Fluoromodules Consisting of a Promiscuous RNA Aptamer and Red or

Jun 23, 2017 - Robert J. Trachman, IIIAmir AbdolahzadehAlessio AndreoniRazvan CojocaruJay R. KnutsonMichael RyckelynckPeter J. UnrauAdrian R...
1 downloads 0 Views 5MB Size
Download PDF
Article pubs.acs.org/JACS

Fluoromodules Consisting of a Promiscuous RNA Aptamer and Red or Blue Fluorogenic Cyanine Dyes: Selection, Characterization, and Bioimaging Xiaohong Tan, Tudor P. Constantin, Kelly L. Sloane, Alan S. Waggoner, Marcel P. Bruchez, and Bruce A. Armitage* Departments of Chemistry and Biological Sciences, Molecular Biosensor and Imaging Center, and Center for Nucleic Acids Science and Technology, Carnegie Mellon University, 4400 Fifth Avenue, Pittsburgh, Pennsylvania 15213-3890, United States S Supporting Information *

ABSTRACT: An RNA aptamer selected for binding to the fluorogenic cyanine dye, dimethylindole red (DIR), also binds and activates another cyanine, oxazole thiazole blue (OTB), giving two well-resolved emission colors. The aptamer binds to each dye with submicromolar KD values, and the resulting fluoromodules exhibit fluorescence quantum yields ranging from 0.17 to 0.51 and excellent photostability. The aptamer was fused to a second aptamer previously selected for binding to the epidermal growth factor receptor (EGFR) to create a bifunctional aptamer that labels cell-surface EGFR on mammalian cells. The fluorescent color of the aptamer-labeled EGFR can be switched between blue and red in situ simply by exchanging the dye in the medium. The promiscuity of the aptamer can also be used to distinguish between cell-surface and internalized EGFR on the basis of the addition of red or blue fluorogen at different times.

■

GFP chromophore, creating fluorescent RNA-dye complexes that mimic GFP spectroscopically, even though the chromophore is not covalently bound to the RNA.12 The so-called Spinach fluoromodule and its improved versions have been used in a variety of bioimaging applications.13−15 The work described herein concerns an RNA aptamer that binds to the fluorogenic cyanine dye, dimethylindole red (DIR).9 In a separate project, a single-chain antibody fragment (scFv) that was selected for binding and activating fluorescence from DIR was found to be promiscuous, binding to several other cyanines to give fluorescent colors spanning the visible region of the spectrum.16 The aptamer we report here is also moderately promiscuous, activating not only DIR to give red emission but also a blue-emitting fluorogen called oxazole thiazole blue (OTB)17,18. The aptamer was fused to a second aptamer that recognizes the epidermal growth factor receptor (EGFR)19 at cell surfaces in order to create a modular imaging reagent. Moreover, the ability to label EGFR with either red (DIR) or blue (OTB) fluorogens allowed us to follow cell surface expression and internalization of the endogenous receptor, distinguishing between the two populations on the basis of which dye was present at different times during the experiment.

INTRODUCTION Biological imaging and detection has been revolutionized by the availability of fluorescent modules, or fluoromodules, that can be used to label and track specific biomolecules such as proteins and RNA. Protein-based fluoromodules have made a bigger impact on the field, beginning with inherently fluorescent proteins such as green fluorescent protein (GFP), which can be genetically encoded as fusion constructs.1,2 Semisynthetic fluoromodules based on chemical (e.g., FlAsH/ReAsH3) or enzymatic incorporation of fluorescent dyes (e.g., SNAP4 and HaloTag5 technology) or noncovalent binding of fluorogenic dyes (e.g., TMP6 and scFv7 modules) are increasingly used with genetically encoded protein apomodules as the addition of an exogenous dye affords greater control over when the fluorescence appears during an experiment as well as versatility with respect to the actual color of the fluorescence. RNA-based fluoromodule development is less advanced than its protein-based counterpart. This is due to in part to the lack of an inherently fluorescent RNA module analogous to GFP, requiring all RNA fluoromodules to include an exogenous dye. RNA aptamers have been selected for binding numerous fluorescent or fluorogenic dyes, with the earliest example of an RNA fluoromodule consisting of an RNA aptamer that binds and activates fluorescence from malachite green (MG).8 Later reports demonstrated fluorescence-activating aptamers for a variety of dyes, including cyanines9,10 and Hoechst-like polyheterocycles.11 The most significant advance in RNA fluoromodules was reported by Jaffrey and co-workers, who selected aptamers that bind to synthetic dyes modeled on the © 2017 American Chemical Society

