Fast and Sensitive Detection of Salmonella in Milk Samples Using

Subscriber access provided by UNIV OF SCIENCES PHILADELPHIA

Applications and Health

Fast and sensitive detection of Salmonella in milk samples using aptamer functionalized magnetic silica solid phase and MCM-41-aptamer gate system Gulay Bayramoglu, Veli Ozalp, Uguray Dincbal, and M Yakup Arica ACS Biomater. Sci. Eng., Just Accepted Manuscript • DOI: 10.1021/acsbiomaterials.8b00018 • Publication Date (Web): 05 Mar 2018 Downloaded from http://pubs.acs.org on March 8, 2018

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 29 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Biomaterials Science & Engineering

Fast and sensitive detection of Salmonella in milk samples using aptamer functionalized magnetic silica solid phase and MCM-41-aptamer gate system Gulay Bayramoglu†,‡, V. Cengiz Ozalp┴,├*, Uguray Dincbal† and M. Yakup Arica† †

Biochemical Processing and Biomaterial Research Laboratory, Gazi University, 06500 Teknikokullar, Ankara, Turkey

‡

Department of Chemistry, Faculty of Sciences, Gazi University, 06500, Ankara, Turkey ├

Konya Food & Agriculture University, Bioengineering, Konya, Turkey

┬

Research & Development Center for Diagnostic Kits (KIT-ARGEM), Konya Food & Agriculture University, Konya, Turkey

Corresponding Author *Veli Cengiz Ozalp, [email protected]

KEYWORDS: Milk; Aptamers; Pathogen bacteria; Salmonella; Biosensor; Silica nanoparticles

ACS Paragon Plus Environment

1

ACS Biomaterials Science & Engineering 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 29

ABSTRACT General detection methods for S. enterica include PCR analysis, immunologic methods, solid culturing techniques, and various microscopic studies. Milk and other food samples demonstrate an especially difficult challenge for direct detection, resulting from high biological contents. In this report, we aimed fast detection of pathogen cells through an efficient magnetic capture and subsequent quick detection based on aptamer affinity. The Fe3O4@SiO2@pGMA and MCM-41 particles were prepared separately and used for pre-concentration and detection, respectively. Aptamer oligonucleotide sequences against S. enterica was fixed on both amine functionalized MCM-41 and Fe3O4@SiO2@pGMA particles via glutaraldehyde coupling. The captured Salmonella cells were determined by a fluorescent homogenous assay in the samples by aptamer gated MCM-41 silica particles. Our method achieved a sensitive assay to detect Salmonella cells in milk samples as low as 103 CFU/ml without any culturing. Hence, the proposed sensing strategy might be an efficient platform for pathogen detection in food matrix.

Introduction The MCM-41 family mesoporous silica nanoparticles have been the preferred choice as the support for many applications of nanoscopic mass-transfer control. Silica is a suitable inorganic matrix with multiple appropriate characteristics, such as regular and homogeneous pore structure, having large surface area, chemical and mechanical stability and availability for easy functionalization. Moreover, MCM-41 contains mesopores adjustable with the special synthesis conditions, which allows rapid uptake and release of desired cargo molecules. Hence, they are highly attractive for developing biosensors based on nucleic acid-silica nano-conjugates.1


2

Page 3 of 29 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


S. enterica is a common cause for food-associated disease, which is widely distributed in the environment. It can be transmitted to humans through contaminated milk, poultry, eggs, and meat products. In addition, Salmonella is a facultative intracellular pathogenic organism and its infection can result in the inflammation of digestive system of humans and other mammals. Salmonella causes temporary damages to microvilli part of intestinal epithelial cells whenever the bacteria pass through the surface of the intestinal tissue.1 Monitoring microbial contamination in food samples is complicated by the diversity of molecules present in such complex samples. The reliability of sensing methods is usually affected by high background interference in biological samples. Commonly applied procedures for pathogen infected sample concentration include gravitational techniques, membrane filtering and recognition element functionalized particles. Magnetic pre-concentration has been adapted for pathogen preconcentration and coupled to various sensing formats. For example, we reported magnetic p(HPMA/EGDMA) (poly (hydroxy propyl methacrylate) / ethylene glycole dimethacrylate) beads-based capture of bacteria and subsequent detection by PCR, real-time PCR and quartz Crystal Micro-balance (QCM) for milk samples2-4 and by fluorophore loaded aptamer gatedsilica for blood samples.5 Similar tandem magnetic separation-sensing approaches have been reported, showing the usability of pre-concentration of the target pathogens from food material.68

As functional nucleic acid molecules with specific recognition properties, aptamers have been commonly employed for the facilitation of many aptamer-based biosensors and drug delivery system.9-11 Aptamers are machine-synthesized, single-stranded oligonucleotides (DNA or RNA, or modified nucleic acids) that can assume a 3D structure that facilitates specific binding to a variety of targets, such as metal ions, complex organic compound proteins, and


3


microbial cells.1,

9, 12

Page 4 of 29

The aptamer-based biosensors have been reported for many types of

applications targeting small molecules, proteins, peptides or whole eukaryotic or prokaryotic cells.13 Conjugates of aptamers and nanoparticles have demonstrated superior performance for efficient purification of targets as well as biosensor applications. A few studies have been reported for Salmonella spp. detection using aptamers.14-15 In the recent years, several aptamer ligands have gained increasing attention for detection of various chemicals in food samples, owing to their advantages of high sensitivity, low-cost, and rapid response.16 MCM-41 mesoporous organosilicas have been the focus for the development of the gated hybrid tools as smart nano-devices. Molecular gating aims fine tuning of cargo molecules out/in from the voids of mesoporous supports. MCM-41 can be exploited for various purposes like drug delivery or sensor development. Aptamer-gated MCM-41silica nanoparticles is an alternative optical platform for monitoring ligand binding activities, compared to other extensively used fluorescence-based techniques.17 In fact, nucleic acids, in general, have been a powerful tool in biosensor development.1 Among them, the use of nucleic acid-nanoparticle conjugates has been commonly employed and a considerable number of them are conjugates with mesoporous silica nanoparticles for their high compatibility with medical applications and unique mesoporous structure.1, 17-21 To the best of our knowledge, this work is the first report of a new aptamer-gated MCM-41 silica system to detect S. enterica in food samples. In this study, we demonstrate here a direct method of Salmonella detection in complex food matrix by a two-step procedure (Figure 1). Namely, specific oligonucleotide DNA sequence (Salmonella specific aptamer) for binding S. enterica was used as specific affinity ligand for capturing S. enterica. The selective separation of the aptamer immobilized magnetic Fe3O4@SiO2@pGMA were tested for capturing bacterial


