J. Phys. Chem. 1994,98, 6633-6643
6633
Fluorescence and Photobleaching Studies of Methylene Blue Binding to DNA Bryant S. Fujimoto,' James B. Clendenning, Jeffrey J. Delrow, Patrick J. Heath, and Michael Schurr Department of Chemistry, BG- 10, University of Washington,Seattle, Washington 981 95 Received: November 17, 1993; In Final Form: March 21, 1994'
Time-resolved fluorescence, fluorescence polarization anisotropy, and transient photobleaching methods are used to investigate methylene blue/DNA complexes over a range of NaCl and MgCl2 concentrations and a limited range of temperature and base composition. At least four, and probably five, different binding sites have been identified. Component 1 has the shortest fluorescence lifetime (26 ps) and represents the main intercalated component under low-salt conditions. Component 2 has an intermediate fluorescence lifetime ( 130 ps). Component 3B has the longest fluorescence lifetime (620 ps), undergoes a modest amplitude (12O) of local rotation, and is significantly shielded from 0 2 quenching of its triplet state. Its amplitude is enhanced by increasing %AT, and it appears to require AA, AT, or T A steps. Component 3A has a long fluorescence lifetime (430 ps), undergoes a very large amplitude of local rotation, and exhibits two subcomponents that are differently shielded from 0 2 quenching. Component 3A is evidently not intercalated. With increasing NaCl or MgC12 concentration, the populations of components 1 and 3B shift into 3A. With increasing temperature, the amplitude of the longest component, ostensibly 3B, increases somewhat a t the expense of component 1, and its lifetime and residual anisotropy decrease slightly. The relative amplitudes of components 1,2, and 3B are unaffected by supercoiling, which implies that they all arise from intercalation sites with similar unwinding angles. From a comparison of the relative photobleach amplitudes with the relative fluorescence intensities, it can be inferred that components 3A and/or 3B dominate the triplet yield and photobleaching amplitude under practically all conditions. The suitability of methylene blue as the extrinsic probe in transient photodichroism experiments is discussed in light of these results.
Introduction Methylene blue is one of a number of tricyclic heteroaromatic compounds that are known to interact with DNA. It is the standard extrinsic probe used in transient photodichroism (TPD) experiments to monitor the rotational dynamics of DNA.14 A primary criterion for choosing methylene blue is its comparatively high triplet yield and associated amplitude of photobleaching. In addition, it binds stronglyto DNA, albeit with a somewhat higher affinity for GC-rich than AT-rich DNAs. Hogan et al. measured the polar angle (e) between the methylene blue transition dipole and the DNA helix-axis by absorbance-detectedelectric dichroism.' From studies on chicken DNA, they report E = 72O for methylene blue and E = 71° for ethidium, which is known to be intercalated under the conditions of their experiment. The fact that the polar angle of methylene blue is similar to that of intercalated ethidium and to thoseof the DNA based themselvesis taken as evidence that methylene blue is also intercalated. Other work provides strong evidence that under certain conditions methylene blue must be intercalated. Specifically, an unwinding angle of 24O was measured in a low ionic strength buffer (5 mM Tris, 5 mM KCl, 0.5 mM DTT, and 30 Ng/mL bovine serum albumen).9 Recently, it was demonstratedthat absorption spectra of solutions containing methylene blue and DNA over a range of buffer conditions could be more or less satisfactorilyrepresented by an appropriately weighted sum of two basis spectra, namely that of free methylene blue and that of methylene blue/DNA complexes under conditions when all of the dye is bound.10 On the basis of the preceding observations it is tempting to conclude that methylene blue occupies a single kind of intercalative binding site. However, other observations are difficult to reconcile with this simple picture. Methylene blue exhibits no intrinsic circular dichroism (CD) but upon binding to DNA acquires an induced CD." At low ionic strength the induced CD at 670 nm is negative. With increasingNaCl, the induced CD rises, passes through zero near a Abstract
published in Advance ACS Abstracts, June 1, 1994.
