Fluorescence Aptameric Sensor for Strand Displacement Amplification

The server is currently under maintenance and some features are disabled. Share Article. ACS Network; Twitter; Facebook; Google+; CiteULike; Email...
0 downloads 0 Views 1MB Size
Download PDF
Anal. Chem. 2010, 82, 1358–1364

Fluorescence Aptameric Sensor for Strand Displacement Amplification Detection of Cocaine Jing-Lin He, Zai-Sheng Wu,* Hui Zhou, Hong-Qi Wang, Jian-Hui Jiang, Guo-Li Shen, and Ru-Qin Yu* State Key Laboratory for Chemo/Biosensing and Chemometrics, College of Chemistry and Chemical Engineering, Hunan University, Changsha 410082, P. R. China A new fluorescence method based on aptamer-target interactions has been developed for cocaine detection with target-induced strand displacement. Here we describe new probes, the hairpin-probe and the single strand-probe (ss-probe), that possess two recognition sequences of cocaine aptamer. In the presence of cocaine, both probes would associate with the target to form a tripartite complex. The conformational change in the hairpin-probe causes the opening of a hairpin structure and the hybridization to primer. With polymerase and the dNTPs, the replication of the single-stranded domain of hairpin-probe triggers the process of primer extension. When the hairpin-probe is converted into a fully double-stranded form, the ss-probe and cocaine are displaced to bind another hairpin-probe and initiate new amplification cycles. Fluorescence signal generation would be observed upon SYBR Green I intercalating into the new DNA double helix. The new protocol design permits detection of as low as 2 nM cocaine in a closed tube, offering a convenient approach for a homogeneous assay. Compared with previously reported cocaine aptameric sensors, our new method is highly sensitive, selective, and economical. DNA polymerase is one of the enzymes responsible for replication and repair of DNA along the sequence of a template strand. Moreover, DNA polymerases are crucial factors in abundant biological core technologies such as polymerase chain reaction (PCR),1,2 ligase chain reaction (LCR),3 rolling circle amplification (RCA),4-8 and strand displacement amplification (SDA).9 SDA provides exponential amplification of a trace of DNA * Corresponding author. Fax: (+86) 731-88822782 (R.-Q. Yu). E-mail: rqyu@ hnu.cn (R.-Q. Yu); [email protected] (Z.-S. Wu). (1) Li, X.; Huang, Y.; Guan, Y.; Zhao, M.; Li, Y. Anal. Chem. 2006, 78, 7886– 7890. (2) Sto ¨hr, K.; Ha¨fner, B.; Nolte, O.; Wolfrum, J.; Sauer, M.; Herten, D.-P. Anal. Chem. 2005, 77, 7195–7203. (3) Mano, J.; Oguchi, T.; Akiyama, H.; Teshima, R.; Hino, A.; Furui, S.; Kitta, K. J. Agric. Food Chem. 2009, 57, 2640–2646. (4) Beyer, S.; Nickels, P.; Simmel, F. C. Nano Lett. 2005, 5, 719–722. (5) Li, N.; Jablonowski, C.; Jin, H.; Zhong, W. Anal. Chem. 2009, 81, 4906– 4913. (6) Li, J.; Zhong, W. Anal. Chem. 2007, 79, 9030–9038. (7) Yang, L.; Fung, C. W.; Cho, E. J.; Ellington, A. D. Anal. Chem. 2007, 79, 3320–3329. (8) Mahmoudian, L.; Kaji, N.; Tokeshi, M.; Nilsson, M.; Baba, Y. Anal. Chem. 2008, 80, 2483–2490. (9) He, F.; Feng, F.; Duan, X.; Wang, S.; Li, Y.; Zhu, D. Anal. Chem. 2008, 80, 2239–2243.

