Fluorescently Cationic Conjugated Polymer as an Indicator of Ligase

Mar 14, 2012 - The method is sensitive and specific enough to detect 1 fM (600 zmol) DNA molecules. .... The mutDNA and wtDNA were mixed at different ...
0 downloads 0 Views 1MB Size
Download PDF
Article pubs.acs.org/ac

Fluorescently Cationic Conjugated Polymer as an Indicator of Ligase Chain Reaction for Sensitive and Homogeneous Detection of Single Nucleotide Polymorphism Yongqiang Cheng,* Qing Du, Liyong Wang, Hailian Jia, and Zhengping Li* Key Laboratory of Medicine Chemistry and Molecular Diagnosis, Ministry of Education, College of Chemistry and Environment Science, Hebei University, Baoding 071002, China ABSTRACT: Ligase chain reaction (LCR) offers a simple and robust alternative platform for nucleic acid amplification, but its application has been limited because the LCR products are mostly detected by gel electrophoresis separation or heterogeneous analysis. In this paper, we report a novel homogeneous LCR assay by using cationic conjugated polymers (CCPs) as an indicator for detection of singlenucleotide polymorphism (SNP). For LCR, we design two pairs of unique target-complement probes. Each pair of probes contains two adjacent probes, in which one probe is designed with phosphorothioate modification at its 3′-end, and the other probe is labeled with fluorescein at its 5′-end. After the LCR, the two adjacent probes are ligated to form one DNA strand with a fluorescein label at its 5′-end and phosphorothioate modification at its 3′-end, which is resistant to the exonuclease I and exonuclease III degradation. When the CCP is added, because of the strong electrostatic interactions between CCP and DNA, effective fluorescence resonance energy transfer (FRET) from the CCP to the fluorescein-labeled DNA can be observed. In contrast, the unligated fluorescein-labeled probes are degraded to the mononucleotides by exonuclease I and exonuclease III. Introduction of CCP leads to inefficient FRET results because much weaker electrostatic interactions between the fluoresceinlabeled mononucleotides and CCP keep the fluorescein far away from CCP. Accordingly, homogeneous LCR for SNP detection is performed successfully. The method is sensitive and specific enough to detect 1 fM (600 zmol) DNA molecules. It is possible to quantify SNP and accurately determine the allele frequency as low as 1.0%. This proposed assay strategy extends the application of LCR and provides a new platform for homogeneous detection of SNP.

D

detecting point mutation such as those occurring in infectious diseases and genetic polymorphism diseases.15,16 Generally, the LCR products were mostly detected by gel electrophoresis separation or heterogeneous analysis, resulting in multiplex steps, high cost, and longer analytical time, which limit its widespread application. Homogeneous methods have attracted increasing attention with remarkable advantages such as simple procedures, short assay time, and with no need for separations or washes. However, the techniques usually used in homogeneous detection such as Taqman probe,17 molecular beacon,18 and specific fluorescent dye of DNA19 are difficult to be applied to the LCR because LCR is not based on primer extension such as PCR, SDA, RCA, etc. but amplification of the ligated probes. Therefore, it is desirable to develop a facile, highly sensitive, and specific method for homogeneous LCR detection. Cationic conjugated polymers (CCPs) containing a large number of repeated absorbing units can transfer the excitation energy along the whole backbone of the CCP to the chromophore reporter.20−24 Because of their unique light-harvesting properties, CCPs provide an

etection of single nucleotide polymorphism (SNP) plays an important role in determining the genetic predisposition toward inherited diseases, cancer diagnosis, and drug response.1,2 Up until now, a number of methods have been developed for detecting SNP. Generally, all the sensitive SNP detections involve target sequence amplification, typically including polymerase chain reaction (PCR),3,4 strand displacement amplification (SDA),5,6 rolling circle amplification (RCA),7,8 enzyme amplification,9 ligase chain reaction (LCR),10−12 etc. Because of its high sensitivity and specificity, ligase chain reaction (LCR) offers a simple and robust alternative platform for nucleic acid amplification.10−14 LCR utilizes two pairs of oligonucleotides as probes, in which one pair is complementary to the upper DNA strand and the other pair is complementary to the lower DNA strand. Each pair of probes contains two adjacent probes complementary to the template DNA strand. In presence of target DNA, the adjacent probes can be ligated by thermostable DNA ligase. Subsequently, the ligated probes can serve as templates and are amplified by thermal cycling with their correspondingly complementary adjacent probes, leading to an exponential amplification process. As ligation has the greater discriminatory power than primer extension reaction, LCR has better specificity than primer extension reaction for © 2012 American Chemical Society

