Fabrication of Self-Assembled Nanoporous Structures from a Self

Subscriber access provided by Kaohsiung Medical University

Article

Fabrication of Self-Assembled Nanoporous Structures from Self-Templating M13 Bacteriophage Jiye Han, Vasanthan Devaraj, Chuntae Kim, Won-Geun Kim, DongWook Han, Suck Won Hong, Yong-Cheol Kang, and Jin-Woo Oh ACS Appl. Nano Mater., Just Accepted Manuscript • DOI: 10.1021/acsanm.8b00500 • Publication Date (Web): 17 May 2018 Downloaded from http://pubs.acs.org on May 17, 2018

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 24 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Applied Nano Materials

Fabrication of Self-Assembled Nanoporous Structures from Self-Templating M13 Bacteriophage Jiye Han, a, c, ‡ Vasanthan Devaraj, b, ‡ Chuntae Kim, a, c Won-Geun Kim, a Dong-Wook Han, d Suck Won Hong, d Yong-Cheol Kang, e Jin-Woo Oh a, b, c, f, * a

Department of Nano Fusion Technology, Pusan National University, Busan 46241, Republic of

Korea b

Research Center for Energy Convergence and Technology Division, Pusan National University,

Busan 46241, Republic of Korea c

BK21 plus Nanoconvergence Technology Division, Pusan National University, Busan 46241,

Republic of Korea d

Department of Cogno-Mechatronics Engineering, Pusan National University, Busan 46241,

Republic of Korea e

Department of Chemistry, Pukyong National University, Busan 48513, Republic of Korea

f

Department of Nanoenergy Engineering, Pusan National University, Busan 46241, Republic of

Korea

ACS Paragon Plus Environment

ACS Applied Nano Materials 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ABSTRACT In this work, a model for self-assembled nanopore formation was devised based on multilayer film deposition. The laminated film with the self-assembled nanoporous surface was fabricated by utilizing nanofiber-like M13 bacteriophage from a simple fabrication method. The fabricated laminated structure containing nanopores agreed well with the model and was well supported by optical results. This optical result confirms the structural transitions from a poor initial surface layer to final nanoporous surface layer and was verified by experiment and simulation. The study shows that the M13 bacteriophage act as a self-templating layer helping in a formation of self-assembled nanoporous structures. Successful fabrication of laminated films with porous surface consist of a uniform distribution of nanopores with a width of ~ 150 nm – 500 nm and a depth of 15 nm – 30 nm on a large scale. Our fabrication approach based on simplicity, and easy fabrication along with low-cost, large-scale manufacturing will open the path for interesting applications in field of plasmonics, filters, tissue engineering, and so, on. KEYWORDS: M13 bacteriophage, self-assembly, self-templating, porous structures, laminated films, simulations


Page 2 of 24

Page 3 of 24 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


1. INTRODUCTION Fabrication of nanostructures and devices by self-assembly has attracted considerable interest recently because of their highly ordered, well defined structural properties

1–5

and versatile functionalities. Furthermore, they offer several advantages

from the perspective of large-scale production, viz. their compatibility with the requirements of systematic control systems, scope for efficiency improvements, and relatively low costs

6–14

. In addition, unexpected useful applications, such as, filters, color

sensors, and surface plasmonic resonance sensors, have also been identified

15–17

. Despite

the recent significant advances made involving the self-assembly of functional materials, difficulties persist in the building of highly complex and hierarchically ordered structures. Biological systems aid understanding of self-assembly and structure formation, 18–23 and mimicking biologic self-assembly offers a promising approach but challenges regarding uncertainties and complexities of the structures produced remain. Viruses were recently highlighted as unique natural building blocks for the self-assembly processes. Furthermore, genetic engineering of viruses has allowed us to overcome the obstacles of self-assembly and offers interesting novel opportunities to integrate various materials into highly self-ordered nanostructures using biologically inspired processes 24, 25. Of the different viruses, the M13 bacteriophage (hereafter referred as M13 phage) offers an excellent biological building block for the assembly of novel materials. The highly anisotropic shape and monodispersity of M13 phage originate from high-fidelity biological reproduction and enables it to exhibit liquid-crystalline (LC) behavior, and in suspension, highly ordered structures can be formed. M13 phage has been used in fabrication of biomimetic structures 26, solar cells 27, phage displays

28

, imaging

29

, photovoltaic and piezoelectric devices


30-32

, sensors

33

, cancer


therapy 38

34

Page 4 of 24

, gene delivery 35, tissue regeneration 36, hydro- and aero-gels 37 and membrane filters

.

