded from http://pubs.acs.org on May 3, 2018

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 44 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Applied Materials & Interfaces

Fabrication of Multiple-layered Hydrogel Scaffolds with Elaborate Structure and Good Mechanical Properties via 3D-printing and Ionic Reinforcement

Xiaotong Wang,†, ‡ Changzheng Wei,*,† Bin Cao,† Lixia Jiang,† Yongtai Hou, ‡ Jiang Chang§

†

Shanghai Qisheng Biological Preparation Co. Ltd. Shanghai 201106, P. R. China

‡

Shanghai Haohai Biological Technology Co. Ltd. Shanghai 200052, P. R. China

§

State Key Laboratory of High Performance Ceramics and Superfine Microstructure,

Shanghai Institute of Ceramics, Chinese Academy of Sciences. Shanghai 200050, P. R. China

* Corresponding Authors

Email: [email protected] Tel: +86-21-62202533

Keywords: hydroxybutyl chitosan, 3D printing, hydrogel, specific ion effect, tissue engineering

1

ACS Paragon Plus Environment

ACS Applied Materials & Interfaces 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Abstract A major challenge in 3D printing of hydrogels is the fabrication of stable constructs with high precision and good mechanical properties and biocompatibility. Existing methods typically feature complicated reinforcement steps or use potentially toxic components, such as photo curing polymers and crosslinking reagents. In this study, we used a thermally sensitive hydrogel, hydroxybutyl chitosan (HBC), for 3D-printing applications. For the first time, we demonstrated that this modified polysaccharide is affected by the specific ion effect. As the salt concentration was increased and stronger kosmotropic anions were used, the lower critical solution temperature of the HBC decreased and the storage modulus was improved, indicating a more hydrophobic structure and stronger molecular chain interactions. On the basis of the thermosensitivity and the ion effects of HBC, a 25-layered hydrogel scaffold with strong mechanical properties and an elaborate structure was prepared via a 3D-printing method and one-step ionic post treatment. In particular, the scaffold treated by 10% NaCl solution exhibited a tunable elastic modulus of 73.2 KPa ~ 40 MPa and excellent elastic recovery, as well as the biodegradability and cytocompatibility, suggesting the potential for its applications to cartilage tissue repair. By simply controlling the temperature and salt concentrations, this novel approach provides a convenient and green route to improving the structural accuracy and regulating the properties of 3D-printed hydrogel constructs.

2


Page 2 of 44

Page 3 of 44 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


1.

Introduction Additive manufacturing, also known as three-dimensional (3D) printing, has drawn

extensive attention in tissue engineering and biomedical applications, owing to its ability to conveniently fabricate biological constructs with complex interconnected 3D structures and accurate pore morphologies and size through layer-by-layer deposition methods.1-2 Various materials such as metals, ceramics and synthetic polymers have been widely used in 3D printing, and some have already been realized in industrial applications. However, hydrogels, which are typically the main components in inks for biofabrication, are still lacked.3 As a large amount of free and bound water exists in hydrogel networks, hydrogel scaffolds usually exhibit weak mechanical properties and low shape fidelity, which lead to low precision of the structures. Typically, the minimal diameter of the extruded hydrogel line is about 150 µm, which corresponds to that of the finest 30-Gauge nozzle2. However, few studies have achieved line diameters less than 200 µm4-7. Reported effective methods include the use of photoinitiators8 or photosensitive acrylic modification7, chemical crosslinking9-11 and multi-compound hydrogel systems6,

12

.

However, several problems are also encountered, such as their safety in vivo and the complex manipulation steps, which are crucial issues for industrialization and medical product manufacturing. Therefore, developing a suitable hydrogel for 3D-printing and fabricating a biocompatible 3D-printed construct with high precision via a simple and green method, remains a considerable challenge in terms of both fundamental research 3



and industrialization. Intelligent hydrogels have emerged as promising biomaterials for 3D-printing owing to their remarkable sensitivity to external stimulus from the environment, such as temperature, ions, pH and electromagnetic field.13 Hydroxybutyl chitosan (HBC) is a type of thermally responsive hydrogel, which is synthesized by conjugating hydroxybutyl groups to hydroxyl (-OH) and amino groups (-NH2) of chitosan natural polymers.14-16 As a modified polysaccharide, HBC has been shown to be water-soluble, biocompatible, degradable, and has physical and chemical properties that can be easily regulated by simply controlling the degree of hydroxybutyl substitution. When the temperature rises above the lower critical solution temperature (LCST), a sol-gel transition of the HBC solutions occurs rapidly, which endows them with good printable performance. Although the viscoelasticity of HBC can be regulated for 3D-printing purposes theoretically, in practice it is often difficult for hydrogels to achieve high resolution structures, such as those of metals, ceramic materials and thermoplastic polymers, owing to their weak mechanical properties. These features undermine the superiority of 3D-printing as a technique for anatomical simulation and precision medicine. Among various strategies for modulating the physicochemical properties of the polymer construct, the Hofmeister effect has drawn considerable attention owing to the flexible and convenient application of the relationships among polymers, water and salts. The Hofmeister effect was first proposed to describe the ability of salts to precipitate proteins from aqueous solution, and later expanded to reflect the influence of small solute 4


Page 4 of 44

Page 5 of 44 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


molecules on the solubility of macro-molecules through solute-water interactions.17-18 Various polymers have been reported in relation to the Hofmeister effect, such as poly-(N-isopropylacrylamide) (PNIPAM)19-20, short peptides21 and sodium styrene sulfonate brushes22; however, the specific ion effects of polysaccharides and their derivatives have rarely been investigated. Similar to PNIPAM, HBC can change its phase state in aqueous solution by alteration of its molecular conformation and hydrophilic-hydrophobic interactions. Furthermore, the gelling and phase transition process of HBC above the LCST resembles the precipitation or denaturation of proteins. Therefore, we hypothesize that the HBC might also be related with specific ion effects in a similar manner to that of proteins and PNIPAM. These features may have applications to modulation of scaffold properties. Therefore, the aim of this work was to first explore the effects of salt ions on the physical and chemical properties of HBC hydrogels. Then a 3D-printed hydrogel scaffold was fabricated based on the thermally responsive properties of HBC. The following key step was to ensure that the micro morphology and properties of the 3D-printed scaffold could be well regulated based on the specific ion effects of HBC (Scheme 1). The microstructure, mechanical properties, biodegradability and cytotoxicity of the 3D-printed HBC hydrogel scaffold were systematically investigated, and the underlying mechanism of the specific ion effect of HBC are also discussed.

Scheme 1. Schematic illustration of fabricating the HBC hydrogel scaffolds via 5



3D-printing and ionic reinforcement. The HBC sample was pre-gelled under 30 °C and 3D-printed onto a heated platform of 40 °C. A stable hydrogel scaffold with multiple layers could be fabricated based on the thermosensitivity of HBC. Then the as-printed scaffold was suspended in NaCl solutions. Small salt molecules led to removal of the hydration shells and strengthened hydrophobic interaction of the HBC molecular chains. This ionic effects of HBC induced shrinkage of the scaffold, resulted in an elaborate structure and good mechanical properties.