1358

Analytical Chemistry, Vol. 82, No. 4, February 15, 2010

or RNA sequences from complex mixtures and, consequently, has become an essential step for nucleic acid strand detection and quantification. The basis of this technique is the ability of DNA polymerase to extend an oligodeoxyribonucleotide primer that is specifically hybridized to a single-stranded DNA template. Guo et al.10 presented a sensitive platform based on a polymeraseinduced isothermal strand-displacement polymerization reaction containing a hairpin fluorescence probe for single-strand DNA detection. Willner’s group11 provided an autonomous aptamerbased machine activated by polymerase, a nicking enzyme, and a molecular beacon for amplified detection of cocaine. The advantage of these fluorescent biosensors was the improved sensitivity of assays, whereas the disadvantages were high cost and the complexity of the procedures. Here we intend to report a strand displacement strategy which is facile, sensitive, and cost-effective in fluorescent aptameric sensor construction. Cocaine serves as a representative model target for testing new analytical techniques due to pressing needs for its rapid detection in law enforcement and clinical diagnostics. The discovery of a specific aptamer for cocaine12 promoted the development of cocaine sensors.13-18 In 2001, Stojanovic’s group19 reported a double-end labeled cocaine aptameric sensor with ligand-induced stem formation that causes fluorescence quenching. A year later, they presented a colorimetric sensor based on a cyanine dye-aptamer complex.20 Liu et al.21 proposed a colorimetric sensor based on the disassembly of gold nanoparticle aggregates linked by aptamers. Plaxco et al.22 built a methylene blue labeled, (10) Guo, Q.; Yang, X.; Wang, K.; Tan, W.; Li, W.; Tang, H.; Li, H. Nucleic Acids Res. 2009, 37, 20–25. (11) Shlyahovsky, B.; Li, D.; Weizmann, Y.; Nowarski, R.; Kotler, M.; Willner, I. J. Am. Chem. Soc. 2007, 129, 3814–3815. (12) Stojanovic, M. N.; Prada, P.; Landry, D. W. J. Am. Chem. Soc. 2000, 122, 11547–11548. (13) Liu, J.; Lee, J. H.; Lu, Y. Anal. Chem. 2007, 79, 4120–4125. (14) Swensen, J. S.; Xiao, Y.; Ferguson, B. S.; Lubin, A. A.; Lai, R. Y.; Heeger, A. J.; Plaxco, K. W.; Soh, H. T. J. Am. Chem. Soc. 2009, 131, 4262–4266. (15) Freeman, R.; Sharon, E.; Tel-Vered, R.; Willner, I. J. Am. Chem. Soc. 2009, 131, 5028–5029. (16) White, R. J.; Phares, N.; Lubin, A. A.; Xiao, Y.; Plaxco, K. W. Langmuir 2008, 24, 10513–10518. (17) Shlyahovsky, B.; Li, Y.; Lioubashevski, O.; Elbaz, J.; Willner, I. ACS Nano 2009, 3, 1831–1843. (18) Li, Y.; Qi, H.; Peng, Y.; Yang, J.; Zhang, C. Electrochem. Commun. 2007, 9, 2571–2575. (19) Stojanovic, M. N.; Prada, P.; Landry, D. W. J. Am. Chem. Soc. 2001, 123, 4928–4931. (20) Stojanovic, M. N.; Landry, D. W. J. Am. Chem. Soc. 2002, 124, 9678–9679. (21) Liu, J.; Lu, Y. Angew. Chem. 2006, 118, 96–100. 10.1021/ac902416u  2010 American Chemical Society Published on Web 01/15/2010

Table 1. Sequences of Sensing Probes and Primers Probes

Sequence (5′ to 3′)

Hairpin-probe

TTCGTTCTTCAATGAAGTGGGACGACATTTCTT CTTCTTTTCATGTCGTCCGTTT GGGAGTCAAGAACGAA AATGGAGTCAAGAACGAA GAAATGGAGTCAAGAACGAA GGACGA GGACGAC GGACGACA GGACGACAT