Figure 1. (a) Schematic illustration of M13 phage structure and pVIII amino acid sequences. (b) Self-templating fabrication model for the self-assembled nanoporous structure involving M13 phage and PDDA layers. Black arrow regions describe the selfassembly fabrication schematic and are not to scale. Cross-sectional SEM image (yellow dotted line highlight) shows the thickness of ~ 2.69 µm for ten-layered laminated structure.

In this work, we propose a new fabrication model for self-assembled nanopore formation in a laminated film as verified by experimental and three-dimensional (3D) simulation results. The fabrication method for laminated films with self-assembled nanoporous

structures

consisting

of

alternating

M13

phage

and

polydiallyldimethylammonium chloride (PDDA) layers was established. This method


Page 5 of 24 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


differs from previous ones as M13 phages act as a self-template layer resulting in a formation of self-assembled nanoporous structure. Because of the self-templating M13 phage property, it was possible to fabricate the nanoporous structures without the presence of an external template. The fabrication method used was simple, straightforward, non- lithographical, and thus, cost-effective.

2. METHODS 2.1. GENETIC ENGINEERING OF M13 BACTERIOPHAGE

Fig. 1a shows the M13 phage geometry information. The N-terminus of major coat protein pVIII was genetically engineered with four negatively charged amino-acid glutamate(E). M13 phages (New England Bio-labs) were genetically engineered using recombinant DNA engineering methods. The desired peptide sequences positioned between the first and fifth amino acids of the N-terminus of wild-type phage pVIII coat proteins with residues 4 (Ala-Glu-Glu-Glu-Glu-Asp) were replaced using an inverse polymerase chain reaction (PCR) cloning method. The M13KE (NEB, #N0316) vector with

an

engineered

PstI

site

was

used

as

a

template

and

5’-

ATATATCTGCAGGAAGAAGAGG AACCCGCAAAAGCGGCCTTTAACTCCC - 3’ was used as a primer. The sequences of the products were verified by DNA sequencing analysis (Cosmo-Gentech, Republic of Korea). The genetically engineered bacteriophage was negatively charged with four glutamic acids (E) [30].

2.2. FABRICATION OF M13 BACTERIOPHAGE BASED LAMINATED FILM



The laminated multilayer film was fabricated by pulling method using commercial syringe pump (LEGATO 270, kdScientific). 4E type M13 phage (5 mg/ml) and PDDA (2 wt. %) solutions were loaded in micro-centrifuge tubes. The glass substrate was attached to the commercial syringe pump with a help of metal tweezer. The dipping and pulling speeds (current work speed: 190.957 ml/minute) were controlled by syringe pump’s inbuilt software. The laminated film consisted ten layers: 5 pairs of M13 phage/PDDA layers. O2 plasma treatment was carried out for the substrate (for hydrophilic nature) and it was dipped in cysteamine to facilitate cross-linking with M13 phage. To fabricate the laminated film with porous surfaces, the glass substrate was dipped in respective solutions for 2 seconds and pulled out to dry naturally at room temperature for 30 minutes. The process was repeated till ten layers were deposited. Please see the supporting information (hereafter SI) figure S1 for additional fabrication details.

2.3. SELF-TEMPLATING FABRICATION MODEL

The schematic of the self-templating fabrication model is shown in Fig. 1b. The idea was to form a self-assembled nanopores in the laminated film from a self-templating M13 phage layer(s) with a poor surface quality. To achieve this self-templating layer, randomly distributed nanofiber shaped M13 phages were deposited (like networking structure) with a poor surface quality, which would act like a template for porous structure formation. By varying the concentration of solution, deposition time and speed, it was possible to fabricate such layers. Furthermore, the nanofiber geometry of M13 phages plays a supporting role in it. The flexible nature of the fibrous M13 phage is


Page 6 of 24

Page 7 of 24 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


helpful in self-templating as a networking structure with rough surface and uneven gaps (width WRS and depth DRS). This is because the M13 phage exhibits LC behavior during the self-assembly process. In the PM fabrication process, when the substrate was pulled, evaporation proceeded much faster near the air-liquid-solid contact. This would result in the local accumulation and deposition of M13 phages on the substrate at the meniscus. At this point, there are believed to be two crucial factors for self-assembly: local induction of chiral LC phase transitions at the meniscus and influence of interfacial forces acting at the meniscus. By interplaying these factors during film growth, it was possible to produce different novel structures, such as a nematic orthogonal twist, cholesteric helical ribbon, and smectic helicoidal nanofilament. In the two types of LC phases (thermotropic and lyotropic), the self-assembly nature of biological systems was driven by the influence of the lyotropic phase. Lyotropic liquid crystals showed many phases because of their wide temperature range and concentration of biological particles. The most important among them was the concentration (of M13 phage), which affected the lyotropic-LC phase significantly. To fabricate a layer like networking structure with uneven film surface, a low concentration (5 mg/ml) phage solution was prepared. At such low concentrations, M13 phages were distributed in a random order and are referred to as an isotropic phase

26, 28

.

