Fluorescent Nanohybrids for Synchronous Tumor ... - ACS Publications

Subscriber access provided by University of Newcastle, Australia

Article

Two-step Assembling of Near-Infrared “OFF-ON” Fluorescent Nanohybrids for Synchronously Tumor Imaging and MicroRNA Modulation-based Therapy Xiongwei Deng, Zhaoxia Yin, Jianqing Lu, Yang Xia, Leihou Shao, Qin Hu, Zhi Xiang Zhou, Fang Zhang, Shao Mei Zhou, Yan Wu, Wang Sheng, and Yi Zeng ACS Appl. Mater. Interfaces, Just Accepted Manuscript • DOI: 10.1021/acsami.6b11438 • Publication Date (Web): 05 Jan 2017 Downloaded from http://pubs.acs.org on January 6, 2017

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

ACS Applied Materials & Interfaces is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 31

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Applied Materials & Interfaces

Two-step Assembling of Near-Infrared “OFF-ON” Fluorescent Nanohybrids for Synchronously Tumor Imaging and MicroRNA Modulation-based Therapy Xiongwei Deng, †,‡ Zhaoxia Yin, † Jianqing Lu, ‡ Yang Xia, † Leihou Shao, ‡ Qin Hu, † Zhixiang Zhou, † Fang Zhang, † Shaomei Zhou, † Yan Wu,*,‡ Wang Sheng*,† and Yi Zeng† †

College of Life Science and Bioengineering, Beijing University of Technology, No. 100 Pingleyuan, Chaoyang District, Beijing 100124, P.R. China.

‡

CAS Key Laboratory for Biomedical Effects of Nanomaterials and Nanosafety, CAS Center for

Excellence in Nanoscience, National Center for Nanoscience and Technology, No. 11 Beiyitiao, Zhongguancun, Beijing 100190, China

KEYWORDS: Nanohybrids; NIR fluorescence; “OFF-ON”; Tumor imaging; MicroRNA modulation therapy;

ABSTRACT Theranostic nanoparticles with combined imaging and therapy functions show great promise in cancer precision medicine. In this study, we constructed near-infrared (NIR) “OFF-ON” fluorescent nanohybrids (F-PNDs) for synchronously tumor imaging and microRNA (miRNA) modulation therapy against esophageal cancer. Nanodiamond clusters (NDs) were firstly functionalized for protamine sulfate immobilization (PNDs) on their surfaces via a non-covalent self-assembling approach and simultaneous encapsulation of NIR emitting fluorescence dye cyanine 5 (Cy-5) (F-PNDs). Tumor suppressor miRNA-203 (miR-203) was then adsorbed onto the surface of F-PNDs to form miR-203/F-PNDs via electrostatic interactions. The size, morphology, photo-physical and stability properties of miR-203/F-PNDs were analyzed. We found that the NIR fluorescence of miR-203/F-PNDs could be activated to “ON” state in intracellular environment while remaining “OFF” state in extracellular or blood environment. Furthermore, in vivo live imaging experiments showed that miR-203/F-PNDs could be predominantly accumulated in tumor tissues and image the tumor sites 24 h post-intravenous

ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

injection. In addition, intravenous and intratumoral injection of miR-203/F-PNDs could efficiently inhibit tumor growth through down-regulation of the expressions of oncogenes Ran and △p63. Our study indicated that miRNA/F-PNDs could serve as a promising theranostic platform for synchronously tumor imaging and miRNA-based modulation therapy against cancer.

1. INTRODUCTION MicroRNAs (miRNAs) are a group of short (~22 nucleotides) and conserved non-coding RNAs that regulate gene expression at the post transcriptional level.1 MiRNAs are abnormally expressed in many cancers and have been recognized as key regulators of cancer pathobiology by acting as oncogenes or tumor suppressor genes.2,3 MiRNAs have shown great promise in cancer diagnosis and therapy, and are recognized as novel biomarkers for precision medicine against cancer.4 However, delivery of therapeutic miRNA into the designed tumor sites and tumor cells remains the biggest hurdle in miRNA modulation-based therapy against cancer.5 In recent years, a variety of non-viral nanoparticle-based vectors have been designed to deliver miRNA both in vitro and in vivo, and have shown great promise in developing miRNA modulation therapy against cancer.6-12 However, it holds great interest to develop useful tools to simultaneously image the tumor site and track miRNA delivery in vivo for optimal outcome of miRNA-based therapy. In this regard, noninvasive imaging modalities could play an important role as a tool that permits the tracking of miRNA delivery process in vivo, which is eventually favorable to develop more successfully miRNA modulation therapy. In recent years, theranostic nanoparticles have attracted more and more attentions by simultaneously integrating imaging and therapeutic agents in a single platform for image-guided cancer therapy.13,14 The combination of imaging probes with therapeutic drugs/genes in nanoparticle allows to monitor the accumulation and distribution of drugs/genes in animal model to facilitate the evaluation of treatment effects and optimize treatment dose for improving therapeutic efficacy.15,16 Thus, the development of versatile theranostic nanoparticles for synchronously tumor imaging and treatment holds great promise in the precision medicine against cancer. To date, various methods have been developed for visualizing theranostic nanoparticle-based delivery in vivo, such as near-infrared (NIR) fluorescence imaging, positron emission tomography (PET) and magnetic resonance imaging (MRI).17-19 Some theranostic


