Fluorescence Coincidence Spectroscopy for Single-Molecule

Anal. Chem. 2008, 80, 8389–8397

Fluorescence Coincidence Spectroscopy for Single-Molecule Fluorescence Resonance Energy-Transfer Measurements Angel Orte, Richard W. Clarke, and David Klenerman* Department of Chemistry, University of Cambridge, Lensfield Road, CB2 1EW, Cambridge, U.K. Single-molecule fluorescence resonance energy transfer (FRET) is commonly used to probe different conformations and conformational dynamics of single biomolecules. However, the analysis of raw burst traces is not always straightforward. The presence of a “zero peak” and the skewness of peaks at high and low FRET efficiencies in proximity ratio histograms make the accurate evaluation of the histogram a challenging task. This is further compounded by the difficulty associated with siting two fluorophores in optimal range of each other. Here we present an alternative method of analysis, based on handling coincident FRET photon bursts, that addresses these problems. In addition, we demonstrate methods to enhance coincidence levels and thus the accuracy of FRET determination: the use of dual-color excitation, including direct excitation of the acceptor fluorophore; the addition of a remote dye to the biomolecule, not involved in the FRET process; or a combination of the two. We show the advantages of dual excitation by studying several labeled double-stranded DNA samples as FRET models. This method extends the application of single-molecule FRET to more complicated biological systems where only a small fraction of complexes are fully assembled. Fluorescence analysis of fluorophore-labeled single molecules has been demonstrated to be a powerful method of probing the structure, dynamics, and conformation of biological molecules, especially when performed at the single-molecule level.1-3 In this field, there are two key linked challenges. The first is to design the experiment so that it reports on the property or properties of interest, where the challenge is to position the fluorophores in the optimum position on the biomolecules, and to use the optimum combination of excitation lasers. The second challenge is, since single-molecule experiments are inherently low signal-to-noise ratio, to devise the optimum method to analyze the fluorescence data from the experiment to determine the properties of interest. Both these challenges become more severe when one starts to apply single-molecule fluorescence to more complex biological samples where only a fraction of the molecules or complexes * To whom correspondence should be addressed. E-mail: dk10012@ cam.ac.uk. Fax: +44 1223 336362. (1) Weiss, S. Science 1999, 283, 1676–1683. (2) Neuweiler, H.; Sauer, M. Anal. Chem. 2005, 77, 178A–185A. (3) Pappas, D.; Burrows, S. M.; Reif, R. D. TrAC, Trends Anal. Chem. 2007, 26, 884–894. 10.1021/ac8009092 CCC: $40.75  2008 American Chemical Society Published on Web 10/15/2008

present are of interest and the rest of the molecules are unassociated, are partially formed complexes, or are partially labeled. One commonly used method in this field is single-pair fluorescence resonance energy transfer (spFRET) where the biomolecule is labeled with a single donor and acceptor fluorophore.4,5 Single-pair FRET has been demonstrated to be a powerful tool to study conformational changes in DNA6,7 or RNA,8,9 enzymatic dynamics,10,11 or protein folding/unfolding.12-14 Molecules that show FRET are identified by analysis of the fluorescence bursts on the donor, ID, and acceptor channels, IA. One way to perform the event selection is to add together the intensities detected in the two channels and use events where this sum, (ID + IA), exceeds a threshold value. This is the SUM threshold criterion. A previous work illustrated the benefits of using the OR and AND criteria15 instead of the SUM criterion. The OR criterion selects all the bursts in either channel with intensity above a certain threshold value, whereas the AND criterion selects only coincident bursts that have certain intensities in both channels simultaneously. The SUM criterion has the problem of very often giving a “zero peak”16 arising from molecules labeled only with the donor fluorophore or from acceptor dark states. In cases in which there is only a small fraction of molecules containing both donor and acceptor fluorophores, in the presence of an excess of molecules with just donor fluorescence, this zero peak dominates the histogram and distorts the results from the analysis of the peaks of interest. Besides this (4) Selvin, P. R. Nat. Struct. Mol. Biol. 2000, 7, 730–734. (5) Rasnik, I.; McKinney, S. A.; Ha, T. Acc. Chem. Res. 2005, 38, 542–548. (6) Deniz, A. A.; Dahan, M.; Grunwell, J. R.; Ha, T. J.; Faulhaber, A. E.; Chemla, D. S.; Weiss, S.; Schultz, P. G Proc. Natl. Acad. Sci. U. S. A. 1999, 96, 3670–3675. (7) Iqbal, A.; Arslan, S.; Okumus, B.; Wilson, T. J.; Giraud, G.; Norman, D. G.; Ha, T.; Lilley, D. M. J. Proc. Natl. Acad. Sci. USA 2008, 105, 11176–11181. (8) Zhuang, X.; Bartley, L. E.; Babcock, H. P.; Russell, R.; Ha, T.; Herschlag, D.; Chu, S. Science 2000, 288, 2048–2051. (9) Kobitski, A. Y.; Nierth, A.; Helm, M.; Jaschke, A.; Nienhaus, G. U. Nucleic Acids Res. 2007, 35, 2047–2059. (10) Ha, T. J.; Ting, A. Y.; Liang, J.; Caldwell, W. B.; Deniz, A. A.; Chemla, D. S.; Schultz, P. G.; Weiss, S. Proc. Natl. Acad. Sci. U. S. A. 1999, 96, 893–898. (11) Zhuang, X. W.; Kim, H.; Pereira, M. J. B.; Babcock, H. P.; Walter, N. G.; Chu, S. Science 2002, 296, 1473–1476. (12) Jia, Y.; Talaga, D. S.; Lau, W. L.; Lu, H. S. M.; DeGrado, W. F.; Hochstrasser, R. M. Chem. Phys. 1999, 247, 69–83. (13) Schuler, B.; Lipman, E. A.; Eaton, W. A. Nature 2002, 419, 743–747. (14) Schuler, B.; Eaton, W. A. Curr. Opin. Struct. Biol. 2008, 18, 16–26. (15) Ying, L. M.; Wallace, M. I.; Balasubramanian, S.; Klenerman, D. J. Phys. Chem. B 2000, 104, 5171–5178. (16) Gell, C.; Brockwell, D.; Smith, A. Handbook of single molecule fluorescence; Oxford University Press: Oxford, 2006.