For a nanoporous surface formation in the multilayer film, following were critical conditions of the initial M13 phage layers: random distribution (of M13 phages) like networking structure, and poor surface quality. At low concentrations like 5 mg/ml along with the combination of deposition time and pulling speed, target initial layers with poor surface roughness (non-uniform film surface causing uneven width WRS and depth DRS)



Page 8 of 24

was fabricated. Such above fabrication conditions could meet the requirements of the initial stage layers as proposed in this fabrication model.

The PDDA film deposited onto M13 phage layers in an alternating manner, filled imperfections in the phage layer, and thereby, improved surface quality

39, 40

. This is

depicted schematically by the plot of initial stage layers (Fig. 1b); Ln represents a layer with improved surface quality that contains no pores. Pore formation began to occur from Ln+1, as the surface quality was improved (e.g., by ~ 50% or more to compared to the first layer L1). The large uneven surfaces caused by WRS and DRS were reduced, resulting in the formation of smaller gaps, which would become the foundation for pore formation. At this stage of deposition, the nanofiber-shaped geometry of the deposited M13 phage film tends to form smaller gaps with a width “W” and depth “D”, resulting in early stage pore formation, which would be well supported by an alternative PDDA layer deposition. As the number of layers were increased further, W and D decreased and finally clear pore formation could be seen at the Lm layer (Fig. 1b, schematic final stage layers plot). The surface quality would improve as the number of layers were increased.

3. RESULTS AND DISCUSSION 3.1. MORPHOLOGICAL ANALYSIS

The pulling method (PM) was used to fabricate the self-assembled nanoporous laminated structure. Fig. S1a (SI) explains the schematic diagram of PM, where the substrate was dipped alternatively in a genetically modified 4E type M13 phage solution


Page 9 of 24 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 2. (a – h) 5x5 µm AFM surface morphology images of 1, 2, 3, 4, 5, 6, 8, and 10 layers, respectively. The scale bar is same for all AFM images. (i – j) AFM line profiles obtained from white lines numbered 1 – 5 in (h) describes the width and depth of pores at end of ten-layer deposition.

and PDDA polymer solution (a concentration of 2 wt. % was prepared). Fig. S1b (see SI) provides details of the fabrication flow-chart. To understand the self-assembly of nanopores, detailed analysis of the surface morphology was performed for each layer. Fig.



2a – h shows the surface morphology (AFM) of the laminated film consisting of 1, 2, 3, 4, 5, 6, 8, and 10 layers. As predicted in the fabrication model, the shape of the M13 phage plays an important role in the formation of self-assembled pores due to its nanofiber shaped geometry. In initial layers (1st, 3rd) nano-fiber shaped M13 phages were distributed in random order, resulting in a formation of networking structure with larger WRS 26, 28, 34, 41 – 43

.

This networking nano-fiber shaped M13 phages act as self-template for initial stage pore formation. Initially deposited layers exhibited poor surface quality (surface roughness ~ 71 nm/54 nm for 1st/3rd layer respectively). At this stage, the coating in the PDDA solution (2nd, 4th layer) assisted in filling those WRS partially, due to faster dipping time. The surface roughness began to improve as number of layers was increased (Fig. 3a). Significant changes appeared from the 5th layer, as the pores began to form and supported well by alternative PDDA layers, which were not observed in the earlier PDDA layers. Between layers 1 – 3, the surface quality was very poor and the coating of the next layer trying to cover those large WRS became a major priority, making pore (approximately W ≤ 1000 nm) formation a difficult task. The surface quality of the 5th layer improved by ~ 50% compared to the earlier layer(s) and comparatively smaller gap sizes (width W ~ 700 nm – 1200 nm) are observed as seen in Fig. 2e (detailed comparison in SI Fig. S3). As further layers were deposited, a major change occurs dominantly in pore width and depth along with a decrease in surface roughness (Fig. 3b, c). The clear formation of selfassembled pores could be observed in the AFM images of the 8 and 10 layered laminated structure. AFM line profile data obtained from Fig. 2h showed pores with a W of ~ 150 –