Received: February 1, 2012 Accepted: March 14, 2012 Published: March 14, 2012 3739

dx.doi.org/10.1021/ac300314c | Anal. Chem. 2012, 84, 3739−3744

Analytical Chemistry

Article

Table 1. Sequences of Probes and Targets (5′-3′) Used in the Experimentsa wtDNA mutDNA probe X probe Y probe Xr probe Yr probe X-m probe Yr-m

GACACCATGGTGCACCTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTG GACACCATGGTGCACCTGACTCCTGTGGAGAAGTCTGCCGTTACTGCCCTG FITC-TATGGTGCACCTGACTCCTGA phosphate-GGAGAAGTCTGCCGTTACTG phosphate-CAGGAGTCAGGTGCACCATG FITC-TAGTAACGGCAGACTTCTCCT FITC-TATGGTGCACCTGACTCCTGT FITC-TAGTAACGGCAGACTTCTCCA

a

The three 3′-ends (underline and italic) bases of probe Y and probe Xr are phosphorothioate modification. The underline and bold base in mutDNA is the mutant site as compared to wtDNA. The probe X-m and probe Yr-m are the probes that are perfectly complementary to the mutDNA.

LCR Reaction. The LCR reaction was performed in a 20 μL mixture containing 20 mM Tris-HCl (pH 8.3), 25 mM KCl, 10 mM MgCl2, 0.5 mM nicotinamide adenine dinucleotide (NAD), 0.01% Triton X-100, 50 nM probe X, 50 nM probe Y, 50 nM probe Xr, 50 nM probe Yr, and the appropriate amount of target DNA. The reaction mixture was first heated at 95 °C for 3 min, then 3 U of Ampligase was added in the reaction mixture at 75 °C. The LCR reaction was carried out with following 30 thermal cycles at 95 °C for 1 min and 65 °C for 1 min. Fluorescence Measurement. Before measuring fluorescence, 20 units of Exo I and 200 units of Exo III were added into the LCR reaction mixture to degrade unreacted fluoresceinlabeled probes by incubation at 37 °C for 90 min. The degraded reaction was terminated by incubation at 80 °C for 15 min and subsequently held at 4 °C. Aliquots of 12 μL of LCR product and 6 μL of PFP (15 μM in monomer repeat units, RUs) were then added to a 1.5 mL centrifuge tube and diluted to 600 μL with 25 mM HEPES buffer (pH 8.0). The fluorescence spectra were measured in a 1 cm × 1 cm quartz cuvette. The excitation wavelength was 380 nm, and the spectra were recorded between 400 and 650 nm. Allele Frequencies Determination. The mutDNA and wtDNA were mixed at different ratios ranging from 0 to 100% and were used as DNA samples. The total amount of target DNA was controlled at 1 pM. The procedure of LCR reaction and fluorescence measurement were the same as demonstrated above. Human Genome DNA Sample Analysis. Human genome DNA was extracted from whole blood of a healthy volunteer by Universal Genomic DNA Extraction Kit Ver. 3.0 (TaKaRa). PCR amplification was performed in 20 μL of 10 mM Tris-HCl buffer (pH 8.3) with 1.5 mM MgCl2, 50 mM KCl, 400 μM dNTPs, 0.5 μM forward and reverse primers, 2 units Taq DNA polymerase, and about 0.1 ng of genomic DNA. For generation of a 100 bp PCR product from the human β-Globin gene, the following primers were used: forward, 5′-ACTAGCAACCTCAAACAGACAC-3′; reverse, 3′-CCACCAACTTCATCCACG-5′.35 The reaction mixture was first denatured for 5 min, and then Taq DNA polymerase was added. Amplification was achieved by thermal cycling for 29 cycles at 95 °C for 30 s, 54 °C for 30 s, and extension at 72 °C for 30 s. PCR products were purified by a QIAEX II Gel Extraction Kit (QIAGEN) and redissolved in 20 μL of deionized water. Afterward, the PCR products were diluted by 1000 times for LCR. The LCR and the fluorescence measurement were performed as described above.