Received: April 25, 2017 Published: June 23, 2017 9001

DOI: 10.1021/jacs.7b04211 J. Am. Chem. Soc. 2017, 139, 9001−9009

Article

Journal of the American Chemical Society Chart 1a

a

See Supporting Information for complete structure.

■

RESULTS Rationale. Our previous report involving the selection of an RNA aptamer that activates fluorescence from DIR (Chart 1)9 and more recent work that reported the selection of aptamers for a thiazole orange derivative10 established the unsymmetrical cyanine dyes as attractive components for the development of RNA fluoromodules for bioimaging and sensing. Furthermore, the discovery that some single-chain antibody fragments exhibit considerable promiscuity in their recognition of fluorogenic cyanines led to a catalog of fluoromodules with colors spanning the visible spectrum in which the protein component is constant but the dye varies.16 These observations motivated us to explore the promiscuity of DIR-binding aptamers and then to apply such aptamers to multicolor fluorescence imaging. Aptamer Selection. We used a previously reported biotinylated version of DIR9 to allow affinity-based enrichment of the RNA pool. (See Chart 1 for the abbreviated structure; the complete structure is shown in Chart S1, Supporting Information.) The RNA pool contained a universal, stem-loopforming sequence flanked by randomized regions, but unlike our or others’ previous reports in which the pools were symmetric with the stem-loop in the center,9,12,20 the RNA pool used for this selection was asymmetric, with the putative stem-loop shifted toward the 5′-end of the sequence. (There was no particular rationale for this; we were simply curious about any potential impact of this change on the outcome of the selections.) The full details concerning the selection procedure and the results can be found in the Experimental Section and Supporting Information. The best aptamers selected from the previous symmetric and new asymmetric pools activate DIR fluorescence to similar levels (>20-fold). However, the winning aptamer from the symmetric pool that we reported previously was poorly represented in the final pool of winners, whereas the aptamer from the asymmetric pool was abundantly represented after 14 rounds of selection. Whether the greater representation of the winner in the current selection is a result of better binding characteristics or a result of amplification fitness is unclear. After sequence minimization and optimization, we obtained a 57 nucleotide anti-DIR RNA aptamer (DIR2s-Apt) which can bind and activate DIR fluorescence (see Supporting Information for experimental details). A color-coded representation of the sequence and a proposed secondary structure of DIR2s-Apt calculated using

NUPACK are shown in Figure 1. The internal constant region is shaded in pink; the predicted structure suggests that it

Figure 1. Predicted secondary structure of DIR2s-Apt RNA selected for binding to DIR. Internal constant region from original pool is shaded.

contributes to two different stem-loop structures rather than forming its own hairpin. Future structure-probing experiments and mutational analyses will be performed to better characterize the secondary structure of DIR2s-Apt. Fluorogenic Dye Activation. Incubating DIR or DIR-Pro with the aptamer DIR2s-Apt led to a modest red-shift of the dyes’ main absorption band (Figure S2), indicating a binding interaction between the dye and aptamer. As shown in Figure 2, DIR exhibited a 20-fold fluorescence enhancement in the presence of the aptamer. For comparison, an RNA aptamer previously selected for binding to MG,8,21 a member of the structurally unrelated triphenylmethane class of fluorogenic dyes, generated a considerably smaller (ca. 3-fold) enhancement, indicating that activation of DIR fluorescence by DIR2sApt is not a result of simple nonspecific binding interactions. Furthermore, DIR2s-Apt failed to activate fluorescence from MG, further establishing the selectivity of DIR recognition by this aptamer. (The fluorescence of MG-Apt/MG-2p is 50-fold brighter than that of DIR2s-Apt/MG-2p; Figure S3.) Finally, yeast tRNA and double-stranded calf thymus DNA gave significantly weaker activation of DIR (Figure S4), further illustrating the selectivity of DIR2s aptamer binding to DIR. Next, we tested additional DIR analogues for fluorescence enhancement by DIR2s-Apt. As shown in Figure 3A, a 45-fold 9002