4

Page 5 of 29 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


cells. Particularly, the aptamer Fe3O4@SiO2@pGMA affinity system was employed to screen S. enterica cells in milk samples and integrated to aptamer-MCM-41 particles loaded with fluorescein for specific and sensitive detection of the target microbial cells from pre-concentrated samples.

Materials and Methods Materials

Tetraethyl orthosilacate (TEOS), (3- (aminopropyl)triethoxysilane (APTES)), glycidyl methacrylate

(GMA),

glutaraldehyde,

tris-HCl,

triethylamine,

hydroquinone,

cetyltrimethylammonium bromide (CTAB, purity 99%), hexamethylene diamine (HMDA), tetrahydrofuran (THF), toluene, bipyridine, CuBr, bromoacetyl bromide, ferric chloride (FeCl3), ferrous sulphate (FeSO4) and fluorescein were purchased from Sigma-Aldrich Chem. GmbH (Germany). The GMA monomer was prepared by distilling under reduced pressure after adding hydroquinone and the resulting mixture was stored at 4 °C until use. The oligonucleotides were purchased from IDTDNA (Europe). All other chemicals were obtained from Merck AG (Darmstadt, Germany).

Synthesis of mesoporous MCM-41 silica particles

To synthesize MCM-41 silica particles, 4.0 g of CTAB was added in 190 mL of water: 2propanol mixture (v/v, 14/1) and the solution was mixed at 25 °C for 2.0 h. Then, 2.2 mL of sodium silicate was transferred in 66 mL of deionized water. Subsequent to 2 hours of incubation at 4 ºC, the solution was mixed with the sodium silicate drop by drop in one h, and sonicated for


5


Page 6 of 29

two hours. After that, 20 mL of ethyl acetate was combined with this solution, and applied a 5 min sonication. The resultant mixture was incubated at 30 °C for 5.0 h by stirring. Then, the mixture was heated up to 80 °C and incubated for 72 h. After silica particles precipitated, the solution phase was aspirated and washed with purified water. The silica particles were centrifuge-precipitated at 5000 rpm for a duration of 10 min, vacuum-dried at 35 °C for 18 h and heated to 540 °C in a crucible for calcination.22 Amination of the above prepared MCM-41 silica particles was achieved with coting with APTES. A solution of 0.5 mL APTES was mixed with 14.50 mL of toluene in a flask. Then, a 1.0 g of MCM-41 silica particles was transferred to this solution and refluxed for 14.0 h.22 The resulting amine group modified MCM-41 silica particles was centrifuged down and washed sequentially with methanol and deionized water.

Aptamer gate functionalization and fluorescein loading on MCM-41 silica particles

The amino-modified nanoparticles (10 mg) were incubated with 100 µM fluorescein solution in PBS buffer (10 mM phosphate buffer, pH 7.4; containing NaCl and KCl saline about 0.138 and 0.0027 M, respectively) overnight and capped with aptamer gates through glutaraldehyde coupling method. Release of fluorescein molecules from pores was measured in a fluorescent spectrophotometer (Fluoromax4, Horiba) with excitation at 480 nm and emission 520 nm as previously described.23

Synthesis of magnetic nanoparticles

Magnetic nanoparticles were synthesized by co-precipitation method as described previously.24 Briefly, FeCl3·6H2O and FeSO4·7H2O were added in 100 mL distilled water and agitated under


6

Page 7 of 29 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


nitrogen gas and put in aqueous ammonia filled reactor. The content was refluxed under nitrogen gas at 40 °C with continuous agitation for 2.0 h, and subsequent agitation was applied at 80 °C for 1.0 h.

Coating of magnetic nanoparticles with silica layer

At initial step, the synthesized above magnetic nanoparticles were coated with APTES. APTES (0.45 mL) was mixed with toluene (14.55 mL) in a flask. Then, magnetic nanoparticles (1.0 g) was added to this mixture., which was refluxing at 70 °C for 14.0 h with continuous stirring. Subsequently the magnetic nanoparticles coated with silica (Fe3O4@SiO2) was collected by magnetic force. They were washed with methanol and deionized water. The amine groups of the APTES were reacted with bromoacetyl bromide to generate SI-ATRP initiate sides. Silica coated magnetic nanoparticles (2.0 g), THF (4.0 mL), and triethylamine (1.0 mL) were mixed under nitrogen atmosphere at 10.0 °C. Then, the mixture was sonicated about 10 min, and the mixture was cooled down to 0 °C. After cooling the mixture, 2 mL of bromoacetyl bromide was dropped within 30 min. in a flask that was continuously mixed by rotation at 25 °C for 20 h. The resulting product was washed with acetone and deionized water through magnetic capture separation. The procedure produced Bromine functionalized nanoparticles that were grafted with pGMA brushes.

Br-end functionalized magnetic silica particles grafting with pGMA brushes via ATRP

The Br-end modified magnetic nanoparticles (2.0 g) were placed in a reactor, and monomer GMA (45.2 mmol), copper bromide (0.2 g), bipyridine (1.0 g), and dioxane (10.0 mL) were mixed, and the polymerization mixture was saturated by continuous flowing of nitrogen gas.