effective platform for homogeneous DNA detection based on formation of the stable polyelectrolyte complexes between CCPs and negatively charged DNA by electrostatic interactions.25−28 CCPs can serve as donors to transduce the hybridization event of single-stranded fluorescent probe and target DNA to fluorescent signal by fluorescence resonance energy transfer (FRET) with high sensitivity.29−33 It is possible to explore CCPs in designing a simple, universal, high-efficiency platform for LCR-based homogeneous SNP detection. In this paper, we demonstrate a new, homogeneous LCR methodology for SNP detection by using CCP as an indicator. The method makes the best of the thermostable ligase-based specific ligation to discriminate single-base variation and the exponential LCR amplification to detect SNP with high sensitivity. In each probe pair of LCR, one probe is designed with phosphorothioate modification at its 3′-end, and the other probe is labeled with fluorescein at its 5′-end. The unique devised probes enable the ligated LCR products with a fluorescein label not to be degraded by exonuclease but the unligated fluorophore-labeled probes to be degraded to the mononucleotides by exonuclease. When the CCP is added, because of the strong electrostatic interactions between CCP and DNA, effective FRET from the CCP to the fluoresceinlabeled LCR products can be observed. Thus, LCR-based homogeneous SNP detection is successfully achieved without the need for specific instruments, separations, and washes steps.

■

EXPERIMENTAL SECTION Materials and Apparatus. Thermostable Ampligase was purchased from Epicenter Technologies (Madison, WI). Exonuclease I (Exo I) and exonuclease III (Exo III) were purchased from Fermentas. 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) was obtained from Sigma. The cationic poly[(9,9-bis(6-N,N,N-trimethylammonium)hexyl) fluorenylenephenylene dibromide] (PFP) used as the CCP in the FRET experiments was synthesized according to the procedure reported by Stork et al.34 The synthetic oligonucleotides used in this study were obtained from TaKaRa Biotechnology Co., Ltd. (Dalian, China). The sequences of the probes and targets are listed in Table 1. All the oligonucleotides were HPLC-purified except that wild-type DNA (wtDNA) and mutant-type DNA (mutDNA) were PAGE-purified. All solutions were prepared in deionized and sterilized water. The other reagents were of analytical reagent grade and used as purchased without further purification. The LCR reaction was performed in a 2720 thermal cycler (Applied Biosystems). A Hitachi F-4500 spectrofluorometer (Tokyo, Japan) equipped with a xenon lamp was used to obtain the fluorescence spectra.

■

RESULTS AND DISCUSSION The Principle of SNP Detection. The homogeneous SNP strategy with LCR by using PFP as an indicator is illustrated in Figure 1. The targets DNA are fragments of the human 3740

dx.doi.org/10.1021/ac300314c | Anal. Chem. 2012, 84, 3739−3744

Analytical Chemistry

Article

Figure 1. Principle of homogeneous LCR detection of SNP.

β-globin gene, in which the wtDNA and mutDNA are the normal βA and sickle βS genes, respectively. The wtDNA is different from mutDNA with a single base of A-T transversion that causes β-thalassemia.34 For LCR, two pairs of probes are respectively designed. The one pair of probes consisted of X, and Y has the sequence perfectly complementary to the upper strand sequence of wtDNA. The other pair of probes formed from Xr and Yr has the sequence perfectly complementary to the lower strand sequence of wtDNA. In the presence of the wtDNA, probes X and Y hybridize to adjacent positions on the upper strand of wtDNA, respectively, after thermal denaturation and are ligated by the thermostable ampligase to form the ligation product of XY. During the next cycle, the XY products can then serve as the new templates for the probe pair Xr and Yr and form the new ligation products of XrYr. Meanwhile, probes Xr and Yr hybridize with the lower strand of wtDNA and are ligated to form the ligation product of XrYr. Similarly, the XrYr products also serve as the templates for the probes X and Y and form the new ligation products of XY. After repeated cycles of denaturation, annealing, and ligation, the wtDNA is