DOI: 10.1021/jacs.7b04211 J. Am. Chem. Soc. 2017, 139, 9001−9009

Article

Journal of the American Chemical Society

benzoxazole ring system (OTB-T-SO3, Chart 1) led to lower activation relative to the other OTB dyes, but also led to significantly less activation by MG-Apt, which in turn led to an overall improvement in enhancement factor. Furthermore, we observed that when the sulfonate group is replaced by a carboxylic acid, OTB-T-CO2, the dye was not activated within our limit of detection. (UV−vis spectra for the aptamer complexes with OTB-SO3 and OTB-T-SO3 are given in Figure S2.) The selectivity of the RNA for seemingly modest structural changes in the fluorogens was surprising. It is possible that the nonactivated dyes α-CN-DIR and OTB-T-CO2 bind to the aptamer without fluorescence activation. To test this possibility, we performed competition experiments that showed that excess α-CN-DIR and OTB-T-CO2 had no effect on the activation of either DIR or OTB-SO3 by the aptamer (Figure S5). Although this does not rule out the possibility that α-CN-DIR and OTBT-CO2 bind to a different site than DIR and OTB-SO3, it is unlikely that there would be two independent binding sites that effectively discriminate between such closely related dyes. Overall, whereas it is not possible to rationalize the structure− activity relationships exhibited by the two classes of cyanine dyes for activation by the aptamer, these results demonstrate that DIR2s-Apt is capable of activating distinct fluorogens that emit in the red (DIR) and blue (OTB) regions of the spectrum, providing two well-resolved emission colors (Figure 4). Salt Effects on Fluorogen Activation by DIR2s-Apt. Aptamer binding to small molecules is typically dependent on ionic strength and cation identity. For example, the inclusion of divalent cations such as Mg2+ promotes aptamer folding and binding to its target. As shown in Figure 5A, decreasing the Mg2+ concentration from 8 to 0 mM led to 2−4-fold reduction in DIR-Pro and OTB-SO3 fluorescence. We also examined the dependence of fluorogen activation on the identity of the monovalent cation present in the buffer. This was motivated by recent reports of dye-binding aptamers that adopt Gquadruplex secondary structures, which are selectively stabilized by K+ relative to Na+ or Li+. When we tested these three cations, no effect was observed on the fluorogen activation (Figure 5B), indicating that a G-quadruplex secondary structure either is not present or is not required for dye binding by DIR2s-Apt. Spectroscopic Characterization of RNA Fluoromodules. We used fluorescence spectroscopy to determine two

Figure 2. Fluorescence emission spectra (λex = 600 nm) of DIR with or without RNAs. DIR (500 nM) was incubated with DIR2s-Apt or MG-Apt (3 μM) in binding buffer for 1 h prior to recording spectra.

fluorescence enhancement was obtained when DIR-Pro, an analogue in which the anionic sulfonate from DIR is replaced by a cationic quaternary ammonium substituent, was incubated with the aptamer. Slightly greater nonspecific activation of DIRPro is observed in the presence of MG-Apt, but overall the enhancement factor, defined as the ratio of fluorescence in the presence of DIR2s-Apt vs MG-Apt, was larger for DIR-Pro than DIR. Figure 3A also presents data for another DIR derivative, α-CN-DIR, which has an electron-withdrawing cyano group attached to the α-carbon closest to the dimethylindole ring system. In contrast to DIR and DIR-Pro, no significant fluorescence activation of α-CN-DIR was observed in the presence of DIR2s-Apt. Although DIR2s-Apt was unable to activate the fluorescence of α-CN-DIR, this aptamer showed high fluorescence activation ability toward another class of fluorogenic cyanines based on the OTB core (Chart 1). As shown in Figure 3B, DIR2s-Apt activated the parent dye OTB by 53-fold, although the enhancement factor was relatively small because of considerable activation by MG-Apt. (Yeast tRNA and calf thymus DNA gave slightly weaker activation of OTB as compared with MG-Apt; Figure S4.) A greater activation and enhancement factor were observed for OTB-SO3, which has a similar sulfonate group as DIR. Interestingly, the addition of a t-butyl group to the