7


Page 8 of 29

Subsequently, the flask was sealed and placed in a rotary shaker. The ATRP reaction was incubated at 65 °C for 10 h. and then, the product (Fe3O4@SiO2@pGMA particles) was collected and cleaned by washing with 50 mL methanol and 50 mM ether. The remaining copper residue on the particles was removed by agitation in ethylene diamine tetra-acetic acid (0.1M) and THF mixture for 2.0 h.25 The amount of epoxy groups on the particles were determined as described previously.20

Spacer-arm attachment and activation of pGMA grafted magnetic silica nanoparticles

The epoxy groups on the grafted pGMA were conjugated with HMDA by epoxy ring opening reaction. A 2.0 g of pGMA grafted magnetic silica particles (i.e., Fe3O4@SiO2@pGMA) were put in a flask with 20 mM of HMDA at 1.0 % concentration at pH 11.0. The reaction was continued at 65 °C for 6 h. The HMDA modified product was cleaned with deionized water and methanol. After magnetic collection, the HDMA modified material was left under reduced pressure at 45 °C for 18 h for drying. The free amino groups of the attached HMDA were functionalized by glutaraldehyde for covalent coupling of terminal amino groups of the aptamer. For this purpose, the HMDA modified magnetic particles (about 2.0 g) was transferred in trisHCl buffer solution (50 mol/L, pH 8.0) containing glutaraldehyde about 1.0% (v/v). The activation protocol was realized at 65 °C for 3.0 h. After the reaction, the glutaraldehyde activated particles were washed sequentially with 0.1 mol/L acetic acid solution, and 0.1 mol/L tris-HCl buffer at pH 8.0.

Preparation of aptamer functionalized magnetic silica solid phase and MCM-41 silica systems


8

Page 9 of 29 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


The amine functionalized magnetic silica particles and/or MCM-41 silica particles were first activated with glutaraldehyde by incubating the aminated magnetic silica particles and/or aminated MCM-41 silica particles (about 0.25 g) in phosphate buffer (pH 7.0, 50 mmol/L) for 2.0 h, and transferred into glutaraldehyde solution (2.0 mL, 2.0%, v/v) in the same buffer. Subsequent washing in acetic acid and PBS buffer ensured the removal of unreacted glutaraldehyde.26 Then, the activated silica particles (about 50 mg) were incubated in phosphate buffer (50 mM, pH 8.5) for 30 min, and mixed with Salmonella binding aptamers (1.0 mL, 200 mM). The Salmonella binding aptamer sequence (TATGGCGGCGTCACCCGACGGGGACTTC6-NH2) as used in this study was reported by Joshi et al. 2009.19 The glutaraldehyde activated particles were reacted with amino functionalized aptamer s for immobilization at 25 °C for 6.0 h. Finally, physically adsorbed aptamer molecules were washed away from silica particles with the phosphate buffer. The extent of aptamer immobilization was determined by UV absorption spectra analysis at 265 nm in a UV-VIS spectrophotometer.26

Characterization studies of the magnetic silica and MCM-41 silica particles

The grafting percentage (GP) of the Fe3O4@SiO2@pGMA particles was calculated from the percentage increase in weight using the equation 1. GP = [(mg - m0)/m0] x100

(1)

where mg is the weight of magnetic particles before grafting while m0 is the weights after grafting. A titration procedure dependent on bromo-acetyl bromide reaction was used to determine bromide amount of the magnetic particles.20 This analysis showed that 0.81 mmol bromine for each gram of magnetic particle.


9


Page 10 of 29

The grafted amine groups on the surface of magnetic silica and MCM-41 silica particles was determined by a previously published method based on potentiometric titration.20 The available epoxy group amount on the p(GMA) grafted magnetic particles was analyzed by pyridine-HCl method as described previously.20 Briefly, 16 mL HCl was mixed with 984 mL pyridine, and 50 mL of this the pyridine-HCl solution solution was mixed with 0.5 g sample and refluxed for 20 min. The solution was brought to room temperature and the available epoxy groups was obtained from titration of pyridine-HCl solution with 0.1 moL/L NaOH solution. The specific surface areas and pore dimension of the pristine MCM-41 and aptamer immobilized MCM- 41 particles were calculated from N2 adsorption isotherm and application of BET method.27 The specific surface area, the total pore volume and the pore size distribution of the pristine MCM-41, and aptamer immobilized MCM-41 particles was determined by BET analysis

as described previously.26 The surface area of the particles was measured by an

accelerated surface area and porosimetry system (Micromeritics, ASAP 2010, USA). The particle samples were degassed at 65 °C at less than 10-5 Torr pressure to prepare them for nitrogen adsorption experiments. The phase staet of of the pristine iron oxide core, silica coated magnetic (Fe3O4@SiO2), and pGMA grafted magnetic particles (Fe3O4@SiO2@pGMA) were analyzed by x-ray diffraction (XRD) by Cu-Ka radiation, between 2θ of 20-80° at 0.1 increments and scan speed of 2° per min.25 Phase analysis was achieved by Match! software package with ICDD PDF-2 Powder Diffraction File. MCM-41 samples coated with thin Au layers were analyzed with scanning electron microscopy (SEM, in a ZEISS, Evo 50). The average hydrodynamic diameter of the particles were measured by dynamic light scattering (DLS) in a Zetasizer Nano-S (Malvern Instruments, Worcestershire, UK). ATR-FTIR analysis were performed in a Spectrum 100 FTIR


10

Page 11 of 29 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


spectrometer (Perkin Elmer Inc., Norwalk, CT, USA) equipped with a Universal ATR accessory. The samples of the particles were scanned from 4000 to 525 cm-1 wavelength. The arithmetic mean, standard deviations and the margin of error for each data set were calculated at a confidence interval of 95%. A value of P < 0.05 was assumed as statistically significant. Triplicate samples were used under identical conditions for each analytical determination. Mean values and standard deviations were calculated. The XRD, TGA, VSM, and FTIR analyses were performed in duplicate. The statistical analysis was obtained by the procedure of analysis of variance (p < 0.05).