ss-probe 1 ss-probe 2 ss-probe 3 Primer 1 Primer 2 Primer 3 Primer 4

electronic aptasensor for cocaine detection. Zhang et al.23 developed a single quantum-dot-based aptameric sensor that is capable of sensing the presence of cocaine through both fluorescence signal-off and signal-on modes. With the application of strand displacement as a new strategy, a highly sensitive and selective fluorescence aptameric sensor for quantification of cocaine at the nanomolar concentration level provides an advantage over other detection methods. An additional advantage of this new protocol using interacting dye alone is its cost-effectiveness. SYBR Green I was chosen because of its high specificity for double-stranded DNA and its bright fluorescence. The use of unmodified oligonucleotide probes is simple and convenient for long-term preservation. Because of the high sensitivity, inherent simplicity, and low cost derived from this designed strategy, the proposed sensing approach in a homogeneous solution might hold great promise for ultrasensitive cocaine determination in law enforcement and clinical applications. EXPERIMENTAL SECTION Reagents. Oligonucleotides used in this work were customerdesigned and synthesized without any base modifications by Sangon Biotechnology Co. Ltd. (Shanghai, China) as seen in Table 1. The boldfaced regions of the hairpin-probe and single strandprobes (ss-probes) indicate the cocaine aptamer sequence, while the region underlined in the hairpin-probe indicates a complementary sequence to the primers. High-concentration DNA stock solutions were prepared with an appropriate buffer medium containing 20 mM Tris-HCl, 140 mM NaCl, and 2 mM MgCl2, and the pH was adjusted to 7.5. The prepared probes were kept at 4 °C before use to minimize denaturation. Cocaine was obtained from Beijing Institute for Drug Control (Beijing, China) and used without further purification. The dNTP mixture (dNTPs) and Klenow Fragment polymerase (KF polymerase) were purchased from TaKaRa Biotechnology (Dalian, China). SYBR Green I (SG, 20× concentrate) was supplied by Generay Biotech Co., Ltd. (Shanghai, China). Low molecular weight DNA ladder was purchased from New England Biolabs Ltd. (USA). Ultrapure water used to prepare all of the solutions was obtained through a Nanopure Infinity Ultrapure Water System (Barnstead/Thermolyne Corp., Dubuque, IA) with an electrical resistance larger than 18.3 MΩ. All buffer solutions and ultrapure water were sterilized and used throughout experiments. Sodium chloride, magnesium chloride, and Tris were provided by China National Medicines Co. Ltd. (Beijing, China). (22) Baker, B. R.; Lai, R. Y.; Wood, M. S.; Doctor, E. H.; Heeger, A. J.; Plaxco, K. W. J. Am. Chem. Soc. 2006, 128, 3138–3139. (23) Zhang, C.; Johnson, L. W. Anal. Chem. 2009, 81, 3051–3055.

The Sensing Procedure. Upon testing various conditions, the following procedure was used to study the concentration-dependent changes in fluorescence experiments: 10 µL of cocaine solution of a specific concentration were mixed with 10 µL of hairpin-probe solution (20 nM) for 10 min. After adding 10 µL of 120 nM ssprobe, the mixture was incubated for 60 min at room temperature. The resulting solution and 10 µL of 5 µM primers were subsequently mixed in a 13 µL solution of polymerase-induced replication consisting of 39 mM Tris-HCl (pH 7.5), 27 mM MgCl2 and 0.39 mM dithiothreitol (DTT), 1.2 mM dNTPs and 8 U KF polymerase, followed by incubation in 37 °C for 60 min. Prior to fluorescence measurements, 42 µL of SG solution (1× conc.), the intercalating dye, diluted from the stock were injected into the resulting solution. When the time-dependent incubation process was monitored, the fluorescence spectra were collected after a certain period (from 30 to 240 min) at 37 °C, and the relative fluorescence intensity was plotted as the function of incubation time at selected time intervals. Gel Electrophoresis. Gel electrophoresis was used to confirm the probe-cocaine binding and polymerase-induced replication. Analysis by electrophoresis was carried out on 3% agarose gels by GoldView staining, cast and run in 0.5 × TBE buffer (4.5 mM Tris, 4.5 mM boric acid, 0.1 mM EDTA, pH 7.9) at room temperature. Electrophoresis was performed at a constant potential of 100 V for 60 min with loading of 9 µL of each sample into the lanes. The resulting gel was excited using a WD-9403F UV device and imaged with a Canon digital camera. The replication reaction was performed by adding 8 U KF polymerase into 20 µL of KF buffer containing 2.5 µM hairpin probe, 2.5 µM ss-probe, 15 µM primer, and 1.2 mM dNTPs with or without 2 mM cocaine followed by incubation at 37 °C for 60 min. Fluorescence Measurements. Fluorescence experiments were all performed using a Hitachi F-7000 fluorescence spectrometer (Hitachi. Ltd., Japan) controlled by FL Solution software for curve-fitting and peak height determination. A quartz fluorescence cell with an optical path length of 1.0 cm was used. The excitation was made at 498 nm with a recording emission range of 509-615 nm. All excitation and emission slits were set at 5 nm. The fluorescence spectra were recorded at 23 ± 2 °C. RESULTS AND DISCUSSION Design of the Aptameric Sensor. As can be seen in Scheme 1 A, the aptamer binding site of cocaine has been split into two aptamer “half-sites”,12 which is expressed as a boldfaced region in the hairpin-probe and ss-probe. The italicized region of the hairpin-probe indicated in the loop sequence and stem sequence is designed to trigger the strand displacement-based signal amplification. The region with the dotted line below it identifies the complementary sequence to the primer. The 5′-AAT sequence in the ss-probe is used to improve the assay performance (see the section “Optimization of Probes” for details). Scheme 1B illustrates that the concentration of cocaine in sample solutions can be determined by employing aptamer-target interactions. In this strategy, each of the resulting probes, the hairpin-probe or the ss-probe, contains a short single-stranded region designed to introduce some propensity for the two aptamer-cocaine binding sites to associate recreating the tripartite complex after addition of cocaine. This propensity is designed to be low such that in the absence of cocaine only a small fraction of the probes will Analytical Chemistry, Vol. 82, No. 4, February 15, 2010