Page 10 of 24

Page 11 of 24 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


500 nm and a D of ~ 15 nm – 35 nm from a ten-layered laminated structure (Fig. 2 i – j). To fabricate the current multilayer film with a porous surface, self-templating nature of M13 phage was required. And further, random distribution of nanofibrous M13 phages (networking-like structure) was important. Based upon these two important parameters along with LC behavior, nanoporous surfaces evolved in the multilayered film. Please note, it was possible to fabricate uniform distribution of self-assembled nanopores surface in a large scale from our fabrication method (Fig. 3d). SEM images (Fig. 3e – f) obtained from top and perspective view of a ten-layered laminated structure was in good support with AFM information as well. Pore W of ~ 150 nm could be seen from the highresolution SEM image. Additionally, pore size distribution could be seen from figures 3b and 3c. At minimal layer (example layer 6), pores showed geometrical properties with larger width and depth, comparably. Upon increasing the layers, linear decrease in width and depth of nanopores were observed. This suggests, control of pore size as function of layer number in our multilayered film. The significant advantage of our fabrication of nanoporous surface was it done without the presence of an external template

38, 44

. The

fabricated self-assembled laminated structure was in good agreement with the proposed model for the formation of nanopores with a combination of initial and final stage layers, as shown in Fig. 1b. In next part of this work, we plan to fabricate nanoporous surfaces with uniform size and distribution in a large area. Such unique nanoporus surfaces in our multi-layer laminated film is possible by varying the concentration of solution, deposition time and dipping speed 44. Two primary applications from this nanoporous multilayer film will be possible: gap plasmonics and filter. In case of plasmonic application, we plan to spray metallic (gold or silver) nanoparticles and investigate hot-spot (nano-gap formed



between pore wall and nanoparticle edge) properties. It is possible to control the gap size by varying

Figure 3. (a) Surface roughness information obtained from AFM data with respect to every layer. Surface roughness data were obtained from different parts of sample and averaged. Decrease in surface roughness values indicate the improvement in surface quality as number of layers increased. The black line is guide for eyes only. Pore


Page 12 of 24

Page 13 of 24 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


geometry information obtained from 5th layer to 10th layer by AFM is shown in (b) and (c) for depth and width, respectively. Nanopores with width of ~ 150 nm – 500 nm and depth of 15 nm – 30 nm were formed finally in ten-layered laminated film. (d) 30x30 µm AFM image measured from ten-layered film surface showing uniform nanopore distribution in a large scale. Top (e) and perspective (f, g) view of SEM images of nanoporous surface from ten-layer film are shown.

the humidity and check the near-field enhancement from the hot-spots for surfaceenhanced Raman spectroscopy (SERs) applications. Additionally, metallization of M13 phages will significantly increase near-field enhancement caused by hot-spots. In case of a filter, removal of unwanted bottom layers need to be processed and regular nanoporous layers would be utilized.

3.2. REFLECTIVITY RESULTS – SIMULATION AND EXPERIMENT

To further validate the proposed fabrication model, three-dimensional (3D) finitedifference time-domain (FDTD) simulations were carried out using a plane wave source and optical experiments were performed (see SI). Two types of structural models were simulated: rough surface (RS) only model and combination of rough + porous (RP) surface model (Fig. 4a). As the name suggests, the first model assumes all layers have a rough surface. The RP structure differs from the first model from the 5th layer as the pores were incorporated in the surface of all layers thereafter. Surface information obtained by



Page 14 of 24

AFM is helpful in determining the structure. The pores were modelled as a parabolic shape derived from the following equation:

45

z c , 4 ∗

(1)

Figure 4. (a) Three-dimensional finite-difference time-domain (FDTD) simulation of the laminated structure. (b) Simulation and experimental reflectivity data taken at λ = 600 nm. (c) Schematic cross-section of 3D FDTD simulation of unit-cell single layer nanopore model (refractive index n = 1.5). (d) 2D contour graph showing reflectance results for pore width “W” versus depth “D” parameters.