Bacterial cell cultures

Frozen stocks of Salmonella enterica, Staphylococcus aureus, Escherichia coli or Bacillus subtilis cells were used to inoculate Luria broth (LB culture medium) and grown overnight at 37 °C in. The indicated number of bacteria cultures were prepared by serially diluting with PBS buffer. The surface-plated samples on LB agar medium were incubated overnight at 37 °C in order to count single colony forming units (CFU).

Magnetic pre-concentration of bacterial cells using magnetic silica particles

Salmonella binding DNA aptamer immobilized Fe3O4@SiO2@pGMA particles were used to capture Salmonella cells in PBS buffer or milk samples. The procedure was similar to a previous report for milk samples.2 The Salmonella specific aptamer-immobilized Fe3O4@SiO2@pGMA particles of 0.1 mg were transferred into 1.0 mL of sample solution containing Salmonella enterica, Staphylococcus aureus, Escherichia coli or Bacillus subtilis cells, vortexed thoroughly and incubated at 25 ºC by constant shaking for 20 min. The samples were washed two times with


11


Page 12 of 29

1 mL of PBS each time and the cells was captured by magnetic pull-down. The isolated cells were directly used in the assay procedure. The results were compared with the traditional plate counting method for calculating a recovery rate.

Assay The samples contained specific number of bacterial cells, which were mixed with 0.1 mg of aptamer immobilized MCM-41 silica particles before fluorescent assay or culture plating was performed for colony count determination as previously reported.26 The growing colonies were counted to calculate CFU in each mL of culture. For fluorescent assay, the captured cells from 1 ml milk samples were directly mixed with aptamer-gated silica nanoparticles for 10 min. and measured for the signal (Excitation at 480 nm/Emission at 520 nm).

RESULTS AND DISCUSSION Characterization of Fe3O4@SiO2@pGMA particles Surface-initiated controlled radical polymerization (SI-CRP) has recently been a preferred strategy for interface engineering to obtain polymer brushes.28 In this work, tentacle type polymer grafted Fe3O4@SiO2@pGMA particles were utilized for pre-concentration of S. enterica from food samples. For grafting Fe3O4@SiO2 nanoparticles with the hydroxyl groups, the Fe3O4 particles were treated with APTES and ATRP initiator (i.e., bromoacetylbromide). The properties of the Fe3O4@SiO2@pGMA particles have been characterized by standard techniques, namely ATR-FTIR, VSM, XRD, SEM, BET and analytical methods. The amount of bromide in


12

Page 13 of 29 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


the Fe3O4@SiO2-Br particles was determined as 0.351 mmol g/particles. The SI-ATRP of p(GMA) from the Fe3O4@SiO2-Br surface was carried out to produce tentacle type polymer grafted composite particles (i.e., Fe3O4@SiO2@pGMA). The grafting efficiency after 10.0 h ATRP reaction was found to be 149%. The surface morphology of the Fe3O4@SiO2 and Fe3O4@SiO2@pGMA particles was investigated by SEM for size and shape determination on resulting particles. Both particles were observed to be in powder form (Figure 2a). The grafting of pGMA onto the surface of the Fe3O4@SiO2-Br and immobilization of aptamer ligand on the Fe3O4@SiO2@pGMA particles was established by ATR-FTIR spectroscopy. The spectra of the Fe3O4, Fe3O4@SiO2, Fe3O4@SiO2@pGMA and Fe3O4@SiO2@pGMA-aptamer particles were obtained in the range 400-4000 cm-1 (Figure 2b). The analysis with Fe3O4 particles resulted in a broad band at around 3214 cm-1, an evidence for the presence of -OH group on the surface of magnetic particles (Figure 2b, line A). The FTIR analysis of the Fe3O4 particles resulted in a distinctive band around 602 cm-1, characteristic of the Fe-O vibration associated with the Fe3O4 particles. The Fe3O4@SiO2 particles showed characteristic peaks at 871 and 1092 cm-1 which corresponds to bond stretching of Si-OH, and Si-O-Si, respectively (Figure 2b, line B). The peaks at 908 cm-1 were ascribed to epoxy ring vibration (Figure 2b). As seen in Figure 2b, the characteristic peaks vibration bands of p(GMA) also appeared at 1067 and 1728 cm-1 corresponds to stretching vibration of the alkoxy (C-O), and carbonyl (C=O) groups, respectively (Figure 2b, line C). The band at 1482 cm-1 is related to C-H symmetric and asymmetric stretching modes. The band around 3000 cm-1 can be assigned to surface and bulk OH groups in the particles. The aptamer immobilized Fe3O4@SiO2@pGMA particles showed new asymmetric and symmetric stretching vibration at 1242 cm−1 and 1096 cm−1, respectively (Figure 2b, line D).


13


Page 14 of 29

All these IR spectral analysis proofed that the epoxy groups of the polymer chains reacted with the aptamer ligand molecules. The crystalline structure of the modified magnetic particles was analyzed by XRD (Figure 2c). The XRD patterns of the Fe3O4, and Fe3O4@SiO2@pGMA demonstrated usual diffraction peak areas with the Fe3O4 particles, which suggests that the Fe3O4 are satisfactorily retained in the Fe3O4@SiO2@pGMA particles. The reflection peaks agree well with the X-ray diffraction data cards (ICDD number 88-0315) at eight peaks: (220), (311), (400), (422), (511), (440), (620) and (533). Fe3O4 coated with silica and polymers- shared identical diffraction peaks indicating spinel structure (Figure 2c, line A). This can be considered as an indication for the presence of magnetic core after coating. The Fe3O4, and Fe3O4@SiO2@pGMA particles had the same spinel structures for a magnetite. The crystal structure after preparation of Fe3O4@SiO2@pGMA particles did not show any change.20 Hence, the magnetic properties of iron oxide particles were retained the same during modification reactions (Figure 2c). The magnetic properties of iron oxide and Fe3O4@SiO2@pGMA particles were subjected to vibrating sample magnetometer analysis. The mass magnetization curves were presented against applied magnetic field at room temperature in Figure 2d. The saturation magnetization values were 27.6, and 18.4 emu g-1 for Fe3O4, and Fe3O4@SiO2@pGMA particles, respectively. All the magnetization curves exhibited zero remanence and coercivity, which means that our samples demonstrated superparamagnetic properties. As a consequence of high saturation magnetization, the magnetic particles samples could be separated from the reaction medium using an external magnet. As seen from this figure, the saturation magnetization was strongly dependent on the content of mass on the Fe3O4 particles. A slight decrease in the saturation magnetization of particles was observed upon silica and pGMA grafting. This can be due to the reduced magnetic