1359

Scheme 1a

a (A) Structure of hairpin-probe, ss-probe, and the complex of hairpin-probe/cocaine/ss-probe. (B) Schematic illustration of cocaine sensing strategy based on strand displacement amplification.

associate. When the cocaine that binds the two probes is introduced, the conformational change in the hairpin-probe resulting from target binding causes the opening of a hairpin structure and the hybridization to a primer (the short dotted sequence) that can initiate replication. With the KF polymerase and the dNTPs, the polymerase-induced replication of the single-stranded domain 1360

Analytical Chemistry, Vol. 82, No. 4, February 15, 2010

triggers the process of primer extension. When a cDNA (the long dotted sequence) is synthesized and the hairpin-probe is converted into a fully double-stranded form, the ss-probe and cocaine are displaced by the polymerase with strand-displacement activity. Thus the displaced ss-probe and cocaine become available for binding another hairpin-probe and triggering new amplification

Figure 1. (A) Fluorescence emission spectra of cocaine assays. The data correspond to an aptameric sensor before the replication cycle (a) in the absence of cocaine or (b) in the presence of cocaine and after the replication cycle (c) in the absence of cocaine or (d) in the presence of cocaine. The concentration of cocaine was 200 µM. The emission wavelength was 524 nm. (B) Gold view stained agarose gel (3.0%) showing different mobilities of (1) hairpin probe only, (2) hairpin probe/ss-probe mixture, (3) hairpin probe/cocaine/ss-probe complex, (4) ss-probe alone, and replication products in the (5) absence or (6) presence of cocaine, respectively. (L) DNA ladders.

Figure 2. Signaling profile of assays containing primer3 and hairpinprobe with one of the following ss-probes: ss-probe1, ss-probe2, and ss-probe3 in the absence (b) or presence (O) of 200 µM cocaine. Three independent experiments were carried out as described in the Experimental Section.

cycles. It is obvious that cocaine acts as a kind of “catalyst” to trigger a conformational change of the otherwise inactive hairpinprobe into a polymerization responsible active structure. After intercalation into the DNA double helix, the SG shows its bright fluorescence while exposed to suitable excitatory illumination. Signal Amplification of Cocaine Binding. As shown in Figure 1 A, the mixture of hairpin-probe/ss-probe (curve a) is in a low fluorescence state with an emission peak around 524 nm. Its fluorescence increase was only ∼13% after the addition of the 200 µM cocaine (curve b). This result indicated that the complex of hairpin-probe/cocaine/ss-probe was formed and SG did intercalate into the stem of the probes. After the replication cycle, a fluorescence intensity increase was observed in the absence of cocaine (curve c). This likely indicates that a small quantity of hairpin-probe captured primers and triggered a part of the replication. A remarkable fluorescence intensity enhancement (over 93%) is acquired at the assay after binding cocaine, suggesting that a large amount of double-stranded DNA was introduced. Thus, results of the fluorescence experiments dem-