amplified exponentially to generate a large number of ligation products of XY and XrYr. It should be noted that the probe X and Yr are designed with the fluorescein label at their 5′-ends, and the probe Y and Xr are designed with phosphorothioate modification at their 3′-ends. Such designs enable the ligation products, XY and XrYr, to keep with the fluorescein label at their 5′-ends and phosphorothioate modification at their 3′ends, which prevent the LCR products from being degraded by Exo I and Exo III because Exo I and Exo III can, respectively, degrade the single-stranded DNA and double-stranded DNA in a 3′-5′ direction and are not active on phosphorothioate-linked nucleotides. When PFP is added, strong electrostatic interactions between the PFP and the LCR products bring PFP close to the fluorescein labeled at LCR products and efficient FRET from PFP to fluorescein occurs. In contrast, one base at the 3′-end of probe X and Yr is, respectively, mismatched with the upper strand and lower strand sequences of mutDNA, and so, because of the high specificity of ampligase, two pairs of probes cannot be ligated. By temperature cycling, mutDNA cannot be amplified. Subsequently, all probes X and 3741

dx.doi.org/10.1021/ac300314c | Anal. Chem. 2012, 84, 3739−3744

Analytical Chemistry

Article

Yr are degraded to the mononucleotides by Exo I and Exo III. Introduction of PFP leads to inefficient FRET results because much weaker electrostatic interactions between the fluoresceinlabeled mononucleotides and PFP keep the fluorescein far away from PFP. As a result, it is possible to carry out LCR-based SNP detection in a homogeneous manner by measuring changes in the emission intensity of PFP and fluorescein interactions. Figure 2 showed the fluorescence spectra obtained when PFP was added to the LCR products of wtDNA and mutDNA after

Figure 2. Fluorescence spectra from solution containing PFP and LCR products from wtDNA and mutDNA. LCR products was diluted by 100 times with HEPES buffer solution (25 mM, pH 8.0) before fluorescence measurement. The final concentration: wtDNA = mutDNA = 10 fM; PFP = 0.15 μM in RUs. The excitation wavelength is 380 nm.

digesting with Exo I and Exo III by excitation at 380 nm. For wtDNA, the fluorescence emission of PFP at 425 nm was significantly quenched and the fluorescence emission of fluorescein at 525 nm was observed. These results indicated that LCR was achieved successfully by using probe pairs matched with wtDNA, and the LCR products, XY and XrYr, were kept with fluorescein labels at the 5′-ends and phosphorothioate modification at the 3′-ends. So, efficient FRET from PFP to fluorescein took place. In contrast, for mutDNA, the PFP fluorescence only decreased weakly, and the fluorescence emission of fluorescein was only a little, indicating that the FRET was limited. FRET efficiency, defined as the ratio of fluorescence intensity at 525 nm to that at 425 nm (I525 nm/I425 nm), was used to evaluate the selectivity for SNP detection. As shown in Figure 2, the FRET efficiency for wtDNA is 10 times higher than that for mutDNA, which demonstrates the good selectivity of this method for detection of SNP. Optimization Experimental Conditions for SNP Detection. In the LCR-based homogeneous assay, the reaction conditions such as concentration of ampligase, ligation temperature, and thermal cycle number of LCR are studied and optimized. Figure 3a shows the FRET responses with different concentration of ampligase. The FRET efficiency produced by the wtDNA was increased significantly with an increase of the concentration of ampligase from 0.05 U/μL to 0.25 U/μL. Nevertheless, the FRET efficiency of the blank and mutDNA kept with the low responses with an increase of ampligase from 0.05 U/μL to 0.15 U/μL and increased obviously with an increase of ampligase more than 0.15 U/μL. In view of the specificity and sensitivity for detection of SNP, the concentration of 0.15 U/μL ampligase was used in subsequent experiments. The temperature for the ligation reaction in LCR had a crucial effect on the FRET efficiency for SNP detection. Thus,

Figure 3. (a) Effect of concentration of ampligase on FRET efficiencies in LCR. (b) Effect of reaction temperature on FRET efficiencies in LCR. (c) Effect of the thermal cycle number of LCR on FRET efficiencies. The blanks were treated without any DNA template and detected in the same way as the wtDNA and mutDNA. The wtDNA and mutDNA were 10 fM. Sequential detection was carried out as described in the Experimental Section.