14

Page 15 of 29 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


moments per unit weight, resulting from diamagnetic contribution of silica and p(GMA). The super magnetic properties of the Fe3O4@SiO2@pGMA particles can be used for fast and effective recovery of aptamer immobilized magnetic particles which could also promote the specific

interaction

with

the

target

bacteria.

The

average

particle

size

of

the

Fe3O4@SiO2@pGMA particles were determined to range between 112 and 176 nm. The BET surface

area

of

Fe3O4@SiO2@pGMA

particles

was

calculated

by

the

nitrogen

adsorption/desorption isotherms. The total surface area and total pore volume for Fe3O4@SiO2@pGMA were found to be 210 m2 g-1 and 0.97 cm3 /g, respectively. The stability of the Fe3O4@SiO2@pGMA was determined by iron ion content analysis of desorption medium by atomic absorption spectroscopy (AAS). We did not observe any leakage of magnetic particles when the samples were incubated in 0.1 mol/L HNO3 solution at 25 °C, even after storing more than 30 days.

Characterization of MCM-41 silica particles The properties of the pristine and aptamer immobilized MCM-41 particles have been characterized by using BET and ATR-FTIR methods. The pore size of the MCM-41 silica particles was determined as 3.4 nm from nitrogen adsorption isotherms. The total surface area and pore volume of the pristine particles were 1241 m2 g-1 and 0.89 cm3 g-1. After immobilization of aptamer, the appearance surface area and pore volume were reduced about to 981 m2 g-1 and 0.81 cm3 g-1, respectively, which can be interpreted for the presence of immobilized aptamers. Pristine MCM-41 and aptamer immobilized MCM-41 particles were characterized by FT-IR studies (Figure 2A, B and C). The peak band at 810 cm-1 originates from Si-O-Si symmetric


15


Page 16 of 29

stretching vibrations in pristine MCM-41, whereas the IR band at 579 cm-1 is due to O-Si-O bending vibrations (Figure 2A). Additional stretching vibrations peaks of -CH2 (2869 cm-1) and CH3 (2931 cm-1) upon APTES functionalization. New -NH stretching peaks emerged around 3400 and 1510 cm-1 (Figure 2B). After aptamer immobilization: anti-symmetric phosphate stretching vibration and the symmetric phosphate stretching vibration are observed at 1240 cm−1 and 1092 cm−1 respectively (Figure 2C). The FTIR spectra of the aptamer immobilized MCM-41 silica demonstrated significant differences than that of the pristine silica. Previously we showed that modified aptamer sequences would function as molecular gate to release the entrapped fluorophore molecules. The utility of aptamer gate concept with target cells surface were proved as cargo release system for S. aureus cells.29 Following a similar strategy, the Salmonella binding aptamer from literature was converted to a hairpin structure by adding 6 additional nucleotides at the 3’ end and called Salmonella aptamer gate. The APTES modified MCM-41 mesopores were modified with glutaraldehyde for subsequent amine coupling with the Salmonella aptamer gate oligo functionalized with a 5’-amine group as previously described.30

Pre-concentration of Salmonella cells from milk samples Salmonella binding DNA aptamer immobilized MCM-41 type silica nanoparticles were tested for their capture efficiency for Salmonella cells in PBS buffer and Milk samples. Samples containing known numbers of bacteria were treated with capture procedure by mixing aptamerfunctionalized nanoparticles and one ml of milk sample. After an incubation period of 30 minutes, the particles were collected by centrifugation, washed and the captured cells were counted by plate culture procedures. The capture efficiency of Si-NP was 76% for experiments with 102 Salmonella cells (Figure 4A). The unspecific capture was tested with control bacteria


16

Page 17 of 29 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


cells (E. coli, B. subtilis and S. aureus) and less than 24% capture was tested in each experiment with 102 cells. The capture efficiency demonstrated along with the increasing cells concentration in the samples up to 106 cells with 0.1 mg/ml particles. In all experiments, the fixed amount of particles was used because the binding capacity of aptamer-Si-NP increased up to 0.1 mg particles (Figure 4B).

Assay development During the extraction procedure, many types of molecular recognition mechanisms were exploited, such as sorbents constituted of immobilized antibodies or aptamers

31

. In this study,

we used aptamer-functionalized MCM-41 nanoparticles loaded with fluorescein reporter molecules as sensing strategy for enriched samples. Aptamer-gates block mesopores to entrap reporter fluorescein molecules until specific interaction with its target, releasing reporter molecules upon molecular conformation changes. To verify in how far S. enterica aptamer gate would block and retain fluorophore molecules inside MCM-41 particles, the release kinetics experiments were carried out (Figure 5A). A release of fluorescein cargo were observed upon addition of captured S. enterica cells by MCM-41 particles, suggesting trigger release from aptamer-target interaction. In samples containing E. coli, a low-level release of fluorescein was observed, indicating a desired minimum leakage stability. Figure 5B shows early time course up to 60 min. A linear relationship was observed with captured S. enterica cells starting from 1 min. We chose 20 min time point for the subsequent assays since it is just enough to produce distinctive signal over control samples (Blue and red lines). These results prove that aptamer gated MCM-41 particles can generate fluorescent signal based on affinity binding.