2. Experimental Section 2.1. Preparation and Characterization of HBC 6


Page 6 of 44

Page 7 of 44 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


HBC aqueous solution was obtained from Shanghai Qisheng Biological Preparation Co., Ltd, which was prepared according to a reported method14. Briefly, the alkalinized chitosan (1000 kDa) was mixed with 1,2-butene oxide homogeneously. After 48 hours of etherification reaction at room temperature, the excess alkylating agent and unreacted portions were removed. The collected precipitation was washed with acetone and vacuum dried at 50 °C. Then the obtained samples were dissolved in deionized water to form HBC aqueous solution (0.8 wt%) and stored at 4 °C for further use. The degree of hydroxybutyl substitution of the HBC was determined by elemental analysis and calculated according to the previous method23. The percentage of each element (C, H, O and N) in HBC was detected using an elemental analyzer (Thermo Flash 2000, USA). Then the degree of hydroxybutyl substitution was calculated according to the known molecular formula [C6H11-a-bO4N·(C2H3O)a·(C4H9O)b·cH2O]n and the following equations: 14 × 100% 161 + 42a + 72b + 18c 72 + 24a + 48b C% = × 100% 161 + 42a + 72b + 18c 11 + 2a + 8b + 2c H% = × 100% 161 + 42a + 72b + 18c

N% =

where a and b represent the numbers of acetyl and hydroxybutyl groups per HBC molecular unit, respectively, and c represents the number of H2O molecules per HBC molecular unit.

2.2. Preparation of HBC gel columns by gel-casting method and salt treatment 7



The HBC sol solution was added into a 12-well plate, stood under 4 °C to eliminate bubbles, and then heated in water bath under 40 °C for 1 h to generate a cylinder gel column. The diameter of the gel column was measured to be approximately 21 mm. Then some samples were suspended in water and sodium chloride (NaCl) solutions with their concentrations of 1%, 5%, 10%, 20%, respectively. The other columns were soaked in different salt solutions with the concentration of 0.8 M, including NaCl, NaI, NaNO3, CH3COONa, Na2SO4, CaCl2, MgCl2 and KCl. The pH value and the electronic conductivity of the salt solutions were examined. After 24 h under room temperature, the diameter of the gel columns was measured. Similarly, HBC gel columns with the same polymer content were prepared by evaporation and ionic reinforcement, respectively. The HBC sol solution (3 mL) was added into a 12-well plate and heated in water bath under 40 °C for 1 h. Then the generated gel column was suspended in 2 mL of NaCl solution (10 wt%) under 40 °C for 30 min. After shrinkage of the gel, the volume of the NaCl solution was measured and the calculated polymer content of the gel was 1.1 wt%. Then the HBC solution with a polymer content equal to that of the dehydrated gel was prepared by evaporation and concentration. Another gel column was prepared using the 1.1 wt% HBC sol solution by gel-casting method. These gel columns with and without ionic reinforcement were defined as 1.1% HBC-NaCl and 1.1% HBC-H2O, respectively.

2.3. Rheological analysis 8


Page 8 of 44

Page 9 of 44 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


The HBC sol solution (0.8 wt%) was mixed with different salt solutions (0.8 M) in a volume ration of 4:1 under 4 °C for 6 h. Then the rheological properties of samples were measured by a rheometer (Thermo Scientific HAAKE MARS III, USA), using a C35/1° TiL measuring geometry and a gap of 0.051 mm. Temperature sweeps were performed from 5 °C to 40 °C at a shear frequency of 1 HZ, with the residence time of 60 s at each temperature point. Rheological properties of 1.1% HBC-NaCl and 1.1% HBC-H2O gel columns were also measured.

2.4. Fourier transform infrared (FTIR) analysis The FTIR was performed using a FTIR spectroscopy (iS10, Thermo Nicolet, USA) from 4000 to 400 cm−1 under room temperature. The HBC gel columns treated with water and 1%, 5%, 10% and 20% of NaCl solutions were lyophilized overnight and dried in vacuum drier at 60 °C. The FTIR spectra and peak signals were analyzed using OMNIC 8.2.

2.5. Preparation of HBC scaffolds by 3D-printing method and salt ionic reinforcement Before 3D-printing, the HBC sol solution was transferred into a syringe and stood under 4 °C to eliminate bubbles. Then HBC samples were heated in water bath under 30 °C for 20 min to allow the sol-gel transition. HBC hydrogels were printed using a 3D nano-plotter with a design software (GeSiM Bioscaffolder 2.1, Germany). A heated platform receiver with controllable temperature 9



was used during 3D-printing, which was set as 40 °C. The inner diameter of the cylinder syringe nozzle was 0.21 mm and the dosing pressure to the syringe pump was in the range of 2.5 ~ 3.5 MPa. The plotting head moved at a speed of 6 mm/s. The space between X and Y axis in a single layer was set as 1.0 mm, and the step height in Z direction between the adjacent layers was set as 0.20 mm. The scaffolds were designed as a 24 mm × 24 mm × 5 mm cuboid with a grid-like structure. After 3D-printing, the HBC scaffolds were suspended in different concentrations of NaCl solutions for 24 h under room temperature. The scaffolds treated by water and 1%, 5%, 10% and 20% of NaCl solutions were defined as H2O, S1, S5, S10 and S20, respectively. The as-printed scaffold placed in oven under 40 °C for 20 min was defined as HBC. Then the scaffolds were rinsed by deionized water for 20 min, shaped by quick-freezing and lyophilized overnight.

2.6. Characterization of the 3D-printed HBC scaffolds The macro-pore morphology of the 3D-printed scaffolds with or without ionic reinforcement was observed using an optical microscopy (ZEISS, Axio Vert A1, Germany). The microstructures of the pore wall and pore size were investigated by scanning electron microscopy (SEM, HITACHI TM3000, Japan). The compressive strength and elastic modulus of the 3D-printed scaffolds were examined using a mechanical testing instrument (GOTECH, China). Five samples in each group were compressed at a 2 mm/min rate until the sample fractured. The elastic 10


Page 10 of 44

Page 11 of 44 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


modulus was determined from the slope of the stress-strain curve by calculating the first order differential of the stress-strain image data. The cyclic compression test was performed for six cycles with the maximal stain of about 70%.

2.7. In vitro enzymatic degradation In vitro degradation of the 3D-printed scaffolds was evaluated using lysozyme (20000 U/mg solid, Shanghai Yuanju Biotech, China), which is a kind of catabolic enzymes of chitosan24. The lyophiled samples were soaked in 2 mg/mL of enzyme solution and incubated at 37 °C under continuous shaking for different period of time (3, 5, 7, 10, 14 and 21 days). The dry weight of the samples before and after digestion was examined, and the degradation rate was determined by weight loss percentage.

2.8. Cell isolation and culture Chondrocytes were isolated from 7-day-old neonatal Sprague-Dawley (SD) rats according to the reported method.25 Briefly, the articular cartilage of the femur was dissected into 1 mm3 pieces, and then digested with 5 mg/mL collagenase-II (PAA Laboratories, Austria) in high-glucose Dulbecco’s modified Eagle medium (DMEM, Gibco) supplemented with 10% fetal bovine serum (FBS, Gibco) under 37 °C for 4 h. Then the chondrocyte suspension was collected and centrifuged at 800 rpm for 10 min. The sediment was re-suspended, pre-plated for 2 days and then removed the non-adhesive cells to purify the chondrocytes. Chondrocytes were cultured with DMEM, 11



supplemented with 10% FBS, 100 U/mL penicillin, 100 µg/mL streptomycin (Gibco) and 2 mM L-glutamine (Gibco). Cells were incubated in a humid atmosphere of 5% CO2 at 37 °C and the second passage was used in later experiments.