Here “D” and “W” represents the pore depth and width, respectively. The reflectance (R) data at λ = 600 nm were chosen because the M13 phage, PDDA, and substrate do not


Page 15 of 24 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


have absorption issues at this region, which is helpful in investigating the optical properties. Layer number “0” represents the substrate R = 4.2%, which is well known. No difference in “R” was noted until 4 layers in both RS and RP models because of the similar structure (Fig. 4b). The difference in “R” starts from the 5th layer. Negligible changes in reflectivity were observed for the RS model because of its rough textured layers 46. The interesting data comes with the RP surface model, where a linear increase in “R” was observed from 5 layers to 10 layers, which was caused by the formation of nanopores at the surface of each layer. R = 6.7% was obtained for the 10 layered structure compared to 4.5% (4 layers). A reflectance experiment was carried out to confirm the simulation results. The experimental results were in good agreement with the RP surface model simulation results. R values of 4.3% and 6.6% were obtained for 4 and 10 layered structures, respectively (Fig. 4b). Pore formation from the 5th layer played an important role in the linear increase in “R”. To explain this phenomenon in detail, single layer unit cell simulation (refractive index n = 1.5) consisting a single pore was performed (Fig. 4c). For each “W”, “D” was varied individually to understand the “R” behavior in detail. Smaller values of “R” were observed for all pore “W” when “D” was larger. As “D” began to decrease, “R” increased gradually (Fig. 4d). This linear increase in “R” could be explained by an example – solid immersion lens (SIL). In an optimized SIL, light would be collected efficiently within a smaller numerical aperture (NA)

45, 47

. The pores had a

similar shape to that of an inverted parabolic SIL (Fig. S4, SI). Light could be transmitted comparatively better, when the pore “D” was large enough. Internal reflections and diffractions can be minimized in the appropriate larger pore depths, resulting in minimal “R” values. In case of smaller pore depth, contributions from the diffraction and internal



reflections could increase comparably, leading to an increase in “R”. These properties were reflected well in the simulation results: minimum R of 2.7% were obtained for larger pore “D” and comparatively higher “R” ≥ 4% for pore “D” ≤ 30 nm. This similar “R” behavior can be applied to the laminated nanoporous structure: a linear increase in “R” as the pore “D” began to decrease. In present work, we had proposed a new self-templating fabrication model involving genetically engineered M13 phage for the evolution of nanoporous surface in the multilayer film. This was successfully verified by optical experiment and simulation results. The optical properties reported in this work was important, as it shows the structural transitions from a poor initial surface layer to final nanoporous surface layer. This will open an interesting fabrication approach for selfassembled nanopores in a multilayer film.

4. SUMMARY In summary, we fabricated a self-assembled nanoporous laminated structure based on M13 phage/PDDA using the pulling method. Significantly in our pulling method fabrication, nanoporous surface were fabricated without a presence of an external template. The proposed self-templating fabrication model utilizing genetically engineered M13 phage were verified successfully by experiment and simulations. The optical results (experiment and simulation) confirms the structural transitions from poor initial surface layer to final layer with a nanoporous surface. M13 phage geometry played key role as a self-template in pore formation because of its nanofiber geometry. The important advantage of this structure relies on its simple and easy fabrication, relative attractiveness in terms of low-cost manufacturing and applicability to large scale production when compared with relatively complex fabrication methods. We hope our


Page 16 of 24

Page 17 of 24 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


fabrication approach involving M13 phage opens interesting applications in the field of tissue engineering, filters, plasmonics, sensors, and so on 48, 49.

SUPPORTING INFORMATION Supporting Information available: Phage quantification, structural characterization, and simulation details. SI figures: fabrication process (S1), additional morphological results (S2, S3), and pore shape fitting for simulation model (S4). This material available free of charge via the internet at http://pubs.acs.org. CORRESPONDING AUTHOR Professor Jin-Woo Oh Email: [email protected] AUTHOR CONTRIBUTIONS ‡

J. H and V. D contributed equally.

NOTES The authors declare no competing financial interests.

ACKNOWLEDGEMENTS This research was supported by the Pioneer Research Center Program through the National Research Foundation of Korea funded by the Ministry of Science (NRF2013M3C1A3065469), National Research Foundation of Korea grant funded by the Korean Government (MSIP, MOE) (NRF-2016R1C1B2014423), and Creative Materials



Discovery Program by the National Research Foundation of Korea funded by Ministry of Science and ICT (NRF-2017M3D1A1039287).