Figure 3. Signaling profile of hairpin-probe/ss-probe2 systems with one of four primers varying in region number from 6 to 9 with (O) or without (b) 200 µM cocaine. Error bars were estimated from at least three independent measurements.

onstrate that signal amplification was caused by aptamer-target binding and strand displacement reaction. Electrophoresis Characterization. Direct evidence to show the probe-cocaine binding and polymerase-induced replication was provided by electrophoresis analysis using a 3.0% agarose gel (Figure 1B). The first four lanes showed the hairpin-probe, mixture of hairpin-probe/ss-probe, hairpin-probe/cocaine/ss-probe tripartite complex, and ss-probe, respectively. A fast migration band appeared in lane 1 due to the stem helix of the hairpin-probe, while no bands were observed in lane 4 due to the single-stranded structure of the ss-probe. Lane 2 for the hairpin-probe/ss-probe mixture in the absence of cocaine exhibited a weak band. In the presence of cocaine (Lane 3), there was a little brighter fluorescent band at the same migration position as that in lane 2, indicating the existence of an amount of probe-cocaine binding. It was observed that the replication products in the absence (Lane 5) or presence (Lane 6) of cocaine showed relatively low mobility, suggesting the adoption of an extended double-stranded structure. Compared with Lane 5, Lane 6 displayed a significantly bright band, which demonstrated that a strand displacement reaction Analytical Chemistry, Vol. 82, No. 4, February 15, 2010

1361

Figure 4. Time course of fluorescence response recorded before (gray bars) and after (black bars) the addition of 200 µM cocaine into the sensing system. The illustrated error bars represent the standard deviation of three measurements obtained at each incubation time.

favored the formation of a compact tripartite structure which depended on the presence of cocaine. Optimization of Probes. To optimize the sensing device, three ss-probes (ss-probe1, ss-probe2, and ss-probe3) were tested, and their ability to form a complex with the hairpin-probe was judged by the fluorescence spectrum in the absence (b) or presence (O) of 200 µM cocaine shown in Figure 2. The 16-mer ss-probe1 shows a rather low ability of assembling with hairpinprobe for its short sequence. The 18-mer ss-probe2 was the most effective ss-probe in the group and obviously had fluorescence enhancement efficiency. Further increase of the added sequence length as the 5′-GAAAT sequence in the ss-probe3 increased the fluorescence background, hindering the sensitive monitoring of the fluorescence change. The 16-mer ss-probe1 and 20-mer ssprobe3 exhibited less enhancement efficiencies with the ss-probe3 being slightly more effective than the ss-probe1. This observation implied that the increasing length of ss-probes was the cause of increasing fluorescence intensity. The ss-probe2 was chosen as the optimum ss-probe in the experiments due to its good performance in causing a conformational change of the hairpinprobe to form a stable tripartite complex with cocaine, but keeping a flexible structure in the absence of cocaine. Optimization of Primers. The efficiency of the replication process depends on the ability of the primer to hybridize with the stem of the hairpin-probe. To investigate the effect of primer strand length on the performance, the hairpin-probe and ss-probe2 were mixed with a specific primer with a 6-, 7-, 8-, or 9-mer segment. In Figure 3, the fluorescence change of the four primers with (O) or without (b) 200 µM cocaine was monitored at room temperature. It can be observed that the fluorescence intensity increased with increasing primer length. As shown in Figure 3, primer3 provided a relatively high fluorescent intensity enhancement in the presence of cocaine with a low background. Primer1 with only six nucleotides seems to have the lowest ability to hybridize with the hairpin-probes. Primer4, the longest strand in the group, induced the highest fluorescence intensity both before and after the addition of analyte. Hence primer3 was used as the optimum primer to initiate polymerase-induced replication. 1362

Analytical Chemistry, Vol. 82, No. 4, February 15, 2010

Figure 5. (A) Fluorescence spectra recorded at various concentrations of cocaine. (B) Fluorescence signal change (∆F) detected upon addition of cocaine to the proposed aptameric sensor. Signal change was calculated as F-F0, where F and F0 correspond to fluorescence emission intensity observed in the presence and absence of a given cocaine concentration, respectively. The inset shows linear relationship between the square root of ∆F and the logarithm of cocaine concentration. Averages and standard deviations of three independent experiments are shown.