2.9. Cell viability The scaffolds were cut into cylinders with the diameter of 1 cm, put into a 48-well plates, sterilized by 75% ethanol for 30 min and then rinsed by PBS for 30 min. Five hundred microliters of cell suspension was added onto the scaffolds at a density of 5 × 104 cells/mL and cultured in the CO2 incubator for different periods of time. The culture medium was changed every other day. After 3 days of incubation, the cell-seeded samples were collected for SEM observation and fluorescent staining. The SEM cellular samples were fixed with 2.5% glutaraldehyde (Sinopharm Chemical Reagent Co., Ltd, China) for 4 h, dehydrated in graded ethanol (30, 40, 50, 60, 70, 80, 90, 95 and 100 v/v %) and air dried overnight. Meanwhile, the 1,1-dioctadecyl-3,3,30,30-tetramethylindocarbocyanine perchlorate (DiI, Invitrogen, USA) and 4′,6-diamidino-2-phenylindole (DAPI, Sigma-Aldrich, USA) fluorescent dyes were used to detect the cell morphology. Samples were fixed with 4% paraformaldehyde for 20 min and rinsed with PBS for 20 min. Then the samples were incubated in 10 µM CM-DiI Dye for 30 min and rinsed with PBS for three times. Subsequently the nuclei were stained with 100 ng/mL DAPI and rinsed with PBS for three times. Finally, the samples were imaged using a confocal microscopy (Leica TCS 12


Page 12 of 44

Page 13 of 44 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


SP8, Germany) with excitation/emission filters set at 550/565 nm and 358/461 nm to detect cell membrane (orange-red) and nucleus (blue), respectively. After 7 days of incubation, cell viability was measured by live/dead staining assay (calcein AM/ethidium homodimer, Invitrogen, USA). The cell-seeded samples were rinsed with PBS for 5 min and stained with the live/dead staining dyes according to the manufacturer’s recommendations. After 15 min of incubation, cell viability was visualized using confocal microscopy with excitation/emission filters set at 488/530 nm and 530/580 nm to detect living (green) and dead (red) cells, respectively. 2.10. Quantitative real-time reverse-transcriptase polymerase chain reaction (QRT-PCR) To evaluate the mRNA transcript levels of chondrocytes specific genes, 3 mL of cell suspension (5 × 104 cells/mL) was seeded onto the 2-cm-diameter cylinder samples in the 6-well plate and incubated for 7 days. Total RNA was isolated using TRIzol Reagent (Ambion, USA) and determined the concentration at 260 nm with a multifunction microplate reader (Tecan, SpectraFluor Plus, Germany). First-strand cDNA was synthesized using the PrimeScript 1st Strand cDNA Synthesis Kit (Toyobo, Japan) according to the standard procedures. QRT-PCR was performed in triplicate with the SYBR Green Master Mix (TaKaRa, Japan) and run on the StepOnePLUS system (Applied Biosystems, USA). The cycle conditions of PCR operation profile were as follows: activation at 95 °C for 1 min, extension for 40 cycles at 95 °C for 15 s, 60 °C for 15 s, and 72 °C for 45 s. The results were normalized to GAPDH mRNA expression and expressed as fold change for TCP (cells cultured on the tissue culture plate). The 13



Page 14 of 44

sequences of PCR primers (forward and backward, 5’ to 3’) were obtained according to the

previous

study25

and

listed

as

follows:

Collagen-II

5’

TGGAAGAGCGGAGACTACTG 3’ & 5’ GTAGACGGAGGAAAGTCATCTGG 3’; Aggrecan 5’ TATGAGGATGGCTTCCACCAG 3’ & 5’ AAGACCTCACCCTCCATCTC 3’;

Collagen-I

5’TCCTGCCGATGTCGCTATC3’

AAGTTCCGGTGTGACTCGTG3’;

&

GAPDH

5’ 5’

GCTCTCTGCTCCTCCCTGTTCTAG 3’ & 5’ TGGTAACCAGGCGTCCGAT 3’.

2.11. Statistical analysis Data are presented as mean±SD from at least three independent experiments. Statistical significance between two groups was determined by Student’s t-test.

The

results between different groups were compared by one-way ANOVA followed by Bonferroni post hoc test. A difference was regarded as significant if p < 0.05 in a test, unless otherwise indicated.

3. Results 3.1 The specific ion effects of HBC Elemental analysis indicated that the degree of hydroxybutyl substitution of the obtained HBC was 2.0. To investigate the ion effects of salts with different concentrations on the properties of HBC, NaCl solutions, for which both Na+ and Cl- were in the middle of the Hofmeister series, were introduced into the HBC hydrogel system. As shown in 14


Page 15 of 44 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 1A, the HBC hydrogel immersed in water swelled slightly, indicating a higher osmotic pressure than that of the surrounding aqueous solution. The diameter of the HBC gel immersed in NaCl solution decreased gradually as the salt concentration was increased. The shrinkage ratios of the gels immersed in 1% and 20% NaCl solutions were approximately 40% and 60%, respectively. The rheological curves in Figure 1B showed that the viscous response behavior of the HBC solutions turned into elastic response behavior gradually as the temperature was increased. The original HBC aqueous system possessed a LCST of 19.9 °C and a G’ of 195 Pa at 40 °C. After homogeneous mixing with different concentrations of NaCl solutions (VHBC:VNaCl=4:1), the HBC showed a decreased LCST and enhanced G’ as the salt concentration was increased (Figure 1B). When the concentration of the NaCl solution was varied from 1% to 5%, the LCST of the HBC decreased from 14.8 °C to 12.6 °C, and the G’ at 40 °C increased from 275 to 428 Pa, suggesting more rapid gelation and mechanical properties compared with those of the aqueous system. As the concentration of NaCl solution was increased further to 10% and 20%, the G’ value of HBC became higher than that of G’’ at 5 °C, indicating the sol-gel transition occurred from the start of the rheological assessment. The G’ values of HBC in 10% and 20% NaCl groups were 522 and 551 Pa at 40 °C, respectively. These values were higher than those of salt systems with lower NaCl concentrations. To further study the effects of salt concentrations on the interactions of the HBC chains, FTIR spectra were measured and are plotted in Figure 1C. The peak at 3386 cm-1 in the HBC without added salt could be assigned to O-H stretching vibrations. The peaks 15



at 1640 and 1550 cm-1 were attributed to N-H deformation vibrations. When NaCl was introduced into the HBC system, the peaks for the O-H stretching vibrations shifted to low frequencies as the NaCl concentration was increased, which might be attributed to strengthening of hydrogen bonds within and between HBC molecules. The peaks assigned to N-H deformation vibrations at 1640 and 1550 cm-1 became more prominent as the NaCl concentration was increased, indicating reinforcement of the hydrophobic interactions and molecular chain entanglement.