20 mM NaCl, and levels off toward a positive plateau at about 250 mM NaCI. Similarly, with increasing MgCl2 the induced CD rises, crosses through zero near 0.2 mM MgCl2, and reaches a positive plateau by 0.5 mM MgC12. This is clear evidence that the binding site somehow changes with increasing salt concentration. Norden and Tjerneld offered one possible interpretation, namely that methylene blue is changing its orientation in the intercalative binding site." However, the unwinding angle is also observed to decrease rapidly from 24' to less than 2O as MgClz increasesfrom 0 to 1 mM.9 The fact that the induced CD rises up to a positive plateau while the unwinding angle declines and nearly vanishes is strong evidence that MgC12 induces a shift from intercalative to nonintercalative binding. Since increasing NaCl causes essentially the same changes in the induced CD over a wider concentration range, such an increase in NaCl concentration very likely causes a similar shift from intercalative to nonintercalative binding. A major unresolved paradox is the finding that for poly(dG).poly(dC) and poly(dGdC).poly(dGdC) both the amplitude of the photobleach and the initial anisotropy are abnormally small: despite their higher affinities for the dye. In fact, signals of satisfactory amplitude could not be obtained for the alternating copolymer (Austin, R. H. Personal communication). This finding raises the disturbing possibility that methylene blue molecules in certain sites may contribute much less than others to the photobleach and TPD signal. Physical parameters of DNA, such as the twisting and bending rigidity, that are extracted from TPD data are rather sensitive to the assumed polar angle of the transition dipole.12J3 If the TPD signal should arise primarily from only a subset of the bound methylene blues at particular sites, then it is the polar angle of those sites, which may differ from the average value, that must be employed in the data analysis. This problem merits scrutiny, especially in view of the substantial disparity between the torsion constantsobtainedusing methylene blue2and e t h i d i ~ m ' probes. ~J~ The different magnitudes and contrasting variations with com-
0022-3654/94/209&6633SO4.50/0 0 1994 American Chemical Society
6634 The Journal of Physical Chemistry, Vol. 98, No. 26, 1994
Fujimoto et al.
position2J2~14and temperature's (Austin, R. H. Personal communication) have been a source of some confusion. Time-resolved fluorescence and fluorescence polarization anisotropy (FPA) methods have frequently proven useful in identifying, quantitating, and characterizing different sites occupied by the same chromophore. Combining time-resolved fluorescence and transient photobleaching methods allows some of the questions noted above to be addressed and some of the paradoxical results understood. The very short fluorescence lifetimes of methylene blue became accessible to single-photon counting methods only relatively recently.
Since one of our concerns is whether the rms amplitude of local angular motion is too large tobe compatiblewith isotropic motion in an intercalative binding site, the former method provides a more conservativeand therefore sounder estimatefor our purposes. For a dye molecule undergoing a small rms amplitude of local angular motion in an isotropic deflection potential, the residual anisotropyequals the amplitude reduction factor which is defined as12,16
Theory for Time-Resolved Fluorescence and Fluorescence Polarization Anisotropy Our apparatus measures the time-resolved fluorescence intensities, Z i ( t ) and IL(t),with polarizations parallel and perpendicular, respectively, to that of the exciting pulse.'2 From these we calculate the sum data, s ( t ) = Zl(t) + 2ZL(t), and the differencedata, d(t) = Zll(t) -Zl(t). The measured fluorescence data are a convolution of the true sum response (S(t)) or true differenceresponse ( D ( t ) )with the instrument response function. The fitting procedure necessary to extract information about the true response (by removing the effect of the instrument response on our results) is described in the materials and methods section. The true sum response to a 6 function exciting pulse is modeled by a sum of exponentials plus a scattered light term,
where P2 is the second Legendre polynomial, /3 is the angle between the transition dipole and its equilibrium position, and u is therms amplitude of local motion around any single axis perpendicular to the transition dipole. The correlation function (P~(cos6)) is sometimes referred to as the order parameter, when the motion of a vector that undergoes restricted rotational motion is discussed.19 The expansion in the second equality of eq 4 is valid for small angles. The amplitude reduction factor would be AF = 1.0 if the dye were rigidly bound to the DNA and could not undergo any rotational motion independent of the DNA. For intercalated ethidium, which exhibits only a small amplitude of local angular motion, one finds AF= 0.9 ( u = 7O). For a molecule capable of undergoing free rotation completely around a single axis perpendicular to its transition dipole, the amplitudereduction factor falls to AF = 0.25.
AF=-- B A
+
- (P~(cosfl))2
-
1 - 6a2
(4)
m
Materials and Methods wheref, is the amplitudeof the scattered light correctionand 6 ( t ) is a 6 function. The true difference response is modeled by
D ( t ) = r(t) S(t)
+ Rf,s ( t )
where R is the anisotropy of the scattered light and r ( t ) is the anisotropy function for the transition dipole of methylene blue. In fitting the differencedata, r(t) is modeled simply as a single exponential plus a baseline
r ( t ) = A exp(-t/T,)
+B
(3)
where A is the relaxing amplitude due to fast local rotations of the methylene blue and B is the amplitude associated with any slow rotational motions that do not relax on the time scale of the fluorescence measurement. The initial anisotropy (A B) has a theoretical maximum of 0.4. The measured value of the initial anisotropy can be less than 0.4 due to the limited time-resolution of the instrument. If the dye molecule undergoes any rotational motion too fast to be temporally resolved by this experiment, the effect of that is to reduce the initial anisotropy.'2J6J7 In the case of ethidium intercalated in DNA, the observed reduction of the initial anisotropyby rapid dye wobble in experimentswith 500 ps time resolutioni2J7closely matches the correspondingrelaxing amplitudeobserved when the time-courseof that motion is directly resolved in experiments with 540 ps time resolution (Fujimoto, B. S.,unpublished data).17J* In the case of methylene blue, the shortest fluorescence lifetime is about 20-25 ps. This severely tests the ability of our experimental apparatus to reliably extract the corresponding anisotropy. The fact that the experimental value of A + B is slightly less than 0.4 may in part be due to the inability of our apparatus to measure the anisotropy on a time scale less than 20 ps. As a result, when we later discuss the fraction of the initial anisotropy that is slowly relaxing, we will use B / ( A B) rather than B/0.4. The former method yields an upper-bound estimate for the residual anisotropy and thus a lower-bound estimate for the rms amplitude of local angular motion of methylene blue.