Analytical Chemistry, Vol. 80, No. 22, November 15, 2008

8389

difficulty, in conventional spFRET measurements, the proximity ratio is used to index the histogram of events and typically a sum of Gaussian functions is used to fit the peaks in these histograms.17,18 However, peaks indexed by proximity ratio only approximate normal distributions for peak values at ∼0.5. Toward modal values of 0 or 1, the peaks bunch together and become heavily skewed, approximating γ functions.15 Indexing with the proximity ratio in these cases makes it difficult to correctly integrate peaks and to distinguish between them. We have developed a single-molecule fluorescence technique in which two fluorophores in the same molecule can be excited simultaneously using two overlapped laser beams, where the detection of coincident fluorescent bursts is used to determine the association or fraction of dual-labeled species. Using this method of two-color coincidence detection (TCCD),19,20 we have previously characterized samples that do not show FRET19-24 and we have shown the convenience of using an alternative function to index the histograms of events. This function, ln(IR/IB), where IR and IB are the intensities in the red and the blue channels, respectively, gives an accurately Gaussian peak for each stoichiometrically pure subpopulation of molecules labeled with dyes fluorescent in both color channels.20,22 This was demonstrated in a previous work to be the case in TCCD histograms, mathematically and through a series of model samples.22 Here we show that the coincidence criterion and histograms of the function ln(IR/ IB) can be also a valuable tool to analyze FRET samples with significant advantages over using the SUM criterion and histograms of the proximity ratio.25 In this work, we specifically explore the application of TCCD to samples where FRET occurs, in contrast to our previous work where there was no FRET. We have analyzed here a series of model samples with different FRET efficiencies and have explored the potential of coincidence spectroscopy to determine differences in FRET states, particularly in cases where the molecule of interest is present as a very small fraction of the sample. Furthermore, we show that we can even detect FRET in situations where the acceptor is nonfluorescent and that we can more accurately quantify samples with very high or very low FRET efficiencies, by adding appropriate reference fluorophores to the sample or by additional direct excitation of the acceptor fluorophore. MATERIALS AND METHODS SMF-TCCD Instrument and Data Analysis. The instrumentation for TCCD measurement has been reported in detail previously.20 Briefly, two overlapped Gaussian laser beams, at 488 (17) Shirude, P. S.; Okumus, B.; Ying, L.; Ha, T.; Balasubramanian, S. J. Am. Chem. Soc. 2007, 129, 7484–7485. (18) Pons, T.; Medintz, I. L.; Wang, X.; English, D. S.; Mattoussi, H. J. Am. Chem. Soc. 2006, 128, 15324–15331. (19) Li, H.; Ying, L.; Green, J. J.; Balasubramanian, S.; Klenerman, D. Anal. Chem. 2003, 75, 1664–1670. (20) Orte, A.; Clarke, R.; Balasubramanian, S.; Klenerman, D. Anal. Chem. 2006, 78, 7707–7715. (21) Li, H.; Zhou, D.; Browne, H.; Balasubramanian, S.; Klenerman, D. Anal. Chem. 2004, 76, 4446–4451. (22) Ren, X.; Li, H.; Clarke, R. W.; Alves, D. A.; Ying, L.; Klenerman, D.; Balasubramanian, S. J. Am. Chem. Soc. 2006, 128, 4992–5000. (23) Clarke, R. W.; Monnier, N.; Li, H.; Zhou, D.; Browne, H.; Klenerman, D. Biophys. J. 2007, 93, 1329–1337. (24) Alves, D.; Li, H.; Codrington, R.; Orte, A.; Ren, X.; Klenerman, D.; Balasubramanian, S. Nat. Chem. Biol. 2008, 4, 287–289. (25) Clarke, R. W., University of Cambridge, Ph.D. Thesis, 2007.