Figure 1. Photographs of the HBC gel columns (A), and the rheological curves (B) and FTIR spectra (C) of HBC polymers after treated with water and different concentrations of NaCl solutions. The rheological curves in the temperature region of 5 ~20 °C were magnified in the below in (B). 16


Page 16 of 44

Page 17 of 44 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Furthermore, the effects of anion and cation species on the properties of the HBC were also assessed by adding various sodium and chloride salts into the HBC sol solutions, respectively. The sodium salts included NaCl, chaotropes (NaI and NaNO3), and kosmotropes (CH3COONa and Na2SO4), which exhibited similar pH values (except for those of NaI and CH3COONa solutions) and ionic strength (Table S1). As shown in Figure S1A, the different anions led to the shrinkage of the HBC gels to varying degrees. The chaotropic anions, I- and NO3-, induced the relatively weak size shrinkage, while the kosmotropic anions, CH3COO- and SO42-, induced more substantial dehydration of the gels. The change of the gel size approximately followed the Hofmeister series: H2O > I- > NO3- > Cl- > CH3COO- > SO42-. Moreover, the rheological curves in Figure S1B showed that the LCST of HBC in the different sodium salt solutions decreased in the same order. The HBC in Na2SO4 solution exhibited the lowest LCST (5 °C) and the highest G’ (1049 Pa at 40 °C). The regular change of the HBC properties with different anions of sodium salts suggested clear anion specific effects of HBC. The cation specific effects were investigated using NaCl, chaotropes (CaCl2 and MgCl2) and the kosmotrope (KCl). As shown in Figure S2A, the HBC gels in all the chloride salt solutions exhibited similar shrinkage, which represented a decrease of approximately 55% of the original size in the aqueous solution. The LCST of HBC in all the chloride salt solutions decreased to the same region, from 10.1 to 11.6 °C (Figure S2B). The G’ of HBC was also enhanced by the different salt ions, from 370 to 550 Pa at 17



40 °C in all the salt groups. Compared with anions, the differences of the effect on the HBC properties among the different cation species were not notable, suggesting that the anions might be associated with the specific ion effect of HBC rather than the cations. The above results demonstrated that the types and concentrations of salt ions had a profound effect on the phase transition process and the rheological properties of HBC. The next step of our work was to make use of the ion effect of the HBC in the regulation of the properties of the hydrogel scaffolds for tissue engineering applications.

3.2 Application of the thermosensitivity and the ionic effects of HBC to the fabrication of 3D-printed scaffolds The rheological curves in Figure 1B demonstrated that the G’ of HBC aqueous system under 30 and 40 °C were 73 and 195 Pa, respectively. Therefore, the HBC aqueous system with a low polymer concentration of 0.8 wt% could meet the requirements for extrusion and fabrication of a 3D-printed self-supported scaffold.

18


Page 18 of 44

Page 19 of 44 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 2. Photographs of the 3D-printed HBC hydrogel scaffold with a size of 24 mm × 24 mm × 5 mm before ionic reinforcement.

The macrostructure of the 3D-printed HBC hydrogel scaffold was depicted in Figure 2. It was clear that a 3D-printed scaffold with more than 20 layers maintained very high shape fidelity and a stable macropore structure. The grid line was approximately 400 µm wide and the pore diameter was about 600 µm. By regulating the temperature, the height of the 3D-printed scaffold could reach up to 5 mm without collapse.

19



Figure 3. Photographs (left side), bright field microscope images (medium) and the SEM images (right side) of the 3D-printed HBC hydrogel scaffolds treated with water and different concentrations of NaCl solutions.

After immersion in water, the 3D-printed scaffold swelled rapidly, resulting in collapse of the structure (Figure 3). By contrast, scaffolds immersed in NaCl solutions began to dehydrate and shrink, and the color changed gradually from transparent to white. The overall size of the final scaffold decreased as the concentration of NaCl solution was 20


Page 20 of 44

Page 21 of 44 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


increased. The scaffold treated by 20% NaCl solution (S5) exhibited the minimal size, which was approximately 0.9 mm × 0.9 mm × 2 mm. Bright field microscope images shown in Figure 3 revealed that the shrunken scaffolds displayed well-defined structures with straight grid lines and stable macropore arrays. The SEM images showed that numerous ordered micropores were distributed uniformly in each strut of the scaffolds treated by salts, which were different from the spongy porous morphology of the aqueous group. The size of both the macro- and micro-pores decreased with as the NaCl concentration was increased. The macropore sizes of the scaffolds treated by 1%, 5%, 10% and 20% NaCl solutions were reduced to approximately 400, 320, 270 and 250 µm, respectively, and the micropore sizes were approximately 15, 10, 7 and 4 µm, respectively.

3.3 The ionic effects of HBC contributed to the tunable and strong mechanical properties of the 3D-printed HBC scaffold Figure 4A showed that the compressive stress and elastic modulus of the 3D-printed HBC scaffolds were enhanced after treatment by NaCl ions in a salt concentration depended manner. The scaffolds in all the groups reached the maximal compressive strength when their strain was approximately 85%. The scaffold immersed in 20% NaCl solutions possessed maximal stress and elastic modulus values, which was as high as 5.6 and 48.0 MPa, respectively. The scaffold treated by 10% NaCl (S10) also exhibited excellent elastic properties. The elastic modulus of the S10 sample varied from 73.2 KPa 21



to 1130.7 KPa when the strain was in the range of 30% ~ 60%, and reached up to 40 MPa at 80% strain, which was 6 times higher than that of the scaffold without ion post treatment (6.25 MPa at 80% strain for HBC). When the deformation reached the fracture strain, the scaffolds in HBC and S1 groups were cracked into hydrogel fragments, while those in S5, S10 and S20 groups were pressed into intact films with deformation (Figure 4B), indicating the gradually enhanced ductility and strength of the scaffolds treated by salt ions.

Figure 4. (A) Compressive stress-strain curves of the 3D-printed HBC hydrogel scaffolds with and without treatment by different concentrations of NaCl solutions and the corresponding elastic modulus-strain curve of the S10 scaffold. (B) Pictures of the HBC and S10 scaffolds after compression tests at the broken strain. 22


Page 22 of 44

Page 23 of 44 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


After post treatment with salt concentrations higher than 5%, the 3D-printed scaffolds exhibited excellent elastic recovery performance. In particular, the scaffold treated by 10% NaCl solution could withstand substantial deformation and recover its original integrated structure quickly without distortion (Figure 5A). To further assess the compressive restoring ability of the S10 scaffold, loading-unloading curves were measured for six compression cycles. As depicted in Figure 5B, the scaffold displayed a hysteresis loop in the first cycle, suggesting that effective energy dissipation followed the compression. In the following three cycles, the loading curves in each cycle fell slightly below those of the previous cycle. The hysteresis loops also became smaller than the first, indicating that the stiffness of the scaffold degraded to a certain degree during the first three cyclic compression process. However, as the process was continued, the hysteresis loops in the last three cycles overlapped almost completely, indicating that the rigidity of the scaffold was maintained, and the scaffold treated by 10% NaCl solution exhibited excellent resistance to deformation.

23



Figure 5. (A) Pictures of the S10 scaffolds before and after compression to 70% strain. (B) Compressive loading-unloading curves of the S10 scaffolds for six cycles.

To validate that the enhanced mechanical properties of HBC hydrogel were not only because of the increased concentration after shrinkage, we prepared two groups of HBC gel columns with the same polymer content, by the way of evaporation and ionic reinforcement, respectively. The rheological curves in Figure 6 showed that the LCST of the HBC hydrogel treated with salt ions (1.1% HBC-NaCl) was 10.4 °C, which was lower than that of the hydrogel not subjected to a salt treatment (17.1 °C for the 1.1% HBC-H2O group). Furthermore, the G’ value at 40 °C in the 1.1% HBC-NaCl group was 1089 Pa, which was approximately twice as much as that in the 1.1% HBC-H2O group (540 Pa). These results indicated that the mechanical properties of HBC constructs were improved not only by the increased polymer content, but also by the effects of salt ions.

24


Page 24 of 44

Page 25 of 44 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 6. The rheological curves of the HBC gel columns prepared by evaporation (1.1% HBC-H2O) and ionic reinforcement (1.1%HBC-NaCl), respectively. The magnified images in blue squares are showed on the right.