REFERENCES (1) Whitesides, G. M.; Grzybowski, B. Self-Assembly at All Scales. Science 2002, 295, 2418 – 2421. (2) Heiss, M.; Fontana, Y.; Gustafsson, A.; Wust, G.; Magen, C.; O’Regan, D. D.; Luo, J. W.; Ketterer, B.; Conesa-Boj, S.; Kuhlmann, A. V.; Houel, J.; Russo-Averchi, E.; Morante, J. R.; Cantoni, M.; Marzari, N.; Arbiol, J.; Zunger, A.; Warburton, R. J.; Morral, A. F. Selfassembled quantum dots in a nanowire system for quantum photonics. Nat. Mater. 2013, 12, 439 – 444. (3) Capito, R. M.; Azevedo, H. S.; Velichko, Y. S.; Mata, A.; Stupp, S. I. Self-Assembly of Large and Small Molecules into Hierarchically Ordered Sacs and Membranes. Science 2008, 319, 1812 – 1816. (4) Zhang, S. Fabrication of novel biomaterials through molecular self-assembly. Nat. Biotech 2003, 21, 1171 – 1178. (5) Ulman, A. Formation and Structure of Self-Assembled Monolayers. Chem. Rev. 1996, 96, 1533 – 1554. (6) Karpan, V. M.; Khomyakov, P. A.; Starikov, A. A.; Giovannetti, G.; Zwierzycki, M.; Talanana, M.; Brocks, G.; van den Brink, J.; Kelly, P. J. Theoretical prediction of perfect spin filtering at interfaces between close-packed surfaces of Ni or Co and graphite or graphene. Phys. Rev. B 2008, 78, 195419(1) – 195419(11).


Page 18 of 24

Page 19 of 24 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(7) Weissman, J. M.; Sunkara, H. B.; Tse, A. S.; Asher, A. Thermally Switchable Periodicities and Diffraction from Mesoscopically Ordered Materials. Science 1996, 274, 959 – 963. (8) Inagaki, S.; Guan, S.; Ohsuna, T.; Terasaki, O. An Ordered mesoporous organosilca hybrid material with a crystal-like wall structure. Nature 2001, 416, 304 – 307. (9) Weickert, J.; Dunbar, R. B.; Hesse, H. C.; Wiedemann, W. Nanostructured Organic and Hybrid Solar cells. Adv. Mater. 2011, 23, 1810 – 1828. (10) D. Granados, J. M. Garcia, In(Ga)As self-assembled quantum ring formation by molecular beam epitaxy. Appl. Phys. Lett. 2003, 82, 2401 – 2403. (11) Zhong, L. S.; Hu, J. S.; Liang, H. P.; Cao, A. M.; Song, W. G.; Wan, L. J. SelfAssembled 3D Flowerlike Iron Oxide Nanostructures and Their Application in Water treatment. Adv. Mater. 2006, 18, 2426 – 2431. (12) Yu, X; Xiao, K.; Chen, J.; Lavrik, N. V.; Hong, K.; Sumpter, B. G.; Geohegan, D. B. ACS Nano 2011, 5, 3559 – 3567. (13) Claudon, J.; Bleuse, J.; Malik, N. S.; Bazin, M.; Jaffrennou, P.; Gregersen, N.; Sauvan, C.; Lalanne, P.; Gerard, J. M. A highly efficient single-photon source based on a quantum dot in a photonic nanowire. Nat. Photon. 2010, 4, 174 – 177. (14) Nie, Z.; Petukhova, A.; Kumacheva, E. Properties and emerging applications of selfassembled structures made from inorganic nanoparticles. Nat. Nanotech. 2009, 5, 15 – 25. (15) Medintz, I. L.; Clapp, A. R.; Mattoussi, H.; Goldman, E. R.; Fisher, B.; Mauro, J. M. Self-assembled nanoscale biosensors based on a quantum dot FRET donors. Nat. Mater. 2003, 2, 630 – 638. (16) Kim, S. H.; Lee, S. Y.; Yang, S. M.; Yi, G. R. Self-assembled colloidal structures for