17


Page 18 of 29

The utilization of the aptamer-Fe3O4@SiO2@pGMA affinity system and aptamer-gated MCM41 aptamer for detection of S. enterica was examined using milk sample obtained from local market. The samples were subjected to the newly constructed method and the classical plate counting procedure. The assay followed by stepwise application of aptamer-MCM-41 capture of S. enterica cells from milk samples, and mixing with 0.1 mg of fluorescein-loaded aptamer-gated MCM-41 for signal generation and amplification. Figure 6 shows the results from experiments with various number of S. enterica cells added milk samples. The addition of S. enterica cells up to 105 resulted in conspicuous increase of fluorescence signal. The linear range is from 2000 CFU/ml to 104 CFU/ml milk. The fluorescence intensity reaches a maximum at 2x105 CFU/ml. The limit of detection (LOD) value was determined as 2336 cells (Figure 6). The fluorescent signal measurements and colony counting experiments resulted in similar number of cells. The selectivity and specificity of the MCM-41 were proved by their feedbacks to Staphylococcus aureus, Escherichia coli or Bacillus subtilis cells. E. coli was selected as gramnegative organism whereas S. aureus, and B. subtilis were selected, as they are gram-positive bacteria. The selectivity to aptamer gated MCM-41 silica are presented in Figure 6. As observed from this figure, the designed MCM-41-apatamer gate system with loaded florescence dye is successful for the specific detection of S. enterica. This presented method has the potential to be utilized in reagent free specific detection of target pathogen in complex bacterial mixture.

Conclusions There are increasing need for selective recognition of pathogen microorganisms in complex food samples. Among them, Salmonella spp. are a common group of bacteria and isolated from food products, such as pasteurized milk, eggs and poultry products. Salmonella serotypes are the


18

Page 19 of 29 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


causative agents of salmonellosis. In this work, we developed a sensitive aptamer based detection system by combining magnetic separation method, with fluorescein loaded aptamer gated MCM-41 particles. In the first step, S. enterica specific aptamer-immobilized Fe3O4@SiO2@pGMA and MCM-41 particles were synthesized via a series of chemical reactions. The pre-concentration system, the Fe3O4@SiO2@pGMA-aptamer particles with the flexible grafted fibrous polymer has provided high density aptamer immobilization and fast specific mass transfer efficiency, as a result a high target bacteria adsorption capacity was achieved. Secondly, MCM-41 silica particles with Salmonella specific aptamers-gate have been successfully prepared for the controlled release of fluorescein upon contacting with target bacterial cells. The results showed that the magnetic pre-concentration system can enrich target bacteria from Salmonella spiked milk samples with high selectivity and in a short time. The MCM-41-system was specifically designed for releasing entrapped fluorophore molecules in the presence of Salmonella cell surface antigens. The reported method does require any sophisticated instrument and assay time is less than 30 min. Thus, the proposed assay system could be an effective strategy to monitor Salmonella contaminations directly in the milk samples.

ACKNOWLEDGEMENTS VCO acknowledges Konya Food and Agriculture University, Research & Development Center for Diagnostic Kits (KIT-ARGEM) for the use of the facilities.

AUTHOR CONTRIBUTIONS G.B., V.C.O and M.Y.A. designed this research and wrote the manuscript. G.B. and U.D. contributed to the synthesis of nanoparticles. V.C.O. assisted in assay development experiments.


19


Page 20 of 29

NOTES The authors declare no competing financial interest.

REFERENCES 1. Castillo, R. R.; Baeza, A.; Vallet-Regi, M., Recent applications of the combination of mesoporous silica nanoparticles with nucleic acids: development of bioresponsive devices, carriers and sensors. Biomaterials Science 2017, 5 (3), 353-377. DOI: 10.1039/C6BM00872K. 2. Ozalp, V. C.; Bayramoglu, G.; Kavruk, M.; Keskin, B. B.; Oktem, H. A.; Arica, M. Y., Pathogen detection by core-shell type aptamer-magnetic preconcentration coupled to real-time PCR. Anal Biochem 2014, 447, 119-125. DOI: 10.1016/j.ab.2013.11.022. 3. Ozalp, V. C.; Bayramoglu, G.; Arica, M. Y.; Oktem, H. A., Design of a core-shell type immuno-magnetic separation system and multiplex PCR for rapid detection of pathogens from food samples. Applied Microbiology and Biotechnology 2013, 97 (21), 9541-9551. DOI: 10.1007/s00253-013-5231-0. 4. Ozalp, V. C.; Bayramoglu, G.; Erdem, Z.; Arica, M. Y., Pathogen detection in complex samples by quartz crystal microbalance sensor coupled to aptamer functionalized core–shell type magnetic separation. Analytica Chimica Acta 2015, 853, 533-540. DOI: http://dx.doi.org/10.1016/j.aca.2014.10.010. 5. Borsa, B. A.; Tuna, B. G.; Hernandez, F. J.; Hernandez, L. I.; Bayramoglu, G.; Arica, M. Y.; Ozalp, V. C., Staphylococcus aureus detection in blood samples by silica nanoparticleoligonucleotides conjugates. Biosens Bioelectron 2016, 86, 27-32. DOI: 10.1016/j.bios.2016.06.023. 6. Webber, J. P.; Stone, T. C.; Katilius, E.; Smith, B. C.; Gordon, B.; Mason, M. D.; Tabi, Z.; Brewis, I. A.; Clayton, A., Proteomics analysis of cancer exosomes using a novel modified aptamer-based array (SOMAscan™) platform. Molecular & Cellular Proteomics 2014, 13 (4), 1050-1064. DOI: 10.1074/mcp.M113.032136. 7. Mehan, M.; Williams, S.; Siegfried, J.; Bigbee, W.; Weissfeld, J.; Wilson, D.; Pass, H.; Rom, W.; Muley, T.; Meister, M.; Franklin, W.; Miller, Y.; Brody, E.; Ostroff, R., Validation of a blood protein signature for non-small cell lung cancer. Clinical Proteomics 2014, 11 (1), 32. 8. Somalogic SOMAscan™ Proteomic Assay Technical White Paper; 2013; 2. 9. Mairal, T.; Ozalp, V. C.; Lozano Sanchez, P.; Mir, M.; Katakis, I.; O'Sullivan, C. K., Aptamers: molecular tools for analytical applications. Anal Bioanal Chem 2008, 390 (4), 9891007. DOI: 10.1007/s00216-007-1346-4. 10. Ozalp, V. C.; Kavruk, M.; Dilek, O.; Bayrac, A. T., Aptamers: Molecular Tools for Medical Diagnosis. Curr. Top. Med. Chem. 2015, 15 (12), 1125-1137. 11. Baumstummler, A.; Lehmann, D.; Janjic, N.; Ochsner, U. A., Specific capture and detection of Staphylococcus aureus with high-affinity modified aptamers to cell surface components. Letters in Applied Microbiology 2014, 59 (4), 422-431. DOI: 10.1111/lam.12295. 12. Park, J. H.; Jee, M. H.; Kwon, O. S.; Keum, S. J.; Jang, S. K., Infectivity of hepatitis C virus correlates with the amount of envelope protein E2: development of a new aptamer-based