the different ligation temperature in LCR was investigated. As shown in Figure 3b, with the increase of the reaction temperature from 62 to 66 °C in LCR, the FRET efficiency for blank, mutDNA, and wtDNA reduced gradually. However, the noticeable reductions from 62 to 65 °C for blank and mutDNA were observed as compared with the small reduction for wtDNA. The maximum value of the net FRET efficiency, in which the blank value was subtracted, was obtained with the 3742

dx.doi.org/10.1021/ac300314c | Anal. Chem. 2012, 84, 3739−3744

Analytical Chemistry

Article

ligation temperature at 65 °C, which was selected throughout subsequent experiments. The LCR amplification efficiency is directly related to the thermal cycle number of LCR. Figure 3c showed that the FRET efficiency of wtDNA was increased remarkably with increasing the thermal cycle number of LCR. However, the FRET efficiency of blank and mutDNA were increased little with the thermal cycle number of LCR from 20 to 30. When the cycle number was greater than 30, the FRET efficiency of the blank and mutDNA increased significantly, which resulted in the poor specificity of LCR for detection of SNP. Therefore, the thermal cycle number of the LCR was set to 30 throughout the subsequent experiments. Sensitivity of Detection and Allele Frequency Determination. The quantitative detection of target DNA using this method under the optimized experimental conditions was evaluated by monitoring the FRET efficiency on the wtDNA concentration. Figure 4a shows the fluorescence responses of

FRET efficiency linearly depends on the concentration of wtDNA. The linear curve fitted a regression equation of I525 nm/I425 nm = 15.40 lg(C/fM) + 14.74 with a range from 1 fM to 10 pM with a correlation coefficient of R = 0.9979. The detection limit (3σ, n = 11) was estimated to be 0.2 fM, with a widely dynamic range that spanned approximately 4 orders of magnitude. A series of six repetitive measurements of the 500 fM wtDNA were used for estimating the precision, and the relative standard deviation (RSD) was 4.4%. Quantifying SNPs can be applied to estimate the frequency of SNP alleles in DNA pools, which has an importance in association studies between SNPs and diseases.36 To determine an allele frequency, wtDNA and mutDNA were mixed at different ratios of 0%, 1%, 2%, 5%, 10%, 20%, 50%, and 100% as DNA samples. The total concentration of DNA in the samples was fixed at 1 pM. Figure 5 shows the relationship between

Figure 5. Relationship between allele frequencies and FRET efficiency of samples of mixed wtDNA and mutDNA in various ratios. The total concentration of DNA in the samples was 1 pM. The sequential detection was carried out as described in the Experimental Section.

allele frequency and FRET efficiency (I525 nm/I425 nm) for the LCR products of the test samples. As the ratio of wtDNA in the test samples increased, the FRET efficiency also increased. This result indicates that the proposed method can be successfully applied for SNP determination in pooled DNA samples. Human Genomic Sample Analysis. To further validate the applicability of the proposed method, the PCR product of healthy human genomic sample was analyzed using the LCRbased homogeneous SNP detection. As shown in Figure 6, a significant difference of FRET efficiency for PCR products was obtained by using specific wtDNA probes and mutDNA probes, whose sequences are listed in Table 1. The wtDNA probes included the two pairs of probes consisting of X, Y, and Xr, Yr with the complementary sequences to wtDNA. The mutDNA probes included the two pairs of probes consisting of X-m, Y, and Xr, Yr-m with the complementary sequences to mutDNA, in which the 3′-end bases of probes X-m and Yr-m were, respectively, mismatched with the upper strand and lower strand sequences of wtDNA. For PCR products of healthy human genomic samples, the LCR was achieved successfully by using wtDNA probes and no LCR with mutDNA probes. The resulting FRET efficiency obtained by excitation at 380 nm is approximately 3 times higher for wtDNA specific probes than that for mutDNA specific probes, which is nearly the same as

Figure 4. (a) Fluorescence spectra from solution containing PFP and LCR products from wtDNA with varying concentrations (0, 1, 10, 100 fM, 1, and 10 pM). LCR products were diluted by 100 times with HEPES buffer solution (25 mM, pH 8.0) before fluorescence measurement. (b) The calibration curve of wtDNA by using LCR with PFP detection. The relative FRET efficiency was the net intensity produced by target DNA, where the background signal had been subtracted for each value. Sequential detection was carried out as described in the Experimental Section. Error bars were estimated from three replicate measurements.