3.4 The 3D-printed HBC hydrogel exhibited good degradability as a tissue engineered scaffold: In vitro enzymatic degradability Considering the porous microstructure and attractive mechanical properties, the 3D-printed HBC scaffold treated by 10% NaCl solution (S10) could have applications to the cartilage tissue engineering. To investigate the degradability of the scaffolds, an in vitro enzymatic digestion assay was performed with lysozyme. As shown in Figure 7, the 3D-printed scaffold without ionic post treatment degraded within 10 days, owing to the loose spongy structure of the swelled scaffold. Conversely, the relative weight loss of the S10 scaffold was only 18% after digestion for 10 days, indicating a slower enzymatic degradation rate of this scaffold. This result further confirmed the compaction of the structure induced by ions. After 21 days of digestion, the S10 scaffold was completely degraded, indicating good degradability of the 3D-printed HBC scaffold treated by 10% 25



NaCl solution.

Figure 7. In vitro degradation rate curves of the HBC and S10 scaffolds after digestion by lysozyme.

3.5 The 3D-printed HBC hydrogel exhibited good cytocompatibility as a tissue engineered scaffold: Cell activities in vitro

26


Page 26 of 44

Page 27 of 44 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 8. SEM (A) and fluorescent staining (B) images of the chondrocytes after cultured on S10 scaffold for 3 days. (C) The live/dead staining images of the chondrocytes after cultured on S10 scaffold for 7 days. (D) Relative gene expression of collagen type II (COL II), type I (COL I) and aggrecan of the chondrocytes after cultured on S10 scaffold for 7 days. “TCP” indicates the tissue culture plate group.

To investigate the cytocompatibility of the scaffolds treated by 10% NaCl solution, chondrocytes were seeded onto the scaffolds and the cell morphology and viability were assessed. After 3 days of incubation, SEM and fluorescence microscope images, shown in Figure 8A and B, revealed that the chondrocytes adhered to the micro-pores of the 27



scaffolds and displayed spindle or round shapes with numerous extended pseudopodia growth. Cell clusters were formed in and around the macro pores. After 7 days of culturing, live/dead staining images revealed that the chondrocytes with a high cell viability were homogeneously distributed on the grids and in the interconnected pores of the 3D-printed scaffolds (Figure 8C). The 3D confocal images showed that the chondrocytes extended along the macropore walls deep inside the scaffold. These results showed that the 3D-printed HBC scaffolds treated by 10% NaCl solution could support attachment and proliferation of chondrocytes. To further investigate the cellular response of the chondrocytes cultured on the scaffolds, the expression levels of mRNA of the related genes in S10 group were detected and compared with those normally cultured on the tissue plate (TCP). As shown in Figure 8D, the expression of chondrocyte specific genes (collagen II and aggrecan) in the S10 group was significantly up-regulated as compared to the TCP group, while the expression of collagen I was approximately half of that in the TCP group. These results indicated that cells cultured on the S10 scaffold maintain the phenotype of chondrocytes.

4. Discussion Despite the rapid development of 3D-printing techniques, additive manufacturing of effective and safe biological constructs is still hampered by the limitations of printable hydrogels in terms of their weak mechanical properties, the rough structure of the scaffold, and existing reinforced methods.1, 3 In the present study, we took advantage of a 28


Page 28 of 44

Page 29 of 44 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


thermally responsive intelligent polymer, HBC, and for the first time identified specific ion effects of this modified polysaccharide on its rheological behaviors. On the basis of its thermosensitivity and the ionic effects of HBC, we successfully fabricated a stable hydrogel scaffold with multiple layers by 3D-printing method and one-step ionic post treatment. We achieved a precise structure, strong mechanical properties, degradability and good cytocompatibility. Compared with the reported bulk hydrogels prepared by gel-casting method26-27, the present 3D-printed scaffold displayed superior controllable porosity, pore size and interconnected structures, which contributed to the extended diffusion of nutrients and oxygen and ingrowth of tissues. In particular, the manufacturing process was performed under mild conditions and simple operation without any addition of toxic reagents. The thermally sensitive features of HBC are an attractive property, which is advantageous for 3D-printing applications. Our previous studies have demonstrated that HBC rapidly respond to temperature through alterations of its molecular chain conformation14, and the viscoelastic behavior can be adjusted to be suitable for extrusion or layered stacking by simply regulating the temperature. Recently, Tsukamoto et al.28 used HBC solution with a concentration of 25 mg/mL for 3D-printing, and prepared a 1.1-mm-high macro gel frame with five layers for cell growth to control the shape of the generated tissues, wherein the HBC served as a sacrificial template based on its reversible thermo-sensitive sol-gel transition properties. Our present work used 8 mg/mL of HBC to produce a 3D-printed bioscaffold with more than 20 layers. We chose this concentration 29



because the rheological properties of 8 mg/mL of HBC is suitable for extrusion and fabrication of a stable hydrogel scaffold. The HBC with a low polymer concentration produced a 5-mm-high hydrogel scaffold with high shape fidelity and a well ordered structure (Figure 2), which might be attributed to the critical processes of pre-gelation at 30 °C and heat preservation at 40 °C. Pre-gelation of HBC renders the polymer applicable for microextrusion under smaller diameter nozzles, leading to a higher printing resolution, and the heated platform further enhanced the mechanical properties, resulting in a well-preserved interconnected pore structure. One practical problem in hydrogel scaffold printing is that of further reinforcing the structure and controlling the physicochemical properties of the scaffolds. Common methods include the use of photoinitiators7-8 or photosensitive acrylic modification7, 29. Despite the improved stability of the networks, there remains some debate over the biocompatibility of such constructs in vivo. Other approaches include those that use chemical crosslinking9-11; however, degraded crosslinking reagents might be potentially cytotoxic. Recently, various novel hydrogel systems have been established for 3D-printing strategies, which are based on single or combined gelling mechanisms such as enzymatic polymerization12 and chemoselective reactions6, 30. A drawback of these approaches is that they feature complicated steps or have harsh reaction conditions, which greatly limit their industrial application. Although the strength of thermo-sensitive HBC was enhanced in this work by raising the temperature, this effect was not sufficient to fulfill the required mechanical properties of a tissue engineered scaffold. Therefore, 30


Page 30 of 44

Page 31 of 44 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


other effective measures should be taken to further reinforce 3D-printed HBC scaffolds. In terms of the mechanism, both hydrophilic and hydrophobic functional groups exist on the molecular chains14, 31, which play an important role in the solubility and stability of HBC in aqueous solution. The hydrophilic -OH and -NH2 groups lead to an affinity of the HBC chains for water molecules and to the formation of hydration shells around the polymers, which together with the limited mobility and junction of molecular chains, results in the unstable structure of the 3D-printed network. This mechanism implies that interfering with the HBC-water interactions and strengthening the chain entanglement might be key points to regulating the morphology and properties of constructs. Previous research has demonstrated that the Hofmeister effect is involved with various polymers. This effect involves a phenomenon where small salt molecules affect the solvation of macromolecules in a species and ionic concentration dependent manner.18 Roy et al.32 revealed that anionic species markedly affected the self-assembled structure of aromatic short peptide amphiphiles in aqueous solutions, and this effect was associated with the Hofmeister series. Recently, He et al.33 applied the Hofmeister effect to protein-based hydrogels, and prepared a strong and ductile gelatin hydrogel with the assistance of highly kosmotropic ammonium sulfate ions. In the present study, we discovered the similarities of the molecular structure and solubility between HBC and the above polymers. For the first time we demonstrated that the specific ion effects also affected this modified polysaccharide. Our results demonstrate that both the ionic concentration and the type of ion species have a pronounced effect on the phase transition 31