Page 2 of 31

Page 3 of 31

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


nanoparticles are current under pre-clinical evaluation.20 For example, superparamagnetic iron oxide (SPIO) are FDA-approved MRI contrast agents and different SPIO-based nanotheranostic platforms have been developed and used in pre-clinical studies.21 Among them, NIR fluorescence offers significant advantages in living cells and tissues imaging due to its low auto-fluorescence and deeper tissue penetration abilities in the NIR region (700-900 nm).22 Specially, cyanine-derived NIR dyes including indocyanine green (ICG), cyanine-5/5.5 (Cy-5/5.5), IR-780 and IR-820, are the most widely used NIR fluorescence dyes for various biomedical applications.23-26 A variety of nanotheranostic platforms integrating NIR imaging agents and therapeutic composites such as chemotherapy drugs or small interfering RNA (siRNA) have been developed so far, including micelles, inorganic materials, metal materials and hybrid materials.27-32 These constructed nanomaterials have superior advantages for cancer therapy due to its passive targeting ability known as EPR effects.33 Specially, theranostic nanoparticles that could exhibit fluorescence “OFF” state in blood circulation and non-target tissues (low fluorescence signals) while could be activated to fluorescence “ON” state in the target tumor sites and cells (high fluorescence signals) have been extensively investigated, which could image the tumor sites and monitor the loaded drugs/genes delivery more effectively compared with always “ON” fluorescent nanoparticles.34,35 Rationally, most “OFF-ON” theranostic nanoparticles were designed based on their stimuli-response ability to tumor specific microenviroment or intracellular factors, such as acidic pH, enzymes and redox potential.36-38 NDs are carbon derived nanomaterials with sizes about 2 to 8 nm in diameter and NDs possess many superior physico-chemical properties, such as good biocompatibility, stable inert core, large surface area and high surface adsorption ability.39,40 NDs could disperse in aqueous solutions forming aggregated clusters of sizes about tens to hundreds of nanometers. Usually, NDs clusters were surface modified with different polymers, proteins or peptides to construct proper nanostructures as drug/gene delivery systems through covalent or non-covalent strategies, and could exhibit sustained release behaviors, including small molecules, peptides, antibodies, DNAs, siRNA and miRNA with increased biological activities and low toxicity.41-45 Recently, Zhao and co-workers demonstrated that glycopolymer-coated NDs delivering doxorubicin showed higher efficiency than free doxorubicin in a 3D spheroid model of breast cancer.46 Li designed a smart



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

pH-responsive doxorubicin delivery system for selective targeting, imaging and therapy functions in breast cancer.47 In the present study, NIR fluorescent imaging agent Cy-5 and therapeutic tumor-suppressor miRNA-203 (miR-203) were simultaneously loaded in NDs-based nanohybrids through a facile two-step assembly approach to develop theranostic nanoparticles for synchronously tumor imaging and miRNA-based modulation therapy against esophageal cancer (Scheme 1). Esophageal cancer is most frequent in China. Its incidence exceeds 100 cases per 100,000 people per year in the high-risk northern and central China. The overall survival for advanced or metastatic esophageal cancer is very poor, whose 5-year survival rate is less than 20 % after surgery in China.48 Thus, we chose esophageal cancer as the cancer model in the current study. The physicochemical properties of miR-203/F-PNDs including hydrodynamic size, zeta potential, photo-physical and stability properties were studied. In vitro cellular uptake and fluorescence imaging properties were equally investigated. The biocompability of the established theranostic nanohybrids for in vivo application was also systematically evaluated. In vivo NIR fluorescence imaging and anti-tumor activity of miR-203/F-PNDs were subsequently examined using xenograft mice model of esophageal cancer.