8390


(Spectra Physics Cyan CDRH) and 633 nm (He:Ne laser, 25LHP151, Melles Griot), were directed to the back port of an inverted microscope (Nikon Eclipse TE2000-U). The beams were focused 6 µm into the sample in a Laboratory-Tek chambered cover glass (Scientific Laboratory Suppliers Ltd., Surrey, UK) through a high numerical aperture oil immersion objective (Apochromat 60×, NA 1.40, Nikon). Fluorescence was collected by the same objective and imaged onto a 50-µm pinhole (Melles Griot), then separated into two different channels using a dichroic mirror (585DRLP Omega Filters), and sent to two avalanche photodiodes (SPCM AQR-14, Perkin-Elmer Optoelectronics). The cross talk (detection of one fluorophore emission in the other channel) from the blue channel to the red channel was 1%, whereas the cross talk from the red channel to blue channel was negligible. Unless otherwise stated, the laser powers were 210 and 52 µW for the blue and red excitations, respectively. For all the single-molecule experiments, data were collected at 20 °C with a 1-ms bin time on both MCS cards, and burst selection performed by applying suitable threshold values.26 The TCCD acquisition time was typically 1 h for each time point. We have used two different approaches, which we will refer to as TCCD1ex and TCCD2ex in this paper; in the former case, only the 488-nm laser was employed, as in a conventional single-pair FRET measurement; the latter case uses both overlapped lasers. Figure 1 shows the two schemes of excitation. The detection efficiencies of TCCD1ex and TCCD2ex for the different dsDNA model samples used in this work were calculated through a series of measurements of the dsDNA at increasing known fractions of free dyes Alexa Fluor 488 and Alexa Fluor 647 (Molecular Probes) that give rise to noncoincident fluorescent bursts. The measured parameter is the association quotient, previously shown to be directly proportional to the fraction of duallabeled molecules in a heterogeneous mixture,20 and defined as Q)

rS rB + rR - rS

(1)

where rB and rR are the fluorescence burst rates on the blue and red channels and rS stands for the burst rate of significant coincident events, given by rC - rE, subtracting the rate of coincident events due to chance, rE, from the total coincident events rate rC. The determination of the chance coincident events is based on probabilistic calculations detailed elsewhere.20 Once the calibration in terms of Q has been performed, the sensitivity or detection efficiency for each dsDNA sample is defined as the slope of the calibration straight line. Coincidence histograms of the function Z, defined as ln(IR/ IB), are built up from the significant coincident bursts, after removing the contribution of chance coincidence.20 For comparison, conventional proximity ratio histograms were also built from events in which IR + IB surpasses a threshold value of 25 (SUM criterion). The proximity ratio function is defined as P)

IR IB + IR

(2)

Materials. All the oligonucleotides were diluted into TEN buffer: 10 mM in Tris, 1 mM EDTA, and 100 mM NaCl. Tris + (26) Clarke, R. W.; Orte, A.; Klenerman, D. Anal. Chem. 2007, 79, 2771–2777.

Figure 1. Instrument schematic for single-molecule fluorescence in solution and the two excitation schemes: single-color, TCCD1ex (A) and dual-color excitation, TCCD2ex (B). Table 1. Sequences and Labeling Schemes of the DNA Single Strands Employed

c

1, 2 3 4 5 6b 7 8 9 10b 11

sequencea

labeling

biotin-TTTTGGCGAATGGCGCGGCAGGCGTGGCACCGGTAATAGGAAA ATTACCGGTGCCACGCCTGCCGCGCCATTCGCCA TTTCCTATTACCGGTGCCACGCCTGCCGCGCCATTCGCCA TAGTGTAACTTAAGCCTAGGATAAGAGCCAGTAATCGGTA TACCGATTACTGGCTCTTATCCTAGGCTTAAGTTACACTA TACTGCCTTTCTGTATCGCTTATCGCGTAGTTACCTGCCTTGCATA-GCCACTCATAGCCT AGGCTATGAGTGGCTATGCAAGGCAGGTAACTACGCGATAAGC AGGCTATGAGTGGCTATGCAAGGCAGGTAACTACGCGATAAGCG-ATACAG AGGCTATGAGTGGCTATGCAAGGCAGGTAACTACGCGATAAGCG-ATACAGAAAGG TACTGCCATTCTGTATCGCTTATCGAGTAGTTACCTGCCTAGCATT-GCCACTCATAGCCT AGGCTATGAGTGGCAATGCTAGGCAGGTAACTACTCGATAAGCGA-TACAGAATGGCAGTA

Alx488 at position 35 5′-Atto647N 5′-Atto647N 5′-Alx488 5′-Atto647N Alx488 at 3′- and position 21 5′-Atto647N 5′-Atto647N 5′-Atto647N 5′-BHQ1 and Alx488 at position 16 5′-Atto647N

a All sequences indicated as 5′ f 3′ from left to right. b Internal labeling with Alx488 at the positions indicated in boldface characters performed through an amino-C6-dT. c Note that a biotin was included in the oligonucleotide for future single-molecule experiments, but it is of no use in the current work.

EDTA × 50 buffer was from USB Co., and sodium chloride was from Acros Organics. A final concentration of 0.01% Tween 20 was added to the measurement solution to prevent surface adhesion. All the buffers were filtered through 0.02-µm filters (Whatman) before use. The free dyes Alexa Fluor 488 and Alexa Fluor 647 were obtained from Invitrogen. In order to identify the different dsDNA samples used in the present study we have employed the following nomenclature: hyphens denote the presence of FRET between a donor and an acceptor fluorophore with an optional indication of their separation in between, here in terms of base pairs, D-xbp-A. Secondly, groups of fluorophores effectively isolated by distance are separated by parentheses. For example, a dsDNA sample including a remote blue fluorophore as well as a pair of fluorophores showing FRET will be denoted as (B)40bp(Dxbp-A), or (B)(D-A) if omitting all the distance information. Table 1 shows the sequences and labeling strategies of the single-strand oligonucleotides used to obtain the different dsDNA models. The labeled oligonucleotides were purchased from IBA GmbH and had been purified by double HPLC. An additional polyacrylamide gel electrophoresis purification step was performed for the single strands longer than 60 nucleotides. Measurements of UV-visible absorbance confirmed the labeling efficiency to be larger than 90% and the absence of free dye. The annealing of the single strands to form double-stranded DNA samples was carried out