photonics. NPG Asia Mater. 2011, 3, 25 – 33. (17) Barnes, W. L.; Dereux, A.; Ebbesen, T. W. Surface plasmon subwavelength optics. Nature 2003, 424, 824 – 830. (18) Sundar, V. C.; Yablon, A. D.; Grazul, J. L.; Ilan, M.; Aizenberg, J. Fibre-optical features of a glass sponge. Nature 2003, 424, 899 – 900. (19) Aizenberg, J.; Weaver, J. C.; Thanawala, M. S.; Sundar, V. C.; Morse, D. E.; Fratzl, P. Skeleton of Euplectella sp.: Structural Hierarchy from the Nanoscale to the Macroscale. Science 2005, 309, 275 – 278. (20) Yan, H.; Park, S. H.; Finkelstein, G.; Reif, J. H.; LaBean, T. H. DNA-Templated SelfAssembly of Protein Arrays and Highly Conductive Nanowires. Science 2003, 301, 1882 – 1884. (21) Mao, C.; Solis, D. J.; Reiss, B. D.; Kottmann, S. T.; Sweeney, R. Y.; Hayhurst, A.; Georgiou, G.; Iverson, B.; Belcher, A. M. Virus based Toolkit for the Directed Synthesis of Magnetic and Semiconducting Nanowires. Science 2004, 303, 213 – 217. (22) Malvankar, N. S.; Vargas, M.; Nevin, K. P.; Franks, A. E.; Leang, C.; Kim, B. C.; Inoue, K.; Mester, T.; Covalla, S. F.; Johnson, J. P.; Rotello, V. M.; Tuominen, M. T.; Lovley, D. R. Tunable metallic-like conductivity in microbial nanowire networks. Nat. Nanotech. 2011, 6, 573 – 579. (23) Palmer, L. C.; Newcomb, C. J.; Kaltz, S. R.; Spoerke, E. D.; Stupp, S. I. Biomimetic Systems for Hydroxyapatite Mineralization Inspired By Bone and Enamel. Chem. Rev. 2008, 108, 4754 – 4783. (24) Whaley, S. R.; English, D. S.; Hu, E. L.; Barbara, P. F.; Belcher, A. M. Selection of peptides with semiconductor binding specificity for directed nanocrystal assembly. Nature


Page 20 of 24

Page 21 of 24 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


2000, 405, 665 – 668. (25) Lee, S. W.; Mao, C.; Flynn, C. E.; Belcher, A. M. Ordering of Quantum Dots Using Genetically Engineered Viruses. Science 2002, 296, 892 – 895. (26) Yang, S. H.; Chung, W. J.; Mcfarland, S.; Lee, S. W. Assembly of Bacteriophage into Functional Materials. Chem. Rec. 2013, 13, 43 – 59. (27) Moon, J. S.; Kim, W. G.; Kim, C.; Park, G. T.; Heo, J.; Yoo, S. Y.; Oh, J. W. M13 Bacteriophage-Based Self-Assembly Structures and Their Functional Capabilities. MiniRev. Org. Chem. 2015, 12, 271 – 281. (28) Chung, W. J.; Oh, J. W.; Kwak, K.; Lee, B. Y.; Meyer, J.; Wang, E.; Hexamer, A.; Lee, S. W. Biomimetic self-templating supramolecular structures. Nature 2011, 478, 364 – 368. (29) Ghosh, D.; Lee, Y.; Thomas, S.; Kohli, A. G.; Yun, D. S.; Belcher, A. M.; Kelly, K. A. M13-templated magnetic nanoparticles for targeted in vivo imaging of prostate cancer. Nat. Nanotech. 2012, 7, 677 – 682. (30) Lee, B. Y.; Zhang, J.; Zueger, C.; Chung, W. J.; Yoo, S. Y.; Wang, E.; Meyer, J.; Ramesh, R.; Lee, S. W. Virus-based piezoelectric energy generation. Nat. Nanotech. 2012, 7, 351 – 356. (31) Kim, W. G.; Kim, K.; Ha, S. H.; Song, H.; Yu, H. W.; Kim, C.; Kim, J. M.; Oh, J. W. Virus based Full Colour Pixels using a Microheater. Sci. Rep. 2015, 5, 13757. (32) Shin, D. M.; Han, H. J.; Kim, W. G.; Kim, E.; Kim, C.; Hong, S. W.; Kim, H. K.; Oh, J. W.; Hwang, Y. H. Bioinspired piezoelectric nanogenerators based on vertically aligned phage nanopillars. Energy Environ. Sci. 2015, 8, 3198 – 3203. (33) Moon, J. S.; Kim, W. G.; Shin, D. M.; Lee, S. Y.; Kim, C.; Lee, Y.; Han, J.; Kim, K.; Yoo, S. Y.; Oh, J. W. Bioinspired M-13 bacteriophage-based photonic nose for differential