2. EXPERIMENTAL SECTION 2.1. Materials. The NDs gel (15% w/v) was purchased from the NanoCarbon Research Institute Ltd. Nanodiamond (individual sizes of 2-8 nm) can spontaneously form nanodiamond clusters (NDs) when dispersed in aqueous solution. Protamine sulphate (PS), penicillin, streptomycin and trypsin from pancreas were obtained from Sigma Aldrich (St. Louis, MO, USA). Cyanine 5 (Cy-5, water-solubility) and NHS-Cy-5 were purchased from Fanbo Biochemicals (Beijing, China). CCK-8 kit was purchased from Dojindo Molecular Technologies (Tokyo, Japan). MiR-203 and scramble miRNA were synthesized and provided by RiboBio Co. LTD (Guangzhou, China). The sequences of miR-203 and scramble miRNA are 5'-GUGAAAUGUUUAGGACCACUAG-3' and 5'-UCACAACCUCCUAGAAAGAGUAGA-3', respectively. Other chemicals and solvents were of reagent grade commercially available. Ultrapure deionized water was supplied by Milli-Q water system.


Page 4 of 31

Page 5 of 31

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


2.2. Preparation and characterization of PNDs, F-PNDs and miR-203-loaded F-PNDs (miR-203/F-PNDs) NDs were dispersed in deionized water (1 mg/mL) and then sonicated for 4 h. The NDs solution was then added dropwise into protamine sulphate (PS) solution (15 mg/mL) at a mass ratio of 1:15 and the resulting mixture was stirred at room temperature for 2 h. The mixture was centrifuged at 8000 g for three times and the unbound PS was removed by extensive wash. The PNDs pellets were re-dispersed in deionized water and the concentration was determined by measuring the lyophilized weight of 1 ml of the solution. For the preparation of Cy-5 loaded F-PNDs, different mass of Cy-5 (200 µg, 100 µg, 50 µg, 20 µg and 10 µg) were pre-mixed with PS solution (15 mg/mL) and the follow-up procedure was the same as preparing PNDs. The encapsulation efficacy (EE) of Cy-5 was calculated as below: EE(%) = (weight of encapsulated Cy-5/weight of Cy-5 in feed) × 100 %. The amount of encapsulated Cy-5 was detected by measuring Cy-5 fluorescence intensity and calculated by standard curve. F-PNDs loaded with tumor suppressor miR-203 (miR-203/F-PNDs) were prepared by electronic interaction. Positively charged F-PNDs could adsorb negative charged miRNA and the best weight ratio of F-PNDs to miRNA was fixed at 4:1 in the current study according to our previous report.41 MiR-203 mimics and scramble miRNA mimics were dissolved in RNase-free water and then were incubated with F-PNDs with the miRNA:F-PNDs weight ratio of 1:4 for 30 minutes at room temperature. Free miRNAs were removed by centrifugation and washed with water. The miR-203/F-PNDs pellets were resuspended in RNase-free water at appropriate concentrations. Gel retardation assay was performed to confirm the miR-203 loading efficiency as described previously.41 Dynamic light scattering (DLS) was used to determine the particle size and surface zeta potential by the Malvern Zetasizer NanoZS instrument. The data was determined via cumulative analysis. F-PNDs (60 µg/mL) were deposited onto commercial lacey carbon coated copper TEM grids and air dried for 2 h. Samples were then imaged by electron microscope (JEOL JEM-2010F). The ultraviolet-visible adsorption and fluorescence spectra were measured by LAMBDA 650 (PerkinElmer) and Hitachi F-4600 systems, respectively. Serum degradation assays were performed as below: naked miR-203 and the miR-203/F-PNDs solutions were added 50% serum. The mixed solutions were then incubated at 37 °C for different