by mixing stoichiometric amounts of each complementary ssDNA, heating to 90 °C, and slow overnight cooling down to room temperature. Double-stranded DNA samples involving a single FRET pair, (D-xbp-A), were designed to incorporate oligo 1, labeled at position 35 (boldface T) with an amino-C6-dT to include an Alexa Fluor 488 tag. The dsDNA FRET samples (A488-3bp-A647N) and (A488-10bp-A647N) were then obtained by hybridizing the strands 2 and 3, respectively, to 1. A sample designed to avoid FRET, (A488)40bp(A647N), was obtained by hybridizing the 40-mer strand 4 labeled at the 5′-end with Alexa Fluor 488, and the corresponding complementary strand 5 also labeled at 5′-end with Atto647N. The dsDNA samples with a remote blue fluorophore (B)(Dxbp-A) were obtained through the dual-labeled probe 6 modified with Alexa Fluor 488 at the 3′-end and position 21 (boldface T). To get different FRET efficiencies, we hybridized 6 with the complementary strands 7, 8, and 9 labeled at the 5′-end with Atto647N, being separated 3, 10, and 15 base pairs from the internal donor on 6. The hybridization of these strands gave the samples (A488)(A488-3bp-A647N), (A488)(A488-10bp-A647N), and (A488)(A488-15bp-A647N), respectively. The dsDNA sample including a quencher and a remote red fluorophore was formed by the dual-labeled probe 10, labeled at the 5′-end with Black Hole Quencher 1 (BHQ1) and at the position 16 (boldface T) aminoAnalytical Chemistry, Vol. 80, No. 22, November 15, 2008

8391

Figure 2. TCCD1ex and TCCD2x measurements on (A488-10bp-A647N). Single-color excitation (TCCD1ex) can be analyzed using conventional proximity ratio histograms (A) or coincidence analysis (B). (C) Coincidence histogram from TCCD2ex measurement.

C6-dT modified to include an Alexa Fluor 488 tag. The complementary 60-mer deoxyoligonucleotide, 11, was labeled at the 5′end with Atto 647N, producing the sample named (A647N)(A48816bp-BHQ1) after hybridization. RESULTS Application of Coincidence Spectroscopy To Moderate FRET Efficiency Samples. To test the usefulness of coincidence spectroscopy in FRET measurements, we started with simple dsDNA samples comprising donor and acceptor fluorophores 10 base pairs apart. Using the nomenclature established in Materials and Methods, the first sample is named (A488-10bp-A647N). The single-molecule fluorescence measurement using only 488-nm excitation can be analyzed in a conventional way, through the SUM threshold criterion and proximity ratio histogram, as shown in Figure 2A. The approximate FRET efficiency (center of the fitting with a Gaussian function) is 0.75, and a zero peak is also clearly present in the histogram. In Figure 2B, the same burst traces are analyzed using TCCD1ex (Figure 1). Here we use a coincidence criterion for burst selection and construct histograms of the function Z ) ln(IR/IB). The Z histogram is well fitted with a single Gaussian function, which is shifted to positive values since the blue intensity is quenched due to energy transfer to the acceptor. Note that the zero peak is absent from the histogram. We can obtain the approximate corresponding proximity ratio value P (thus approximate FRET efficiency) from the center position of the coincidence histogram xc through the following equation: P) 8392

exc 1 + exc

(3)


The histogram in Figure 2B is centered at ln(IR/IB) ) 0.90, corresponding to a proximity value of 0.71. This is in relatively good agreement with the proximity ratio histogram fit. At high or low FRET efficiencies, the proximity ratio histograms become heavily skewed, which makes them more difficult to fit than Z histograms, which remain normally distributed. We can also perform dual-color excitation experiments, TCCD2ex, to samples showing FRET. This is of particular interest for samples with low FRET efficiencies. In such scenarios, the FRET peak is not well defined using a conventional analysis since it is overlapped by the “zero peak”, making the estimation of an energy transfer yield very inaccurate.25 In contrast, the extra direct excitation of the acceptor causes an enhancement of the red bursts’ intensity allowing the detection of events coincident in the donor and acceptor channels. As an example, a TCCD2ex measurement of the sample (A488-10bp-A647N) gave a histogram fitted with a single Gaussian peak, as shown in Figure 2C. Comparing the Z histograms in Figure 2B and C, the latter one showed an additional shift to larger positive values, toward a higher intensity in the red channel, due to direct red fluorophore excitation. When we compare this sample to a control sample in which FRET is absent, a 40 base-pair dsDNA with both fluorophoresatthe5′-endsofthecomplementarystrands,(A488)40bp(A647N), the histogram of this control is centered around 0, whereas the (A488-10bp-A647N) histogram center is shifted to a value of 1.38. This shift represents the transfer of fluorescence energy from the donor to the acceptor. In order to obtain an estimate of the FRET efficiency from TCCD2ex measurements, the central position, xc, of a histogram indexed by Z = ln(IR/IB) is related to the proximity ratio P by the following equation (derived in Supporting Information):

exc P) xc

I’R IBexp

1+e -

I’R

(4)