Effect of the Replication Time of the Assay. The performance of signal amplification and detection of cocaine was influenced by the incubation time of the polymerase-induced replication. To optimize the incubation time, we determined the fluorescence response at 37 °C which was reflected by the amount of SG intercalated into the DNA double helix before and after addition of cocaine (Figure 4). Rapid signal generation was observed upon the addition of cocaine (black bars), and the fluorescence intensity maintained its increase with incubation time, indicating that the continuous formation of tripartite complex was indeed the result of a circular polymerization reaction. After incubation of the solution for 60 min, the fluorescence intensity reached equilibrium. Further incubation was not capable of leading to the obvious fluorescence response change, whereupon the rate of target replication slows down resulting in a postexponential growth phase. In control experiments without cocaine, as can be observed from the gray bars of Figure 4B, the fluorescence intensity was increased proportional with incubation time. Primers

Table 2. Comparison of Analytical Performance of Various Different Methods for Determination of Cocaine Method/technique

Detection limit

Detection time

Ref.

Autonomous aptamer-based machine, Fluorescence Two labeled aptamer subunits self-assembly, Fluorescence Quantum dots-encoded aptamer-linked nanostructures, Fluorescence Microfluidic electrochemical aptamer-based sensor, ACVa Electrogenerated chemiluminescence aptamer-based sensor, ECL measurementb Double-end labeled aptamer, Fluorescence Cyanine dye-aptamer combination, Colorimetry Aptamer-linked nanoparticle aggregates, Colorimetry Electrochemical aptamer-based sensor, ACVa Single quantum-dot-based aptameric sensor, Microfliudic fluorescence Strand displacement amplification based aptameric sensor, Fluorescence

5 µM 10 µM 120 µM 10 µM 1 nM 12.5 µM 2 µM 25 µM 10 µM 0.5 µM 1 nM

70 min 60 min 1-5 min 1-2 min 5 min 30 s 12 h 1 min 6 min 100 s 2h

11 12 13 14 18 19 20 21 22 23 This work

a

ACV is the alternating current voltammograms. b ECL is the electrogenerated chemiluminescence.

were possibly difficult to associate with the hairpin-probe in 60 min due to the steric hindrance in the hairpin structure in the absence of cocaine. This phenomenon indicated that the optimum incubation time was 60 min. Analytical Performance of the Aptameric Sensor. Experiments were carried out by adding increasing amounts of cocaine to the aptameric sensor to examine whether the fluorescence change could be used for cocaine quantitation. Figure 5A shows the changes in the fluorescence intensities of the aptameric sensor upon detecting different concentrations of cocaine amplified by the strand displacement reaction. The fluorescence response increased significantly with the increase of target binding. Fluorescence enhancement was detectable for samples containing as low as 2.00 nM cocaine. In Figure 5B, the main graph shows that the fluorescence intensity continued to increase with the increase of the cocaine concentration until a plateau was reached. A good linear relationship between the square root of the fluorescence signal change (∆F) and the logarithm of cocaine concentration was from 2.00 nM to 200 µM for sensitive cocaine quantitation with a correlation coefficient of 0.9927 for the linear calibration curve shown in the inset. The regression equation was ∆F1/2 ) 3.473 log[C cocaine] + 7.449. The detection limit for cocaine was experimentally determined to be 1 nM based on a signal-to-noise ratio (S/N) of 3. This highly sensitive detection of cocaine is due to the large signal amplification upon targetinduced polymerization. This sensitivity is comparable to or better than that of other reported aptamer-based analytical methods listed in Table 2 for cocaine detection. It is clear that the proposed aptameric sensor offers a more than 500-fold improvement in the detection limit as compared to the fluorescent sensors mentioned in Table 2. Selectivity of the Aptameric Sensor. We tested the specificity of the assay with some common biological compounds, such as uridine, glucose, dopamine, uric acid, adrenaline, and IgG. Due to the inherent specificity of the aptamer toward its target, the fluorescence change of the sensing system is highly selective, shown in Figure 6. Only cocaine caused remarkable signal amplification, while all the other biological compounds tested, even at 5-fold higher concentrations than those used for cocaine, cause negligible change in the fluorescence. The experimental results indicated that the developed assay could exhibit a high degree of selectivity for the cocaine detection, as expected. Application of the Aptameric Sensor to Cocaine Detection in Real Samples. To test the feasibility of the practical application of this aptameric sensor, we conducted analyses of cocaine in