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

times. 15 µL of the mixtures were taken out at different incubation times and then mixed with 5 µL 2% SDS and 2.5 µL 10% glycerine. Then, the above mixtures were loaded onto 2% argarose gel and gel electrophoresis was carried. 2.3. Experimental cells and animals Cell culture medium RMPI 1640 and fetal bovine serum (FBS) were obtained from Gibco BRL (Grand Island, NY, USA). Ec-109 cells (human esophageal cancer cell) were cultured in 10% FBS containing RMPI 1640 medium and supplemented with streptomycin (100 µg/mL) and penicillin (100 U/mL) at 37 °C and 5% CO2 atmosphere. Experimental female Balb/c nude mice (4-6 weeks old) were supplied by Charles River Laboratories and maintained at the animal care facility. All mice were housed (a group of five) in a clean environment supplemented with enough water and fresh food, and were under a 12 h light/dark environment. The mice were acclimatized for 7 days prior to the in vivo experiments. 2.4. In vitro Cy-5 and miR-203 release behaviours and fluorescence imaging of miR-203/F-PNDs To evaluate the in vitro release profiles of Cy-5 and miR-203 from miR-203/F-PNDs, FAM-labeled miR-203 was used in this study. 2 mL of miR-203/F-PNDs (0.5 mg/mL) were put into two separate dialysis bag (MWCO 3500 Da for Cy-5 and MWCO 50,000 Da for FAM-miR-203) and then the dialysis bags were immersed in 10 mL of RNase-free PBS 7.4, PBS 5.5 with or without 0.25% trypsin at 37 °C with constant shaking at 100 rpm. At different time points, 0.5 mL of medium were taken out from the solution and 0.5 mL of fresh PBS was added again after each sampling. The released Cy-5 and FAM-miR-203 were detected by measuring the fluorescence intensity of Cy-5 (λex 646 nm and λem 664 nm) and FAM (λex 488 nm and λem 520 nm). MiR-203/F-PNDs (5 µg/mL of Cy-5 equivalent) in 1640 medium containing 10% FBS were incubated with or without Ec-109 cells at 96-well plates for different times. In vitro fluorescence images were then recorded with an ex/in vivo imaging system (CRi, Woburn, MA). 2.5. In vitro cellular uptake, distribution and cell imaging Ec-109 cells (2 × 105) were seeded in a borosilicate chambered cover glass overnight (37 °C, 5% CO2). After overnight incubation, the culture medium was replaced with a fresh medium containing miR-203/F-PNDs (5 µg/ml of Cy-5 equivalent). After co-incubation with 30 min, 2 h


Page 6 of 31

Page 7 of 31

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


and 4 h, the medium was removed and the cells were washed twice with PBS, and then fixed with 4% paraformaldehyde. The endosome/lysosomes were stained by LysoTracker Green DND-26. Then the cells were observed using a laser scanning confocal microscope (LSM 710, Carl Zeiss Microscope). 2.6. Cell proliferation assay 1 × 103 cells Ec-109 cells were seeded in a 96-well plate for 24 h. 100 nM concentration of miR-203 (miR-203/F-PNDs) were added to each well. Untreated cells and free miR-203-treated cells were used as controls. After incubation for different times, CCK-8 assay was performed to determine the cell viability. The cell viability was calculated as below: Viability% = (OD 450 nm of the experimental group-OD 450 nm of blank (medium)/OD 450 nm of control group-OD 450 nm of blank (medium) × 100%. Absorbance at 450 nm was detected with TECAN Infinite M200 microplate reader (Tecan, Durham, USA). 2.7. Hemolysis assay Red blood cells (RBCs) were obtained from 0.5 mL of freshly whole blood and washed with PBS three times. Then RBCs were suspended in PBS and 0.5 mL of empty F-PNDs dissolved in PBS was added to equal volume of the RBC suspension for final concentrations of 10, 50, 100 and 200 µg/mL. 0.5 mL of RBC suspensions incubated with equal volumes of water were used as positive control and incubated with PBS were used as negative controls. The samples were gently mixed and incubated for 4 h, and then centrifuged at 1000 × g for 5 min. Then, 100 µL of supernatant was added into a 96-well plate and the absorbance at 577 nm was detected with a microplate reader. The haemolytic ratios of different samples were calculated as below: Hemolysis % = (sample absorbance – negative control) /(positive control – negative control)×100% 2.8. Hemotology analysis A total of 20 healthy Balb/c mice were randomly divided into 4 groups (five mice per group) and injected with saline and different concentrations of F-PNDs (5, 10 and 20 mg/kg) and scarified at 10 days after injection. Approximately 500 µL of blood was collected for blood hemotology analysis (Charles River Laboratories, Beijing, China). 2.9. Long-Term Biodistribution and Clearance Analysis of PNDs