IBexp

where Iexp B is the average brightness of the blue coincident events in the TCCD2ex experiment and IR′ is the average brightness of the directly excited acceptor in an isolated independent environment, i.e., in the absence of FRET. IR′ can be obtained from a control experiment using a sample in which FRET is absent (in our case, the control sample (A488)40bp(A647N)). Equation 4 approximates the fluorescence intensity in the acceptor channel as a sum of the FRET-based contribution and that from the acceptor fluorophore when directly excited independently (see Supporting Information). Using eq 4 to work out a proximity ratio value from the histogram in Figure 2C, with an xc of 1.38, yielded a P value of 0.72 (with IR′ ) 31.0 kHz and IBexp ) 21.2 kHz). This value is in very good agreement with that obtained using TCCD1ex (0.71) and the conventional proximity ratio approach (0.75) (Figure 2A and B). Enhancing the Detection of High-FRET Samples by Adding a Remote Blue Fluorophore. When resonance energy transfer is so effective that the donor is almost completely quenched, there is a physical limitation on the information actually retrievable from a single pair of very high FRET fluorophores: The donor photon rate can become so low that its fluctuations are almost indistinguishable from the background photon count

rate. In the conventional proximity ratio analysis, this gives rise to highly skewed distributions that cannot be reliably fitted. Therefore, in cases of samples undergoing highly efficient FRET, we propose an alternative approach to take advantage of the potential of TCCD, namely, the addition to the biomolecule of a third fluorophore that is not involved in the FRET process.25 For a sample with very high FRET efficiency, the addition of a remote fluorophore of the same nature as the donor, but far away from the acceptor tag, effectively enables a recovery of information about the position of the molecule in the probe volume that can then be used to more accurately determine the FRET efficiency, compensating for the quenching of the donor caused by FRET. The extra fluorophore also increases the number of detected coincidence events and hence the detection efficiency. In this section, we test this approach, comparing the different detection efficiencies of TCCD1ex and TCCD2ex for a set of dsDNA model samples undergoing high FRET by measuring how the association quotient changes as the sample is diluted by different amounts of free dye to obtain a calibration curve. The samples used were (A488-3bp-A647N) and (A488-10bp-A647N), a no FRET sample, (A488)40bp(A647N), and a set of samples with a remote fluorophore, (A488)(A488-3bp-A647N), (A488)(A48810bp-A647N), and (A488)(A488-15bp-A647N) (see Materials and Methods for details on dsDNA sequences and an explanation of the nomenclature). Figure 3A plots the calibration curves using TCCD2ex for DNA samples with donor and acceptor separated by 10 bp with and without an extra remote fluorophore, (A48810bp-A647N) and (A488)(A488-10bp-A647N), respectively. The

Figure 3. (A) Association quotient calibration in the presence of free dyes for (A488-10bp-A647N) (blue) and (A488)(A488-10bp-A647N) (red), the latter showing a higher sensitivity. (B) Different sensitivities for TCCD2ex on DNA samples with varying FRET efficiencies with (blue columns) and without a remote fluorophore (yellow columns). The sensitivity was obtained from the gradient of association quotient calibrations as shown in (A). (C) TCCD2ex histograms from (A488-3bp-A647N) (black) versus (A488)(A488-3bp-A647N) (red) and the corresponding fittings to Gaussian functions (blue and magenta, respectively). Analytical Chemistry, Vol. 80, No. 22, November 15, 2008

8393

Figure 4. Significant histograms (bar) recovered by subtracting the chance coincidence histogram (gray) to the total histogram (blue) of three different samples: (A) (A488-10bp-A647N) at a fraction of 0.11, (B) (A488)(A488-10bp-A647N) at a fraction of 0.11, and (C) (A488)(A488-15bpA647N) at a fraction of 0.05.

increased slope of the calibration curve in the presence of the remote dye reflects a 2.5-fold increase in detection sensitivity compared to just using a single FRET pair. The situation can be even more drastic when donor and acceptor are closer. For instance, the increase in the TCCD2ex sensitivity by adding a remote blue fluorophore to a FRET pair separated by only 3 base pairs was ∼18-fold (this is the comparison of (A488-3bp-A647N) versus (A488)(A488-3bp-A647N)). Figure 3B shows the sensitivity values for the different studied samples. This clearly shows a similar high sensitivity is obtained for all the samples with the remote fluorophore, comparable to that for the sample without FRET, (A488)40bp(A647N), for which the maximum Q value is 0.202 as previously published.19,20 It is also clear that much lower sensitivity is obtained in the absence of the remote fluorophore. The improvement in histogram recovery is shown in Figure 3C, which compares the TCCD2ex histograms from the samples (A488-3bp-A647N) versus (A488)(A488-3bp-A647N). We also analyzed the same samples using TCCD1ex. In general, this method gave significantly higher sensitivity coefficients because almost all red bursts arise from FRET events, removing the issue of beam overlap that limits sensitivity when using two excitation wavelengths (see Supporting Information, Table S1). Low Fraction of FRET Sample Present. In single-molecule experiments on biomolecular systems that employ two fluorophores, it is frequent to find scenarios in which the fraction of dual-labeled molecules is relatively low. For instance, if a duallabeled molecule is synthesized, low degrees of labeling may cause an excess of singly labeled species. On the other hand, when the labeled species are different subunits of certain biomolecular complexes, dissociation upon dilution to the single-molecule regime may also give rise to just a remaining small fraction of associated dual-labeled species. Therefore, a high detection efficiency of the molecules of interest may be crucial in such situations. A conventional FRET treatment and proximity ratio histogram in a scenario like this will end up with a histogram invariably dominated by a “zero peak”, complicating the analysis of the data for an accurate determination of the FRET efficiency especially if the energy-transfer efficiency is low. Conversely, the use of the coincidence methodologies, both TCCD1ex and TCCD2ex, do allow accurate recovery of the histograms of FRET events, after which FRET efficiency values can be extracted. Note that using TCCD2ex we determine and subtract from the Z histogram the contribution of chance coincident events where two unassociated red and blue molecules happen to simultaneous 8394