20

Page 21 of 29 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


assay system suitable for measuring the infectious titer of HCV. Virology 2013, 439 (1), 13-22. DOI: 10.1016/j.virol.2013.01.014. 13. Ochsner, U. A.; Katilius, E.; Janjic, N., Detection of Clostridium difficile toxins A, B and binary toxin with slow off-rate modified aptamers. Diagnostic Microbiology and Infectious Disease 2013, 76 (3), 278-285. DOI: 10.1016/j.diagmicrobio.2013.03.029. 14. Kraemer, S.; Vaught, J. D.; Bock, C.; Gold, L.; Katilius, E.; Keeney, T. R.; Kim, N.; Saccomano, N. A.; Wilcox, S. K.; Zichi, D.; Sanders, G. M., From SOMAmer-Based Biomarker Discovery to Diagnostic and Clinical Applications: A SOMAmer-Based, Streamlined Multiplex Proteomic Assay. PLoS ONE 2011, 6 (10), e26332. DOI: 10.1371/journal.pone.0026332. 15. Rohloff, J. C.; Gelinas, A. D.; Jarvis, T. C.; Ochsner, U. A.; Schneider, D. J.; Gold, L.; Janjic, N., Nucleic Acid Ligands With Protein-like Side Chains: Modified Aptamers and Their Use as Diagnostic and Therapeutic Agents. Mol Ther Nucleic Acids 2014, 3, e201. DOI: 10.1038/mtna.2014.49. 16. Zichi, D.; Eaton, B.; Singer, B.; Gold, L., Proteomics and diagnostics: Let's Get Specific, again. Current opinion in chemical biology 2008, 12 (1), 78-85. DOI: 10.1016/j.cbpa.2008.01.016. 17. Ozalp, V. C.; Eyidogan, F.; Oktem, H. A., Aptamer-Gated Nanoparticles for Smart Drug Delivery. Pharmaceuticals 2011, 4 (8), 1137-1157. 18. Ozalp, V. C.; Schafer, T., Aptamer-based switchable nanovalves for stimuli-responsive drug delivery. Chemistry 2011, 17 (36), 9893-9896. DOI: 10.1002/chem.201101403. 19. Joshi, R.; Janagama, H.; Dwivedi, H. P.; Kumar, T.; Jaykus, L. A.; Schefers, J.; Sreevatsan, S., Selection, characterization, and application of DNA aptamers for the capture and detection of Salmonella enterica serovars. Molecular and Cellular Probes 2009, 23 (1), 20-28. DOI: 10.1016/j.mcp.2008.10.006. 20. Gupta, S.; Hirota, M.; Waugh, S. M.; Murakami, I.; Suzuki, T.; Muraguchi, M.; Shibamori, M.; Ishikawa, Y.; Jarvis, T. C.; Carter, J. D.; Zhang, C.; Gawande, B.; Vrkljan, M.; Janjic, N.; Schneider, D. J., Chemically-Modified DNA Aptamers Bind Interleukin-6 with High Affinity and Inhibit Signaling by Blocking its Interaction with Interleukin-6 Receptor. Journal of Biological Chemistry 2014, 289 (12), 8706-8719. DOI: 10.1074/jbc.M113.532580. 21. Ribes, À.; Santiago-Felipe, S.; Bernardos, A.; Marcos, M. D.; Pardo, T.; Sancenón, F.; Martínez-Máñez, R.; Aznar, E., Two New Fluorogenic Aptasensors Based on Capped Mesoporous Silica Nanoparticles to Detect Ochratoxin A. ChemistryOpen 2017, doi:10.1002/open.201700106. DOI: 10.1002/open.201700106. 22. Bayramoglu, G.; Arica, M. Y., MCM-41 silica particles grafted with polyacrylonitrile: Modification in to amidoxime and carboxyl groups for enhanced uranium removal from aqueous medium. Microporous and Mesoporous Materials 2016, 226, 117-124. DOI: https://doi.org/10.1016/j.micromeso.2015.12.040. 23. Ozalp, V. C.; Schafer, T., Aptamer-Based Switchable Nanovalves for Stimuli-Responsive Drug Delivery. Chemistry-a European Journal 2011, 17 (36), 9893-9896. DOI: 10.1002/chem.201101403. 24. Arica, T. A.; Ayas, E.; Arica, M. Y., Magnetic MCM-41 silica particles grafted with poly(glycidylmethacrylate) brush: Modification and application for removal of direct dyes. Microporous and Mesoporous Materials 2017, 243, 164-175. DOI: http://dx.doi.org/10.1016/j.micromeso.2017.02.011. 25. Bayramoglu, G.; Doz, T.; Ozalp, V. C.; Arica, M. Y., Improvement stability and performance of invertase via immobilization on to silanized and polymer brush grafted magnetic