+
-
+
Buffers and DNA Samples. Except when specified otherwise, all measurements were carried out in 10 mM Tris and 0.01 mM Na2EDTA at pH 7.5 and 20 OC. Calf thymus DNA purchased from Sigma was digested with proteinase K for 30 min at 37 "C. The solution was extracted with buffered phenol until the water-phenol interface was clean and then twice more, and then dialyzed alternately against 10 mM Tris, 100 mM NaC1, and 1 mM EDTA and 10 mM Tris, 500 mM NaCI, and 1 mM EDTA for 1 week before dialysis into the final buffer. Supercoiled pBR322 was grown and purified using standard techniques described previously.20 The purification of pBR322 was performed by HPLC, using a Nucleogen DEAE 4000-7 (IWC) anion exchange column from Macherey-Nagel (Diiren, West Germany). Fractions containing the supercoiled plasmid, identified by agarose gel electrophoresis, were pooled and concentrated with Centriprep30 concentrators (Amicon). The resulting sample was dialyzed exhaustively in 100 mM NaCI, 10 mM Tris, and 1 mM NazEDTA (pH 8.5) before being dialyzed into the final buffer. The integrity of the supercoiled DNA was checked by agarose gel electrophoresis (0.8% gel). More than 90%of the sample was in the supercoiled form, and the remainder was nicked circle. Linearized pBR322 fragments were created by reacting the supercoiled pBR322 with HincII using the protocol supplied by the manufacturer (New England Biolabs). The progress of the reaction was monitored by agarose gel electrophoresis. When the reaction mixture showed only two bands consistent with the expected products (a 3256 base-pair fragment and a 1107 basepair fragment), the reaction was stopped by extracting the sample twice with buffered phenol. The sample was then dialyzed alternately against 10mM Tris, 100mM NaC1, and 1 mM EDTA and 10 mM Tris, 500 mM NaCI, and 1 mM EDTA for 1 week before dialysis into the final buffer. Two nonself-complementary48 base-pair synthetic DNAs were synthesized by standard solid-phase phosphite triester techniques on an Applied Biosystems 380A DNA synthesizer. Their sequences are presented in Table 1. After deprotection, each sequence was ethanol precipitated twice and then chromato-
The Journal of Physical Chemistry, Vol. 98, No. 26, 1994 6635
Methylene Blue Binding to DNA
TABLE 1: Synthetic DNA Sequences commition
5’GCCGCCTTCTTCCTGTTCCTGGTCTTlTGCTCACATGTTCTTTCCGGC S’GCCGTCGGCGACGCTCGCGGCAGGCCAGCGGTCGCGCAGCGGCTCGGC
54% GC 83% GC
graphed on a Sephadex G-50column in deionized water. Selected fractionswere run on a denaturing (7M urea) 20% polyacrylamide gel. Fractions with a minimum of failure sequences were pooled and lyophilized. Approximately equal amounts of complementary sequences were combined and dialyzed against 400 mM NaCl, 50 mM Tris, and 50 mM Na2EDTA at pH 8.5. The sample was then annealed by placing it in an eppendorf tube, which was floated on top of 2 L of 60 OC water in a beaker. The beaker was placed in an ice bucket, covered, and left to anneal for 8-12 h. The annealed double-strand molecules were separated from any remaining single-strand species by chromatography using a hydroxylapatite column (Bio-Rad Laboratories) and eluted with a sodium phosphate (pH 6.8) gradient from 10 to 500 mM. Selected fractions were run on a nondenaturing 12% polyacrylamide gel. Those fractions that showed only double-strand DNA were pooled, lyophilized,and then dialyzedagainst 100 mM NaCl, 10 mM Tris, and 1 mM Na2EDTA at pH 7.5. Methykne Blue. Methylene blue was purchased from Mallinckrodt and purified by extraction with benzene as described by Bergmann and O’KonskL21 Fresh stock solutions were made up before each experiment, and the concentration was determined spectrophotometrically using the absorption and dissociation constants of those authors.21 The purity of the solution was checked by measuring the Aau/Aslo ratio. This was always greater than 2.1, which indicates theabsenceofanydemethylated methylene blue. FluorescenceMeasurements. Time-resolved fluorescence measurements were made using the single-photon-counting system described earlier.’* The lasing medium of the Spectra Physics 475 synch-pumpedcavity-dumpeddye laser contained Rhodamine 590 plus a small amount of the saturable absorber DQOCI in ethylene glycol. The dye laser produced pulses with a full width at half-maximum (FWHM) of