cell recognition. Chem. Sci. 2017, 8, 921 – 927. (34) Gandra, N.; Abbineni, G.; Qu, X.; Huai, Y.; Wang, L.; Mao, C. Bacteriophage Bionanowire as a Carrier for Both Cancer-Targeting Peptides and Photosensitizers and its use in Selective Cancer Cell Killing by Photodynamic Therapy. Small 2013, 9, 215 – 221. (35) Ma, K.; Wang, D. D.; Lin, Y.; Wang, J.; Patrenko, V.; Mao, C. Synergetic Targeted Delivery of Sleeping-Beauty Transposon System to Mesenchymal Stem Cells Using LPD Nanoparticles Modified with a Phage-Displayed Targeting Peptide. Adv. Func. Mater. 2013, 23, 1172 – 1181. (36) Sunderland, K. S.; Yang, M.; Mao, C. Phage-Enabled Nanomedicine: From Probes to Therapeutics in Precision Medicine. Angew. Chem. Int. Ed. 2017, 56, 1964 – 1992. (37) Jung, S. M.; Qi, J.; Oh, D.; Belcher, A.; Kong, J. M13 Virus Aerogels as a Scaffold for Functional Inorganic Materials. Adv. Funct. Mater. 2017, 27, 1603203. (38) Lee, Y. M.; Jung, B.; Kim, Y. H.; Park, A. R.; Han, S.; Choe, W. S.; Yoo, P. J. Nanomesh-Structured Ultrathin Membranes Harnessing the Unidirectional Alignment of Viruses on a Graphene-Oxide Film. Adv. Mater. 2014, 26, 3899 – 3904. (39) Modi, M. H.; Rai, S. K.; Thomasset, M.; Lodha, G. S.; Idir, M. Effect of surface roughness on multilayer film growth. Eur. Phys. J. Special Topics 2009, 167, 27 – 32. (40) Richardson, J. J.; Bjornmalm, M.; Caruso, F. Technology-driven layer-by-layer assembly of nanofilms. Science 2015, 348, aaa2491. (41) Peng, S.; Tian, L.; Liang, J.; Mhaisalkar, S. G.; Ramakrishna, S. Polypyrrole Nanorod Networks/Carbon Nanoparticles Composite Counter Electrodes for High-Efficiency DyeSensitized Solar Cells. ACS Appl. Mater. Interfaces 2012, 4, 397 – 404. (42) Zhou, W.; Cao, X.; Seng, Z.; Shui, W.; Zhu, Y.; Yan, Q.; Liu, H.; Wang, J.; Zhang, H.


Page 22 of 24

Page 23 of 24 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


One-Step synthesis of Ni3S2 nanorod@Ni(OH)2 nanosheet core-shell nanostructures on a three-dimensional graphene network for high-performance supercapacitors. Energy Environ. Sci. 2013, 6, 2216 – 2221. (43) Zhang, Z.; Xiao, F.; Qian, L.; Xiao, J.; Wang, S.; Liu, Y. Facile Synthesis of 3D MnO2-Graphene and Carbon Nanotube-Graphene Composite Networks for HighPerformance, Flexible, All-Solid-State Asymmetric Supercapacitors. Adv. Energy Mater. 2014, 4, 1400064. (44) Mansouri, J.; Yapit, E.; Chen, V. Polysulfone filtration membranes with isoporous structures prepared by a combination of dip-coating and breath figure approach. J. Membrane Sci. 2013, 444, 237 – 251. (45) Devaraj, V.; Baek, J.; Jang, Y.; Jeong, H.; Lee, D. Design for an efficient single photon source based on a single quantum dot embedded in a parabolic solid immersion lens. Opt. Express 2016, 24, 8045 – 8053. (46) Koynov, S.; Brandt, M. S.; Stutzmann, M. Black nonreflecting silicon surfaces for solar cells. Appl. Phys. Lett. 2006, 88, 203107-1 – 203107-3. (47) Zwiller, V.; Bjork, G. Improved light extraction from emitters in high refractive index materials using solid immersion lenses. J. Appl. Phys. 2002, 92, 660 – 665. (48) Lumdee, C.; Yun, B.; Kik, P. G. Effect of surface roughness on substrate-tuned gold nanoparticle gap plasmon resonances. Nanoscale 2015, 7, 4250 – 4255. (49) Wang, J.; Wang, L.; Yang, M.; Zhu, Y.; Tomosia, A.; Mao, C. Untangling the Effects of Peptide Sequences and Nanotopographies in a Biomimetic Niche for Directed Differentiation of iPSCs by Assemblies of Genetically Engineered Viral Nanofibers. Nano Lett. 2014, 14, 6850 – 6856.



Table of Contents


Page 24 of 24

Fabrication of Self-Assembled Nanoporous Structures from a Self

Recommend Documents