diffuse into the probe volume.20 This allows the accurate recovery of histograms even when the chance coincident events form the majority of total coincidence. Figure 4 shows illustrative examples of significant histograms obtained from TCCD2ex experiments on samples of different FRET efficiencies in high excess of nonassociated singly labeled material. For all the model samples, the histograms obtained under these conditions were in excellent agreement with those from experiments with the pure model DNA samples. Determination of FRET Efficiency in the Presence of a Reference Dye. The benefits of adding the remote fluorophore in terms of enhanced coincidence and detection sensitivity and histogram recovery have been shown for these model samples. However, the effect of the presence of the reference dye is a decrease in the apparent FRET efficiency. For most practical applications of FRET to biophysical studies, the absolute values of the proximity ratio are less important because of the difficulties in accurately converting FRET signals into distances. It is more highly desirable to be able to accurately distinguish distinct conformational states, which is the strength of the method we present here. Nevertheless, it is useful to have the facility to calculate the actual FRET efficiency between the primary donor and acceptor pair, taking out the contribution of the reference fluorophore. The apparent FRET efficiency (in terms of proximity ratio, P), as in eqs 3 and 4, can be calculated from the central position of the coincidence histograms, xc, and the average brightness values fromacontrolsampleintheabsenceofFRET,(Alx488)40bp(Att647N), for either channel IB′ or IR′. The development of the equations to obtain FRET efficiency on samples of the form (B)(D-xbp-A) is detailed in the Supporting Information. There are two different equations depending on the excitation scheme, single- or dualcolor excitation (TCCD1ex or TCCD2ex). For the former case, the proximity ratio is given by

1

P)

-xc

1+e

-

IB’

(5)

Iexp R

whereas, for the TCCD2ex scheme, the proximity ratio between donor and acceptor is given by

P)

’ Iexp R - IR -xc Iexp ) - I’R - IB’ R (1 + e

(6)

where IRexp is the average brightness in the red channel of the coincident events in the experiment and IB′ and IR′ are the average brightness on the blue and red channels, respectively, for the control measurement in the absence of FRET. As examples, the sample (Alx488)(Alx488-15bp-Att647N) showed xc values of -0.960 and -0.098 in TCCD1ex and TCCD2ex experiments, respectively, yielding a P value of 0.42 and 0.44 from eqs 5 and 6, respectively. The sample (Alx488)(Alx488-10bp-Att647N) gave xc values of -0.101 and 0.262 in TCCD1ex and TCCD2ex, which yielded FRET values of 0.75 and 0.69 through eqs 5 and 6. The remarkably good performance of these equations, along with eqs 3 and 4, is validated and compared to structural FRET models (taking into account the helical nature of the DNA duplex) in Figure 5. The average proximity ratio values obtained are plotted for the four different situations studied: samples in the presence and the absence of a remote fluorophore, using TCCD1ex or TCCD2ex. The recovered values are compared to theoretical FRET efficiencies, based on the helical model of the dsDNA27,28 including linkers on the fluorophores (see Supporting Information for the model). The Fo¨rster distance R0 between Alx488 and Att647N was calculated to be 49.8 Å (see Supporting Information), but the curves including a 10% error in R0 determination are also shown. Figure 5 shows good agreement between the different schemes and a reasonably good comparison with the theoretical model. Therefore, through these equations one is able to obtain FRET information from Z histograms. In samples with an additional fluorophore, using either single- or dual-color excitation schemes, one has the additional advantage of the higher sensitivity of detection, which in turn gives better histogram recovery as well as the removal of the zero peak present in conventional proximity ratio histograms. Enabling the Analysis of FRET to a Quenched Acceptor by Adding a Remote Red Fluorophore. In the previous section, we have shown the benefits of adding a reference blue fluorophore

Figure 5. Apparent FRET efficiency (proximity ratio) recovered by the two different excitation schemes, TCCD1ex (squares) and TCCD2ex (circles), for single-pair FRET samples (D-xbp-A) (black) and samples in the presence of a remote fluorophore (B)(D-xbp-A) (red). Solid lines represents the theoretical FRET efficiency based on the helical model27,28 for an R0 of 48.9 Å (see Supporting Information). The dashed lines represent 10% error in the Fo¨rster distance determination.