and rheological properties of HBC, where the effect of the anions in particular follows the Hofmeister series (Figure 1, S1 and S2). Higher ion concentrations and stronger kosmotropic anions decrease the LCST and improve G’, indicating enhanced hydrogen bonding and hydrophobic interactions in the HBC polymer system. The underlying mechanism for this observation can be well explained by ion hydration theory34-35. Small salt molecules compete with the HBC polymer for interactions with water molecules, leading to removal of the hydration shells of the HBC, which triggers its phase transition and precipitation from the aqueous solution. Furthermore, it is known that the pH value can affect the solubility of chitosan derivatives due to the protonation and deprotonation of the amino groups36. In the present study, most pH values of the different salt solutions were similar, except for that of the NaI solution (Table S1). Our results demonstrate that the alkaline NaI solution exerted the weakest effect on the rheological properties of HBC (Figure S1). This observation contrasted with the general trend of alkaline solutions promoting the precipitation of chitosan polymers. A possible explanation is that most amino groups were substituted by hydroxybutyl in HBC, reducing the sensitivity of the grafted polymer to pH values. Meanwhile, the I- in NaI solution is a strongly chaotropic ion, which promotes the solubility of HBC. The above results suggested that the specific ion effects of HBC could exert a positive effect on the regulation of construct properties at the molecular level. One of the most important results is that the precision and micro morphology of the 3D-printed HBC scaffold could be well controlled by effects of the salt ions. Owing to 32


Page 32 of 44

Page 33 of 44 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


the specific ion effect on the HBC, the addition of salts induced elimination of bound water, which facilitated the dehydration and homogeneous shrinkage of the printed network. As a result, the size of both grid lines and the interconnected macro pores of the scaffold were reduced to a certain degree as the ion concentration was varied. The minimal line width was approximately 100 ~ 200 µm (Figure 3). This linewidth is among the best reported for hydrogel printing4-7,

37-38

. From the perspective of fabricating a

biomimetic structure, the application of specific ion effects on HBC to 3D-printing is of great importance because it provides a simple method to improve the resolution of hydrogel constructs and ensure highly accurate anatomical 3D-printing. Interestingly, the salt ions induced the formation of orderly micro pores, which differed from the spongy porous structure of the scaffold not subjected to a salt treatment. This change might be explained by ion hydration theory, where small salt molecules trigger polarization of surrounding water molecules, generating hydration shells with better-organized structures, which are distinct from those of the disordered water molecules in the aqueous phase. Thereby, in the subsequent lyophilization process, the ordered bound water is frozen and acts as an ice template, contributing to the regular micro-pore structure. As microscale surface topography is an important biophysical property for manipulating cell behaviors and functions39-40, the engineered regular micro-pore structure based on the specific ion effect of HBC might be an attractive feature for the use of 3D-printed hydrogel scaffolds in biological and tissue engineering applications. Another interesting result is that the compressive mechanical properties were 33



evidently improved after the salt ion treatment. Our results demonstrated that the reinforced mechanical strength was not only due to the increased polymer concentration after shrinkage, but also to the effects of salt ions (Figure 6). The ions might break contact between the HBC polymer and the surrounded water, contributing to stronger hydrophobic interactions and strengthening of the compound structure. Thus, the obtained 3D-printed HBC scaffold possessed tunable compressive strength and modulus, which reached as high as 5.6 and 48.0 MPa, respectively (Figure 4). Compared with the strong hydrogel constructs in the previous studies41-44, the present scaffold was at a high level in terms of the mechanical properties. Moreover, the scaffold treated with salt solutions at higher concentrations showed superior elastic resilience (Figure 5). These properties might be attributed to the energy absorption of the molecular chain movement during compressive deformation. The compressive modulus of human cartilage is reported to be in the range of 790 ~ 1910 kPa by Armstrong et al.45. By comparison the present S10 scaffold exhibited tunable and strong mechanical properties, the modulus of which was in the range of 73.2 KPa ~ 40MPa (Figure 4A), indicating its potential for application not only as a mechanically functional cartilage scaffold, but also a bi-layered osteochondral scaffold. As an alternative to common reinforcing approaches used in hydrogel 3D-printing, such as photo-curing and chemical crosslinking, the salt ion treatment is simple and features mild conditions without the use of toxic reagents, which are essential features for manufacture of medical products. Screened of the 3D-printed HBC scaffolds treated with a variety of salt solutions of 34


Page 34 of 44

Page 35 of 44 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


different concentrations, revealed that samples immersed in 10% NaCl solution (S10) possessed excellent mechanical properties and microstructural features, which could meet the requirements of bioscaffolds for cartilage tissue engineering. To further investigate the potential of these constructs, the biodegradability and cytocompatibility of the S10 scaffold were assessed. Our previous studies have demonstrated that the HBC hydrogel could be digested within 4 weeks subcutaneously14. Our current in vitro enzymatic digestion assay revealed that the S10 scaffold could be digested within 21 days by lysozyme, and that the degradation rate was approximately three times as slow as that of the untreated hydrogel (Figure 7). Hence, the S10 scaffold might be retained longer in cartilage tissues and assist in mechanical supporting. The delayed degradation rate might be attributed to the increased density and hydrophobic structure of the S10 scaffold, which reduced the exposure of the polymer to enzymes in aqueous solution. The cell experiments revealed that chondrocytes cultured on the S10 scaffold displayed a normal morphology and high viability (Figure 8). The interconnected macropores provided pathways for cell migration into the center of the construct and created a 3D growth environment resembling that of in vivo conditions. Interestingly, cell clusters were formed around the macro pores (Figure 8B), which may be attributed to the cartilage lacuna-mimetic structure and composition of the HBC polymer. Because positively charged chitosan has been reported to promote chondrogenesis of stem cells by facilitating cell aggregation and precartilage condensation46-47, the formation of cell clusters might be based on a similar mechanism, which is beneficial to chondrogenic 35



function. Furthermore, chondrocytes cultured on the S10 scaffold exhibited up-regulation of collagen II and aggrecan, and down-regulation of collagen I as compared to those in the TCP group (Figure 8D). These results demonstrated that the S10 scaffold contributed to the maintenance of a chondral phenotype and inhibited the de-differentiation of cells during in vitro culture. In summary, the 3D-printed HBC scaffold treated by 10% NaCl solution was mechanically strong, biodegradable and cytocompatible. The construct shows promise as a candidate for cartilage tissue engineering.

5. Conclusion Our study confirmed that HBC, a modified polysaccharide, is strongly affected by the specific ion effect. The sol-gel phase transition process and rheological properties of HBC varied with different salt ion treatment over a range of concentrations. These effects were triggered by polymer-water interactions and alteration of the molecular chain conformation. Furthermore, a HBC hydrogel scaffold with multiple layers was successfully fabricated by a 3D-printing technique and one-step ionic post treatment. This material showed tunable and reinforced mechanical properties and a stable porous structure with high resolution. In particular, the 3D-printed HBC scaffold treated by 10% NaCl solution possessed a precise microstructure, an excellent compressive modulus, elastic recovery, biodegradability and cytocompatibility. These features satisfy the requirements for cartilage tissue engineering and tissue repair. On the basis of the thermo-response properties and ion effects of HBC, we have developed a novel strategy 36


Page 36 of 44

Page 37 of 44 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


of simply controlling the temperature and salt ion concentrations for scaffold property regulation, which could assure high structural accuracy, simple and green fabrication, and excellent biocompatibility owing to the lack of toxic reagents. Thus, there is great potential for this approach in 3D biofabrication and the manufacture of medical products.