Figure 6. Different small molecules and extracellular proteins were compared with cocaine in their capability to change the fluorescence intensity. The concentration of cocaine, uridine, glucose, dopamine, uric acid, adrenaline, and IgG were 200 µM, 1.0 mM, 1.0 mM, 500 µM, 500 µM, 500 µM, and 3.6 µM, respectively. The results were the average of three experiments.

Figure 7. Calibration curve of the assay with cocaine in diluted (20fold) serum samples in the concentration range from 20 to 2500 nM. The inset provides the linearity of ∆F1/2 for aptameric sensor against the logarithm of cocaine concentrations. Error bars were estimated from at least three independent measurements.

human serum, one of the most challenging media containing a variety of proteins and other serious interference. Varying amounts of cocaine were added to the diluted (20-fold) serum samples. The calibration curve in the presence of 5% serum was similar to Analytical Chemistry, Vol. 82, No. 4, February 15, 2010

1363

Table 3. Cocaine Concentration Detected by Proposed Fluorescence Aptameric Sensor in Tris-HCl Buffer and in 5% Diluted Human Serum Detected in Tris-HCl Buffer (n ) 3)a

Detected in Diluted Serum (n ) 3)a

Added (nM)

Mean ± SDb (nM)

CVc (%)

Mean ± SDb (nM)

CVc (%)

20.0 160.0 900.0 2500.0

19.4 ± 0.86 157.3 ± 10.2 926.9 ± 70.8 2492.7 ± 169.6

4.43 6.48 7.64 6.80

18.6 ± 0.71 160.9 ± 3.5 949.1 ± 88.0 2540.0 ± 198.2

3.82 2.18 9.27 7.80

a The data are given as average value obtained from three independent experiments. b SD is the standard deviation. c CV is the coefficient of variation.

that in the Tris-HCl buffer, as shown in Figure 7, and the inset provides the linearity of the square root of ∆F for the aptameric sensor against the logarithm of cocaine concentrations in the range from 20 nM to 2.5 µM. Additionally, it is noteworthy that the background signal of the serum around 524 nm increased if a more concentrated serum was used. The higher background is caused by tailing of the broad serum peak around 520 nm (ex: 450 nm).24 As demonstrated in Table 3, the results showed an acceptable coherence between the data obtained in Tris-HCl buffer and those in diluted serum. The results revealed that the newly (24) Jiang, Y.; Fang, X.; Bai, C. Anal. Chem. 2004, 76, 5230–5235.

1364

Analytical Chemistry, Vol. 82, No. 4, February 15, 2010

proposed aptameric sensor showed promising properties for possible practical applications. CONCLUSIONS We have described a new fluorescence aptameric sensor that permits sensitive, selective, economical detection of cocaine based on signal amplification under the strand displacement reaction. The new protocol design permits detection of as low as 2 nM cocaine within 60 min of the replication time. Moreover, the sensor enables accurate target quantification over nearly a six log range of initial target levels. In comparison to the established aptamer based cocaine detection system, the amplification of fluorescence signals from the polymerase-induced replication improves the detection sensitivity. Additionally, this technique requires only the intercalating dye instead of the fluorescent label on the probes, offering a cost-effective approach for homogeneous assays. ACKNOWLEDGMENT This research was supported by the National Natural Science Foundation of China (Grants No. 20675028 and 20775023), the “973” National Basic Research Program of China (No. 2007CB310500), and the Science Commission of Hunan Province. Received for review October 25, 2009. Accepted January 5, 2010. AC902416U