to enhance coincidence in samples with high FRET efficiencies. The same approach can be used in other scenarios. In the course of our single-molecule FRET investigations in biomolecules, we have found samples showing FRET but in which the acceptor was additionally quenched. We have mimicked a situation in which the acceptor is fully quenched, it is completely dark, by substituting the acceptor with Black Hole Quencher 1.29,30 This quencher acts as a dark acceptor, causing energy transfer to occur from the donor, Alexa Fluor 488, that is subsequently quenched. This scenario, which is not uncommon in single-molecule fluorescence studies of biological molecules, would be completely impossible to analyze by using conventional FRET measurements, as the dark acceptor would not show any fluorescence. However, it can be successfully analyzed using coincidence spectroscopy once a reference fluorophore is added to enhance coincidence. We added far away from the donor a red reference dye that will give rise to coincident fluorescence bursts in a dual-color excitation experiment (TCCD2ex). We then quantified the shift in the coincidence histograms due to FRET from the donor to the dark acceptor. Following the nomenclature described earlier in this paper, the sample will be named (A647N)(A488-16bp-BHQ1). The TCCD histograms for this model sample was centered at a Z value of 0.14 ± 0.04, slightly red-shifted due to FRET from the donor to the dark acceptor. This is significantly different to the central position of the histograms from (A488)40bp(A647N) model samples in the absence of FRET, 0.05 ± 0.03. Energy transfer from the donor to the dark acceptor can be also detected through the values of average brightness of coincident bursts. The blue channel fluorophore showed a coincidence average brightness of 24.5 ± 0.8 kHz for (A647N)(A488-16bp-BHQ1), whereas in the model in the absence of FRET (A488)40bp(A647N), this value was 26.1 ± 0.7 kHz. Obviously, the detection of FRET would not be possible for this system without the addition of the reference red dye that enhances the coincidence levels. As in all the coincidence measurements, the detection of species of interest is selective, with nonassociated or singly labeled species filtered out, and the chance coincident events are removed using the usual protocol.20 Figure 6 shows the calibration curve for this sample, as well as the recovery of the actual TCCD histogram of (A647N)(A488-16bp-BHQ1) in a large excess of single-labeled impurities. We have used this sample to mimic a singular situation in which the acceptor is fully quenched and have shown TCCD2ex can rescue the sample by adding a reference red fluorophore. This situation would be the extreme case, so when the acceptor is partially quenched an extra red shift in the Z histogram and an increase in red burst intensity would be detected easily. DISCUSSION Fluorescence coincidence spectroscopy has previously been implemented very successfully to extract valuable information from systems in the absence of FRET, in terms of aggregation or interaction between different components, having provided in(27) Clegg, R. M.; Murchie, A. I. H.; Zechel, A.; Lilley, D. M. Proc. Natl. Acad. Sci. U. S. A. 1993, 90, 2994–2998. (28) Dietrich, A.; Buschmann, V.; Muller, C.; Sauer, M. Rev. Mol. Biotechnol. 2002, 82, 211–231. (29) Marras, S. A. E.; Kramer, F. R.; Tyagi, S. Nucleic Acids Res. 2002, 30, e122. (30) Johansson, M. K.; Cook, R. M. Chem. Eur. J. 2003, 9, 3466–3471.


8395

Figure 6. (A) Association quotient calibration in the presence of free dyes for (A647N)(A488-16bp-BHQ1). (B) Significant histogram (bar) recovered by subtracting the chance coincidence histogram (gray) to the total histogram (blue) of (A647N)(A488-16bp-BHQ1) at a fraction of 0.05.

sights into biological systems of interest such as human telomerase, virions, or receptors in the membrane of living T-cells.22,23,31 Here we have shown that coincidence analysis is just as applicable to the detection of different FRET states.25 As an example, two different FRET states were detected by TCCD on a green fluorescent protein mutant labeled with an external red fluorophore, Alexa Fluor 647.32 The two states were not clearly visible on traditional proximity ratio histograms, but clearly resolved using coincidence analysis. Here we have confirmed the correlation of the position of coincidence histograms with the FRET efficiency and demonstrated the ability of the approach to overcome such complications as the presence of the zero peak and the distortion of the histogram peaks at the extreme FRET efficiency values associated with the conventional methodology. Besides, the coincidence analysis filters out events due to impurities or incomplete labeling, making it possible to work in an excess of fluorescent material not showing energy transfer. Single-molecule fluorescence methodologies utilize very diluted solutions, usually ∼50 pM, to ensure less than one molecule at a time in the probe volume. Complying with this restriction is (31) James, J. R.; White, S. S.; Clarke, R. W.; Johansen, A. M.; Dunne, P. D.; Sleep, D. L.; Fitzgerald, W. J.; Davis, S. J.; Klenerman, D. Proc. Natl. Acad. Sci. U. S. A. 2007, 104, 17662–17667. (32) Orte, A.; Craggs, T. D.; White, S. S.; Jackson, S. E.; Klenerman, D. J. Am. Chem. Soc. 2008, 130, 7898–7907.