LCR products from different concentrations of wtDNA. It could be seen that the fluorescence emission of PFP at 425 nm was significantly lowered with an increase of the concentration of wtDNA while the fluorescence emission of fluorescein at 525 nm significantly raised. As shown in Figure 4b, the enhanced 3743

dx.doi.org/10.1021/ac300314c | Anal. Chem. 2012, 84, 3739−3744

Analytical Chemistry

Article

(3) Mackay, I. M.; Arden, K. El.; Nitsche, A. Nucleic Acids Res. 2002, 30, 1292−1305. (4) Li, H. K.; Huang, J. H.; Lv, J. H.; An, H. J.; Zhang, X. D.; Zhang, Z. Z.; Fan, C. H.; Hu, J. Angew. Chem., Int. Ed. 2005, 44, 5100−5103. (5) Ness, J. V.; Ness, L. V.; Galas, D. J. Proc. Natl. Acad. Sci. U.S.A. 2003, 100, 4504−4509. (6) Wang, H. Q.; Liu, W. Y.; Wu, Z.; Tang, L. J.; Xu, X. M.; Yu, R. Q.; Jiang, J. H. Anal. Chem. 2011, 83, 1883−1889. (7) Li, J.; Deng, T.; Chu, X.; Yang, R.; Jiang, J.; Shen, G.; Yu, R. Anal. Chem. 2010, 82, 2811−2816. (8) Bi, S.; Li, L.; Zhang, S. Anal. Chem. 2010, 82, 9447−9454. (9) Patolsky, F.; Lichtenstein, A.; Willner, I. Nat. Biotechnol. 2001, 19, 253−257. (10) Wu, D. Y.; Wallace, R. B. Genomics 1989, 4, 560−569. (11) Barany, F. Proc. Natl. Acad. Sci. U.S.A. 1991, 88, 189−193. (12) Cao, W. Trends Biotechnol. 2004, 22, 38−44. (13) Luo, J.; Bergstrom, D. E.; Barany, F. Nucleic Acids Res. 1996, 24, 3071−3078. (14) Mano, J.; Oguchi, T.; Akiyama, H.; Teshima, R.; Hino, A.; Furui, S.; Kitta, K. J. Agric. Food Chem. 2009, 57, 2640−2646. (15) Blocker, M. E.; Krysiak, R. G.; Behets, F.; Cohen, M. S.; Hobbs, M. M. J. Clin. Microbiol. 2002, 40, 3631−3634. (16) Pingle, M. R.; Granger, K.; Feinberg, P.; Shatsky, R.; Sterling, B.; Rundell, M.; Spitzer, E.; Larone, D.; Golightly, L.; Barany, F. J. Clin. Microbiol. 2007, 45, 1927−1935. (17) Bardea, A.; Burshtein, N.; Rudich, Y.; Salame, T.; Ziv, C.; Yarden, O.; Naaman, R. Anal. Chem. 2011, 83, 9418−9423. (18) Zheng, J.; Li, J.; Jiang, Y.; Jin, J.; Wang, K.; Yang, R.; Tan, W. Anal. Chem. 2011, 83, 6586−6592. (19) Cheng, Y.; Li, Z.; Zhang, X.; Du, B.; Fan, Y. Anal. Biochem. 2008, 378, 123−126. (20) Gaylord, B. S.; Heeger, A. J.; Bazan, G. C. Proc. Natl. Acad. Sci. U.S.A. 2002, 99, 10954−10957. (21) He, F.; Tang, Y.; Yu, M.; Feng, F.; An, L.; Sun, H.; Wang, S.; Li, Y.; Zhu, D.; Bazan, G. C. J. Am. Chem. Soc. 2006, 128, 6764−6765. (22) He, F.; Feng, F.; Duan, X.; Wang, S.; Li, Y.; Zhu, D. Anal. Chem. 2008, 80, 2239−2243. (23) Feng, F.; Wang, H.; Han, L.; Wang, S. J. Am. Chem. Soc. 2008, 130, 11338−11343. (24) Ren, X.; Xu, Q. H. Langmuir 2009, 25, 43−47. (25) Gaylord, B. S.; Massie, M. R.; Feinstein, S. C.; Bazan, G. C. Proc. Natl. Acad. Sci. U.S.A. 2005, 102, 34−39. (26) Duan, X.; Li, Z.; He, F.; Wang, S. J. Am. Chem. Soc. 2007, 129, 4154−1455. (27) Duan, X.; Wang, S.; Li, Z. Chem. Commun. 2008, 1302−1304. (28) Duan, X.; Liu, L.; Wang, S. Biosens. Bioelectron. 2009, 24, 2095− 2099. (29) Duan, X.; Yue, W.; Liu, L.; Li, Z.; Li, Y.; He, F.; Zhu, D.; Zhou, G.; Wang, S. Nat. Protoc. 2009, 4, 984−990. (30) Liu, B.; Bazan, G. C. Chem. Mater. 2004, 16, 4467−4476. (31) Xu, H.; Wu, H.; Huang, F.; Song, S.; Li, W.; Cao, Y.; Fan, C. Nucleic Acid Res. 2005, 33, e83. (32) Feng, F.; He, F.; An, L.; Wang, S.; Li, Y.; Zhu, D. Adv. Mater. 2008, 20, 2959−2964. (33) Zhang, Y.; Li, Z.; Cheng, Y.; Wang, Y. Talanta 2009, 79, 27−31. (34) Stork, M.; Gaylord, B. S.; Heeger, A. J.; Bazan, G. C. Adv. Mater. 2002, 14, 361−366. (35) Guo, W.; Yuan, J.; Dong, Q.; Wang, E. J. Am. Chem. Soc. 2010, 132, 932−934. (36) Li, Z. P.; Tsunoda, H.; Okano, K.; Nagai, K.; Kambara, H. Anal. Chem. 2003, 75, 3345−3351.