Supporting Information. Supporting Information is available. Figure S1 and Figure S2 show the photographs of the HBC gel columns and the rheological curves of HBC polymers after treated with water, and different sodium and chloride salt solutions. Table S1. shows the pH value and electronic conductivity of the various sodium salts and chloride salts with their concentration of 0.8 M.

Acknowledgments This work was supported by Science and Technology Commission of Shanghai Municipality (16441907000).

Reference (1) Wang, X.; Jiang, M.; Zhou, Z.; Gou, J.; Hui, D. 3D Printing of Polymer Matrix Composites: A Review and Prospective. Composites Part B: Engineering 2017, 110, 442-458.

37



(2) Daly, A. C.; Freeman, F. E.; Gonzalez-Fernandez, T.; Critchley, S. E.; Nulty, J.; Kelly, D. J. 3D Bioprinting for Cartilage and Osteochondral Tissue Engineering. Advanced healthcare materials 2017, 6 (22), 1700298. (3) Kirchmajer, D. M.; Gorkin Iii, R.; in het Panhuis, M. An Overview of the Suitability of Hydrogel-forming Polymers for Extrusion-based 3D-printing. Journal of Materials Chemistry B 2015, 3 (20), 4105-4117. (4) Richards, D.; Jia, J.; Yost, M.; Markwald, R.; Mei, Y. 3D Bioprinting for Vascularized Tissue Fabrication. Annals of biomedical engineering 2017, 45 (1), 132-147. (5) Jia, J.; Richards, D. J.; Pollard, S.; Tan, Y.; Rodriguez, J.; Visconti, R. P.; Trusk, T. C.; Yost, M. J.; Yao, H.; Markwald, R. R.; Mei, Y. Engineering Alginate as Bioink for Bioprinting. Acta biomaterialia 2014, 10 (10), 4323-4331. (6) Boere, K. W. M.; Blokzijl, M. M.; Visser, J.; Linssen, J. E. A.; Malda, J.; Hennink, W. E.; Vermonden, T. Biofabrication of Reinforced 3D-scaffolds Using Two-component Hydrogels. Journal of Materials Chemistry B 2015, 3 (46), 9067-9078. (7) Hong, S.; Sycks, D.; Chan, H. F.; Lin, S.; Lopez, G. P.; Guilak, F.; Leong, K. W.; Zhao, X. 3D Printing of Highly Stretchable and Tough Hydrogels into Complex, Cellularized Structures. Advanced materials 2015, 27 (27), 4035-4040. (8) Hockaday, L. A.; Kang, K. H.; Colangelo, N. W.; Cheung, P. Y.; Duan, B.; Malone, E.; Wu, J.; Girardi, L. N.; Bonassar, L. J.; Lipson, H.; Chu, C. C.; Butcher, J. T. Rapid 3D Printing of Anatomically Accurate and Mechanically Heterogeneous Aortic Valve Hydrogel Scaffolds. Biofabrication 2012, 4 (3), 035005.

38


Page 38 of 44

Page 39 of 44 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(9) Censi, R.; Schuurman, W.; Malda, J.; di Dato, G.; Burgisser, P. E.; Dhert, W. J. A.; van Nostrum, C. F.; di Martino, P.; Vermonden, T.; Hennink, W. E. A Printable Photopolymerizable Thermosensitive p(HPMAm-lactate)-PEG Hydrogel for Tissue Engineering. Advanced Functional Materials 2011, 21 (10), 1833-1842. (10) Chen, Y. M.; Chen, L. H.; Li, M. P.; Li, H. F.; Higuchi, A.; Kumar, S. S.; Ling, Q. D.; Alarfaj, A. A.; Munusamy, M. A.; Chang, Y.; Benelli, G.; Murugan, K.; Umezawa, A. Xeno-free Culture of Human Pluripotent Stem Cells on Oligopeptide-grafted Hydrogels with Various Molecular Designs. Scientific reports 2017, 7, 45146. (11) Muduli, S.; Lee, H. H.; Yang, J. S.; Chen, T. Y.; Higuchi, A.; Kumar, S. S.; Alarfaj, A. A.; Munusamy, M. A.; Giovanni, B.; Kadarkarai, M. Proliferation and Osteogenic Differentiation of Amniotic Fluid-derived Stem Cells Cultured on Hydrogels Grafted with ECM-derived Oligopeptides. Journal of Materials Chemistry B 2017, 5 (27), 5345-5354. (12) Wei, Q.; Xu, M.; Liao, C.; Wu, Q.; Liu, M.; Zhang, Y.; Wu, C.; Cheng, L.; Wang, Q. Printable Hybrid Hydrogel by Dual Enzymatic Polymerization with Superactivity. Chemical science 2016, 7 (4), 2748-2752. (13) Khoo, Z. X.; Teoh, J. E. M.; Liu, Y.; Chua, C. K.; Yang, S.; An, J.; Leong, K. F.; Yeong, W. Y. 3D Printing of Smart Materials: A Review on Recent Progresses in 4D Printing. Virtual and Physical Prototyping 2015, 10 (3), 103-122. (14) Wei, C. Z.; Hou, C. L.; Gu, Q. S.; Jiang, L. X.; Zhu, B.; Sheng, A. L. A Thermosensitive Chitosan-based Hydrogel Barrier for Post-operative Adhesions' Prevention. Biomaterials 2009, 30 (29), 5534-5540.

39



(15) Chen, B.; Dang, J.; Tan, T. L.; Fang, N.; Chen, W. N.; Leong, K. W.; Chan, V. Dynamics of Smooth Muscle Cell Deadhesion from Thermosensitive Hydroxybutyl Chitosan. Biomaterials 2007, 28 (8), 1503-1514. (16) Kato, A.; Kan, K.; Ajiro, H.; Akashi, M. Development of a Rapid In Vitro Tissue Deadhesion System Using the Thermoresponsive Sol-gel Transition of Hydroxybutyl Chitosan. Journal of biomaterials science. Polymer edition 2017, 28 (10-12), 958-973. (17) Tadeo, X.; Lopez-Mendez, B.; Castano, D.; Trigueros, T.; Millet, O. Protein Stabilization and the Hofmeister Effect: the Role of Hydrophobic Solvation. Biophysical journal 2009, 97 (9), 2595-2603. (18) Carnegie, R. S.; Gibb, C. L.; Gibb, B. C. Anion Complexation and the Hofmeister Effect. Angew Chem Int Ed Engl 2015, 53 (43), 11498-11500. (19) Zhang, Y.; Furyk, S.; Bergbreiter, D. E.; Cremer, P. S. Specific Ion Effects on the Water Solubility of Macromolecules: PNIPAM and the Hofmeister Series. Journal of the American Chemical Society 2005, 127 (41), 14505-14510. (20) Chen, X.; Yang, T.; Kataoka, S.; Cremer, P. S. Specific Ion Effects on Interfacial Water Structure near Macromolecules. Journal of the American Chemical Society 2007, 129 (40), 12272-12279. (21) Paterova, J.; Rembert, K. B.; Heyda, J.; Kurra, Y.; Okur, H. I.; Liu, W. R.; Hilty, C.; Cremer, P. S.; Jungwirth, P. Reversal of the Hofmeister Series: Specific Ion Effects on Peptides. The journal of physical chemistry. B 2013, 117 (27), 8150-8158. (22) Hou, Y.; Liu, G.; Wu, Y.; Zhang, G. Reentrant Behavior of Grafted Poly(sodium styrenesulfonate) Chains Investigated with a Quartz Crystal Microbalance. Physical Chemistry Chemical Physics Pccp 2011, 13 (7), 2880-2886. 40