8396


challenging when studying biological complexes with relatively large dissociation constants. The high sensitivity of TCCD2ex makes it an ideal way to study such systems, providing a reliable ability to recover accurate histograms by accounting for coincident fluorescent events due to chance. We have demonstrated here that fluorescence coincidence spectroscopy is also capable of picking up differences in histograms due to changes in FRET efficiency or to partial quenching of one of the fluorophores, even under conditions of low population fraction of the sample of interest. The potential of TCCD lies in its relatively simple experimental setup and straightforward methods of analysis. Other advantages arise from the use of continuous wave lasers as excitation sources. For example, red fluorophores such as Cy5 or Alexa Fluor 647 are known to undergo phototransformations to dark states upon excitation with a blue laser.33,34 The use of continuous wave lasers considerably reduces this short-wavelength photobleaching of acceptor fluorophores35 by avoiding extremely high instantaneous illumination intensities. The coexistence of several species within the coincidence histograms is indicated by excessive broadening of the histograms. In all our model samples, the widths of the histograms were always ∼1.8 times the shot-noise limit. This broadening is a common feature in dsDNA dual-labeled with a donor and acceptor, usually attributed to distribution of distances and dynamic heterogeneities36,37 or other effects such as mismatch between donor and acceptor detection volumes.37 Seidel and colleagues and Weiss and collaborators estimated a broadening of FRET histograms due to fluorophore distance dynamics in dsDNA, similar to those studied here, of 5 and 1.6 Å, respectively.36,37 However, additional effects such as the interaction of the fluorophoreswiththeDNAstrandandbasestackingmaybeconsidered.28,34 In our fitting procedures, the inclusion of additional species is justified when the experimental histogram is well above this value of 1.8 times the shot-noise limit, and by a decrease in χ2 values. Each of the TCCD1ex or TCCD2ex techniques, using singleor dual-color excitation, respectively, has certain advantages. In TCCD1ex, practically all of the bursts in the acceptor channel are due to efficient FRET. This eliminates the complications posed by chance coincident events, since the red fluorophore is not directly excited under optimal conditions. This is the same experiment as a conventional single-molecule FRET experiment, but benefiting from the advantages of the coincidence analysis against the conventional analysis of the proximity ratio histograms. On the other hand, TCCD2ex allows the quantitative determination of dissociation/equilibrium constants because it detects both associated and unassociated molecules.20 Thus, a single TCCD2ex experiment is capable of providing both FRET efficiency values and dissociation equilibrium constants from a single data acquisition. As introduced by Weiss and co-workers, it is also possible to use alternating laser excitation (ALEX). In the ALEX method, (33) Heilemann, M.; Margeat, E.; Kasper, R.; Sauer, M.; Tinnefeld, P. J. Am. Chem. Soc. 2005, 127, 3801–3806. (34) White, S. S.; Li, H.; Marsh, R. J.; Piper, J. D.; Leonczek, N. D.; Nicolaou, N.; Bain, A. J.; Ying, L.; Klenerman, D. J. Am. Chem. Soc. 2006, 128, 11423– 11432. (35) Kong, X.; Nir, E.; Hamadani, K.; Weiss, S. J. Am. Chem. Soc. 2007, 129, 4643–4654. (36) Antonik, M.; Felekyan, S.; Gaiduk, A.; Seidel, C. A. M. J. Phys. Chem. B 2006, 110, 6970–6978. (37) Nir, E.; Michalet, X.; Hamadani, K. M.; Laurence, T. A.; Neuhauser, D.; Kovchegov, Y.; Weiss, S. J. Phys. Chem. B 2006, 110, 22103–22124.

the donor and then acceptor are excited on the same molecule and this allows more accurate determination of FRET efficiency and hence structure of the molecule.38 It would therefore be possible to alternate between the red laser being on and off to get the benefits of both TCCD1ex and TCCD2ex. In cases of very high FRET efficiency values, close to 1, or in other scenarios where additional quenching of the acceptor is present, the usual FRET analysis is very challenging or distinctly inaccurate when possible. Using TCCD we are able to address these scenarios by enhancing the coincidence levels by the use of remote fluorophores not involved in the FRET process, i.e., a far away blue or red fluorophore. Although the inclusion of a third tag in a biological system may be a challenging task, the greater sensitivity of the coincidence method should be rewarding. Besides this, it is significantly easier in general to include a third tag at any remote location on the biomolecular complex, particularly if it consists of several components, than it is to reposition either of the FRET-pair fluorophores. CONCLUDING REMARKS In this work, we have shown that it is possible to apply TCCD using either one- or two-laser excitation to samples where there is FRET between a donor and acceptor fluorophore, even in the situation where there is a small fraction of the species that shows FRET. This is a common situation as single-molecule fluorescence is applied to more complex biological systems. The position of the peak in the histogram can be used to determine the approximate FRET efficiency, and Gaussian peaks are obtained when the FRET is very high or low, which is not the case for proximity ratio histograms. We have also measured the detection efficiency for single-pair FRET species with differing extents of energy transfer and found that it is not constant. This is a new observation that has consequences for the determination of the relative populations of species with different FRET efficiencies since for a heterogeneous sample with several species this effect biases the histograms toward the species with higher detection (38) Lee, N. K.; Kapanidis, A. N.; Wang, Y.; Michalet, X.; Mukhopadhyay, J.; Ebright, R. H.; Weiss, S. Biophys. J. 2005, 88, 2939–2953.

efficiency. In order to properly quantify the different populations detected on a histogram, the different detection efficiencies for different FRET efficiencies should be measured and used to determine a set of correction factors. We have shown that the addition of a remote fluorophore addresses this issue, making the detection efficiency nearly constant. Such an additional remote fluorophore also allows us to detect FRET in the situation where the acceptor is partially or entirely quenched. A remote fluorophore can be added by putting a dye label at any convenient position on any component of the system and is particularly straightforward for a system with more than one component. The detection of FRET in cases where the acceptor is quenched should allow the study of many new molecular systems and potentially allow the exploitation of intrinsic quenching, eliminating the need to add an acceptor to the system. Overall the methods developed in this paper combined with our previous methods to select the optimum threshold for coincidence analysis should allow the study of FRET in complex biological systems, where the complex is only present in low fractions, and allow simpler labeling schemes to be used particularly by exploiting intrinsic quenching. This in turn should allow single-molecule fluorescence to be applied to gain new insights into an even wider range of biomolecular complexes and systems. ACKNOWLEDGMENT A.O. thanks the European Union 6th Framework for a MarieCurie Fellowship. This work was funded by the Biotechnology and Biological Research Council of the UK. We thank S. M. Ibrahim for critically proofreading this manuscript. SUPPORTING INFORMATION AVAILABLE Additional information as noted in text and Table S1. This material is available free of charge via the Internet at http:// pubs.acs.org.

Received for review May 2, 2008. Accepted September 8, 2008. AC8009092


8397

Fluorescence Coincidence Spectroscopy for Single-Molecule

Recommend Documents