Figure 6. Detection results of a human genomic DNA sample. The concentration of specific mutDNA probes and wtDNA probes were 50 nM, respectively. Sequential detection was carried out as described in the Experimental Section. The error bars show the error estimated from three replicate measurements.

that for the blank. These results indicate that the genotype of this genomic DNA from human genomic sample is wtDNA, which suggests that the developed SNP strategy might become a promising technique for genomic research.

■

CONCLUSIONS In conclusion, we have developed a novel, homogeneous LCR assay for SNP detection by using CCP as an indicator with high specificity and sensitivity. The specificity of the ligase ensures the efficient ligation of allele-specific probes for a matched target and distinguishes a one-base difference for mismatched target. The unique phosphorothioate-modified probes prevent the LCR products from degradating by Exo I and Exo III. Therefore, the homogeneous LCR for SNP detection is carried out successfully by measuring the FRET between the CCP and fluorescein-labeled LCR products. This method is simple, is cost-effective, and does not require expensive instruments or complex steps. As a result, this proposed assay strategy extends the application of LCR and provides a new platform for homogeneous detection of LCR as well as genetic analysis and molecular diagnosis.

■

AUTHOR INFORMATION

Corresponding Author

*Phone: +86-312-5079403. Fax: +86-312-5079403. E-mail: [email protected] (Y.C.); [email protected] (Z.L.). Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS We acknowledge financial support from the National Natural Science Foundation of China (Grant 21075028), the Specialized Research Fund for the Doctoral Program of Higher Education, China (Grants 20070075003 and 20091301120003), and the National Science Foundation of Hebei Province, China (Grant B2009000170).

■

REFERENCES

(1) Irizarry, K.; Kustanovich, V.; Li, C.; Brown, N.; Nelson, S; Wong, W.; Lee, C. J. Nat. Genet. 2000, 26, 233−236. (2) Kim, S.; Misra, A. Annu. Rev. Biomed. Eng. 2007, 9, 289−320. 3744

dx.doi.org/10.1021/ac300314c | Anal. Chem. 2012, 84, 3739−3744