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

We firstly prepared Cy-5 conjugated PNDs. Briefly, 1 mg of PNDs was dissolved in 5 mL of deionized water, and 50 µg of Cy-5 NHS ester dissolved in 100 µL DMSO was added. The above mixture was stirred at room temperature and under nitrogen atmosphere for 24 h. The solution was thereafter centrifuged and washed three times with deionized water to obtain Cy-5 conjugated PNDs. We then monitored the clearance of PNDs by semi-quantitatively measuring the fluorescence of Cy-5 conjugated PNDs in mice organs according to previous report.49 To study long-term biodistribution and clearance of PNDs, Cy-5 conjugated PNDs were intravenously injected into mice at 20 mg/kg. At different time intervals post-injection (1, 7 and 10 days), the mice were sacrificed and the major organs (liver, kidney, spleen, lungs, heart) were collected. Then, a semi-quantitative estimation of the fluorescence intensity in the organs was done using the Maestro ex/in vivo imaging system and analyzed by the Maestro software. 2.10. In vivo NIR imaging In vivo real-time NIR fluorescent imaging of Ec-109 tumor-bearing mice were performed by using an ex/in vivo imaging system. The images were acquired at 1, 24, and 48 h after intravenous injection with saline, Cy-5 solution, miR-203/F-PNDs pre-treated with 0.25% trypsin for 1h and miR-203/F-PNDs (at a dose of Cy-5 4 mg/kg of total mice body weight). At the end of in vivo imaging experiments, the mice were sacrificed and the tumors and major organs were then collected for imaging and analysis. 2.11. Microscopy imaging of frozen tumor slides Tumor-bearing mice were intravenously injected with miR-203/F-PNDs at a dose of 4 mg/kg of Cy-5. After 48 h post-injection, animals were sacrificed, and tumors were collected. Then, the tumor tissues were frozen and cut into 10 µm thickness using a Leica cryostat. After that, the slides were then imaged by fluorescence microscope. 2.12. In vivo anti-tumor experiments When the tumor size grew to around 100 mm3, the mice were randomly divided into five groups (5 mice per group). For anti-tumor experiments, the tumor-bearing mice were administrated by intratumoral (i.t.) or

intratail vein (i.v.)

injection with

miR-203/F-PNDs, scramble

miRNA/F-PNDs at a miR-203-equivalent dose of 2 mg/kg every 2 days for 2 weeks. The animal weight and tumor sizes were measured for 2 weeks. The tumor volume was calculated using the


Page 8 of 31

Page 9 of 31

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


formula: Tumor volume= (Length×Width2)/2. At the end of the experiment, the mice were sacrificed and the tumor sites and major organs were collected for further analysis. 2.13. Quantitative real-time PCR and Western-blot analysis qRT-PCR study was performed to analyze miR-203 expression level and the mRNA levels of Ran and △p63 according to our previous methods.41 Total RNA was isolated using Trizol reagent according to the manufacturer’s instruction (Invitrogen, USA). U6 was used as an endogenous control. The primers are as follows: MiR-203: 5'-GCGTGAAATGTTTAGGACCACTAG-3' U6: 5'- GCTTCGGCAGCACATATACTAAAAT -3' To analyze the protein levels of Ran and △p63, a Western-blot study was performed. Tumor tissues were lysed with RIPA lysis buffer supplemented with protease inhibitor on ice. Cellular debris was removed by centrifugation at 12,000 g for 20 min at 4°C. The supernatant was collected and the concentrations of protein were measured using the BCA protein assay kit (Promega, USA). The protein samples were loaded on the SDS/PAGE and transferred onto a PVDF membrane (Millipore, USA) after electrophoresis and incubated and blocked 1 h. The anti-Ran and anti-△p63 (Novus, USA) antibody were further added and incubated with the membranes overnight at 4°C. Then, the membranes were co-incubated with the secondary antibody after washing three times. GAPDH was used as an internal protein (Cell signaling, USA). 2.14. H&E staining and TUNEL assays Tumor specimens, liver and kidney organs were fixed in 4% paraformaldehyde, embedded in paraffin wax and then stained with hematoxylin and eosin (H&E). Terminal deoxynucleotidyl transferase-mediated dUPTFluorescein nick end labelling (TUNEL) assay was performed as following: tumor sections were permeabilized with 0.1% Triton X-100, 0.1% sodium citrate in PBS and washed twice with PBS. The sections were then incubated in 50 µl of TUNEL kit (Roche, Basel, Switzerland) for staining in a humidified chamber in the dark at 37 °C for 1 hour. All images were obtained by microscopic observation. 2.15. Statistical analysis



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

All data are determined as Mean ± SD and all experiments were performed at three times. Statistical significance of the data were considered by the one-way analysis of variance (ANOVA), (*p

Fluorescent Nanohybrids for Synchronous Tumor ... - ACS Publications

Recommend Documents