Page 40 of 44

Page 41 of 44 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(23) Blanchard, J.; Proniuk, S. Some Important Considerations in the Use of Cyclodextrins. Pharmaceutical Research 1999, 16 (12), 1796-1798. (24) Huang, W.; Xu, H.; Xue, Y.; Huang, R.; Deng, H.; Pan, S. Layer-by-layer Immobilization of Lysozyme–chitosan–organic Rectorite Composites on Electrospun Nanofibrous Mats for Pork Preservation. Food Research International 2012, 48 (2), 784-791. (25) Cao, B.; Peng, R.; Li, Z.; Ding, J. Effects of Spreading Areas and Aspect Ratios of Single Cells on Dedifferentiation of Chondrocytes. Biomaterials 2014, 35 (25), 6871-6881. (26) Bu, Y.; Shen, H.; Yang, F.; Yang, Y.; Wang, X.; Wu, D. Construction of Tough, in Situ Forming Double-Network Hydrogels with Good Biocompatibility. ACS Applied Materials & Interfaces 2017, 9 (3), 2205-2212. (27) Rauner, N.; Meuris, M.; Zoric, M.; Tiller, J. C. Enzymatic Mineralization Generates Ultrastiff and Tough Hydrogels with Tunable Mechanics. Nature 2017, 543 (7645), 407-412. (28) Tsukamoto, Y.; Akagi, T.; Shima, F.; Akashi, M. Fabrication of Orientation-Controlled 3D Tissues Using a Layer-by-Layer Technique and 3D Printed a Thermoresponsive Gel Frame. Tissue engineering. Part C, Methods 2017, 23 (6), 357-366. (29) Du, M.; Chen, B.; Meng, Q.; Liu, S.; Zheng, X.; Zhang, C.; Wang, H.; Li, H.; Wang, N.; Dai, J. 3D Bioprinting of BMSC-laden Methacrylamide Gelatin Scaffolds with CBD-BMP2-collagen Microfibers. Biofabrication 2015, 7 (4), 044104. (30) Boere, K. W.; van den Dikkenberg, J.; Gao, Y.; Visser, J.; Hennink, W. E.; Vermonden, T. Thermogelling and Chemoselectively Cross-Linked Hydrogels with Controlled Mechanical Properties and Degradation Behavior. Biomacromolecules 2015, 16 (9), 2840-2851. 41



(31) Back, J. F.; Oakenfull, D.; Smith, M. B. Increased Thermal Stability of Proteins in the Presence of Sugars and Polyols. Biochemistry 1979, 18 (23), 5191-5196. (32) Roy, S.; Javid, N.; Frederix, P. W.; Lamprou, D. A.; Urquhart, A. J.; Hunt, N. T.; Halling, P. J.; Ulijn, R. V. Dramatic Specific-ion Effect in Supramolecular Hydrogels. Chemistry 2012, 18 (37), 11723-11731. (33) He, Q.; Huang, Y.; Wang, S. Hofmeister Effect-Assisted One Step Fabrication of Ductile and Strong Gelatin Hydrogels. Advanced Functional Materials 2018, 28 (5), 1705069. (34) Lo Nostro, P.; Ninham, B. W. Hofmeister Phenomena: an Update on Ion Specificity in Biology. Chemical reviews 2012, 112 (4), 2286-2322. (35) Gurau, M. C.; Lim, S. M.; Castellana, E. T.; Albertorio, F.; Sho Kataoka, A.; Cremer, P. S. On the Mechanism of the Hofmeister Effect. Journal of the American Chemical Society 2004, 126 (34), 10522-10523. (36) Dash, M.; Chiellini, F.; Ottenbrite, R. M.; Chiellini, E. Chitosan—A versatile semi-synthetic polymer in biomedical applications. Progress in Polymer Science 2011, 36 (8), 981-1014, (37) Huang, S.; Yao, B.; Xie, J.; Fu, X. 3D Bioprinted Extracellular Matrix Mimics Facilitate Directed Differentiation of Epithelial Progenitors for Sweat Gland Regeneration. Acta biomaterialia 2016, 32, 170-177. (38) Hung, K. C.; Tseng, C. S.; Dai, L. G.; Hsu, S. H. Water-based Polyurethane 3D Printed Scaffolds with Controlled Release Function for Customized Cartilage Tissue Engineering. Biomaterials 2016, 83, 156-168. (39) Shao, Y.; Fu, J. Integrated Micro/nanoengineered Functional Biomaterials for Cell Mechanics and Mechanobiology: a Materials Perspective. Advanced materials 2014, 26 (10), 1494-1533. 42


Page 42 of 44

Page 43 of 44 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(40) Wang, X.; Hu, X.; Kawazoe, N.; Yang, Y.; Chen, G. Manipulating Cell Nanomechanics Using Micropatterns. Advanced Functional Materials 2016, 26 (42), 7634-7643. (41) Huang, W.; Wang, Y.; Chen, Y.; Zhao, Y.; Zhang, Q.; Zheng, X.; Chen, L.; Zhang, L. Strong and Rapidly Self-Healing Hydrogels: Potential Hemostatic Materials. Advanced healthcare materials 2016, 5 (21), 2813-2822. (42) Wei, J.; Wang, J.; Su, S.; Wang, S.; Qiu, J.; Zhang, Z.; Christopher, G.; Ning, F.; Cong, W. 3D Printing of an Extremely Tough Hydrogel. RSC Advances 2015, 5 (99), 81324-81329. (43) Zhao, D.; Huang, J.; Zhong, Y.; Li, K.; Zhang, L.; Cai, J. High-Strength and High-Toughness Double-Cross-Linked Cellulose Hydrogels: A New Strategy Using Sequential Chemical and Physical Cross-Linking. Advanced Functional Materials 2016, 26 (34), 6279-6287. (44) Annabi, N.; Shin, S. R.; Tamayol, A.; Miscuglio, M.; Bakooshli, M. A.; Assmann, A.; Mostafalu, P.; Sun, J.-Y.; Mithieux, S.; Cheung, L.; Tang, X. S.; Weiss, A. S.; Khademhosseini, A. Highly Elastic and Conductive Human-Based Protein Hybrid Hydrogels. Advanced materials 2016, 28 (1), 40-49. (45) Armstrong, C. G.; Mow, V. C. Variations in the Intrinsic Mechanical Properties of Human Articular Cartilage with Age, Degeneration, and Water content. Journal of Bone & Joint Surgery American Volume 1982, 64 (1), 88-94. (46) Lu, T. J.; Chiu, F. Y.; Chiu, H. Y.; Chang, M. C.; Hung, S. C. Chondrogenic Differentiation of Mesenchymal Stem Cells in Three-Dimensional Chitosan Film Culture. Cell transplantation 2017, 26 (3), 417-427. (47) Huang, G. S.; Dai, L. G.; Yen, B. L.; Hsu, S. H. Spheroid Formation of Mesenchymal Stem Cells on Chitosan and Chitosan-hyaluronan Membranes. Biomaterials 2011, 32 (29), 6929-6945. 43



Table of Contents

44


Page 44 of 44

Fabrication of multiple-layered hydrogel scaffolds with elaborate

Recommend Documents