21


Page 22 of 29

nanoparticles. Food Chemistry 2017, 221, 1442-1450. DOI: https://doi.org/10.1016/j.foodchem.2016.11.007. 26. Borsa, B. A.; Tuna, B. G.; Hernandez, F. J.; Hernandez, L. I.; Bayramoglu, G.; Arica, M. Y.; Ozalp, V. C., Staphylococcus aureus detection in blood samples by silica nanoparticleoligonucleotides conjugates. Biosensors and Bioelectronics 2016, 86, 27-32. DOI: http://dx.doi.org/10.1016/j.bios.2016.06.023. 27. Ostroff, R. M.; Mehan, M. R.; Stewart, A.; Ayers, D.; Brody, E. N.; Williams, S. A.; Levin, S.; Black, B.; Harbut, M.; Carbone, M.; Goparaju, C.; Pass, H. I., Early Detection of Malignant Pleural Mesothelioma in Asbestos-Exposed Individuals with a Noninvasive Proteomics-Based Surveillance Tool. PLoS ONE 2012, 7 (10), e46091. DOI: 10.1371/journal.pone.0046091. 28. Mehan, M. R.; Ayers, D.; Thirstrup, D.; Xiong, W.; Ostroff, R. M.; Brody, E. N.; Walker, J. J.; Gold, L.; Jarvis, T. C.; Janjic, N.; Baird, G. S.; Wilcox, S. K., Protein Signature of Lung Cancer Tissues. PLoS ONE 2012, 7 (4), e35157. DOI: 10.1371/journal.pone.0035157. 29. Kavruk, M.; Celikbicak, O.; Ozalp, V. C.; Borsa, B. A.; Hernandez, F. J.; Bayramoglu, G.; Salih, B.; Arica, M. Y., Antibiotic loaded nanocapsules functionalized with aptamer gates for targeted destruction of pathogens. Chemical Communications 2015, 51 (40), 8492-8495. DOI: 10.1039/C5CC01869B. 30. Hernandez, F. J.; Hernandez, L. I.; Pinto, A.; Schafer, T.; Ozalp, V. C., Targeting cancer cells with controlled release nanocapsules based on a single aptamer. Chem Commun (Camb) 2013, 49 (13), 1285-1287. DOI: 10.1039/c2cc37370j. 31. De Groote, M. A.; Nahid, P.; Jarlsberg, L.; Johnson, J. L.; Weiner, M.; Muzanyi, G.; Janjic, N.; Sterling, D. G.; Ochsner, U. A., Elucidating Novel Serum Biomarkers Associated with Pulmonary Tuberculosis Treatment. PLoS ONE 2013, 8 (4), e61002. DOI: 10.1371/journal.pone.0061002.


22

Page 23 of 29 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 1. Schematic representation of stepwise determination of Salmonella in food samples. Magnetic silica nanoparticles functionalized with Salmonella specific aptamers were used to capture Salmonella cells in milk samples in Step I. The captured cells were eluted and mixed with aptamer-gated MCM-41 silica nanoparticles loaded with reporter fluorescent molecules. The fluorescence signal was monitored in Step II for determining the number of Salmonella cells isolated in Step I.


23


Figure

2.

Characterization

of

magnetic

particles;

a)

Page 24 of 29

The

SEM

micrograph

of

Fe3O4@SiO2@pGMA at 23.32 KX magnification; b) FTIR analysis of pristine: (A) Fe3O4, (B) Fe3O4@SiO2,

(C)

Fe3O4@SiO2@pGMA

and

(D)

Fe3O4@SiO2@pGMA-aptamer

immobilized particles; c) The XRD patterns: (A) Fe3O4; and (B) Fe3O4@SiO2@pGMA particles; d) VSM analysis: (A) Fe3O4 and (B) Fe3O4@SiO2@pGMA particles at room temperature.


24

Page 25 of 29 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 3. FTIR analysis: (A) pristine MCM-41, (B) APTES modified MCM-41 and (C) aptamer immobilized MCM-41 particles


25


% Recovery

A

E. Coli

S. aureus

B. Subtilis

S. enterica

80 60 40 20 0

2

3

4

5

6

Log CFU/mL

B

50 40

% Capture

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 26 of 29

30 20 10 0 0.00

0.05

0.10

0.15

0.20

0.25

Fe3O4@SiO2@pGMA / mg Figure 4. A) Enumeration of Salmonella cells captured-down by Fe3O4@SiO2@pGMAaptamer particles by culture counting method. The indicated bacteria at various numbers were mixed with PBS buffer before applying magnetic pull-down procedure. B) The effect of Fe3O4@SiO2@pGMA-aptamer amount on the capture efficiency. About 104 Salmonella cells were mixed with the indicated mg of the particles and capture procedure were applied.


26

Page 27 of 29

120 S. enterica E. coli Control

100

Fluorescence

A

80 60 40 20 0 0

10

20

30

Time / Hours

B

6

Fluorescence

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


S. enterica E. coli Control

4

2

0 0 Figure 5.

10

20

30

40

Time / min

50

60

A) Evaluation of MCM-41-aptamer-gated nanoparticles in PBS buffer. The

fluorescein molecules were entrapped inside mesopores by Salmonella binding aptamer oligos and studied for stability and cargo retention properties (red line). The particles were incubated with S. enterica cells isolated from milk samples to evaluate the release of fluorophore molecules by the specific interaction of aptamers (black line). Non-specific control experiments used E. coli with Salmonella binding aptamer gated particles (blue lines). B) Early time release up to 60 min. Triplicate samples were used to calculate mean fluorescence signal amount and the standard deviations.


27


70 3.5

60

3.0 2.5

Fluorescence

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 28 of 29

50

2.0 1.5

40 30

1.0 0.5 0.0 0

1000

2000

3000

4000

5000

20 10 0 100

101

102

103

104

105

106

107

108

Cell count (CFU/ml) Figure 6. Fluorescent signal of assay mixture followed by addition of 1.0 mL milk spiked with the indicated number of Salmonella cells.


28

Page 29 of 29 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


For Table of Contents Use Only


29

Fast and Sensitive Detection of Salmonella in Milk Samples Using

Recommend Documents