Figure 3. Fluorescence activation of various DIR and OTB dyes (Chart 1) by DIR2s-Apt or MG-Apt RNA. Dye (100 nM) was incubated in binding buffer for 1 h with or without RNA aptamer (3 μM). λex /λem = 600/646 nm (DIR), 600/658 nm (DIR-Pro), 564/610 nm (α-CN-DIR), and 380/ 421 nm (OTB derivatives). Data and error bars represent mean and standard deviations for three separate trials. 9003

DOI: 10.1021/jacs.7b04211 J. Am. Chem. Soc. 2017, 139, 9001−9009

Article

Journal of the American Chemical Society

Table 1. Binding Affinity (KD) of Fluorogenic Dyes with DIR2s-Apt KD (nM)a

dye

966 252 662 1071

DIR DIR-Pro OTB-SO3 OTB-T-SO3

± ± ± ±

KD (nM)b

84 42 37 120

708 313 739 1193

± ± ± ±

74 44 58 103

a

DIR2s aptamer (25 nM) was incubated with different concentrations of dyes. bDye (25 nM) was incubated with different concentrations of DIR2s aptamer.

Table 2. Photophysical Properties of RNA-Fluorophore Complexes or Reference Fluorescent Proteins fluorophore

Figure 4. Normalized excitation and emission spectra for RNA fluoromodules consisting of DIR2s-Apt bound to members of the DIR or OTB class of fluorogenic dyes. [Dye] = 100 nM, [RNA] = 3 μM. λex = 380 nm for OTB-SO3, 600 nm for DIR-Pro.

22

TagRFP DIR DIR-Pro TagBFP23 OTB-SO3 OTB-T-SO3

important properties for fluoromodules: affinity, represented by the equilibrium dissociation constant (KD) and fluorescence quantum yield (ϕf). To determine KD values, we titrated each of the dyes into a solution of the aptamer, plotted fluorescence intensity versus the log of dye concentration, and fit the data to a 1:1 binding model that accounts for ligand depletion. (Job plot analysis confirmed that the aptamer bound each dye in a 1:1 stoichiometry, as shown in Figure S6.) Titrations were performed in both directions (i.e. adding dye into RNA and vice versa); the data and the fits are shown in Figure S7 with the KD values given in Table 1. Each of the dyes is bound by DIR2s-Apt with high nanomolar/low micromolar KDs, with DIR-Pro exhibiting the highest affinity (KD = 252 nM). Fluorescence quantum yields were determined relative to the appropriate standards and are shown in Table 2. The quantum yields of the fluorogens when bound to DIR2s-Apt compare favorably to the recently reported Mango fluoromodule (ϕf = 0.14)10. Combined with molar extinction coefficients of ca. 105 M−1cm−1, these fluoromodules should be sufficiently bright for use in biological imaging applications. Photostability of RNA Fluoromodules. A prerequisite for an effective fluorescent label is sufficient photostability to allow imaging under reasonable conditions of intensity and time. Figure 6 shows the effect of extended irradiation of the DIR2s-Apt complexes with DIR-Pro and OTB-SO3. The samples were irradiated continuously in a plate reader while the emission was monitored at the appropriate wavelengths. The photostability of DIR-Pro/DIR2s-Apt compares favorably

λex (nm)

λem (nm)

ε (M−1cm−1)

ϕf

brightness

555 600 600 402 380 380

584 646 658 457 421 421

100 000 150 000 164 000 52 000 73 000 71 000

0.48 0.26 0.33 0.63 0.51 0.17

49 000 39 000 54 000 33 000 37 000 12 000

with an MG derivative MG-2p in complex with its aptamer (Figure 6A) excited at the same wavelength. (The two complexes have very similar absorbances at the excitation wavelength.) The DIR-Pro complex loses ca. 15% of its fluorescence intensity over a period of 500 s of continuous irradiation, whereas the MG complex loses ca. 45%. Under identical conditions, the commonly used fluorophore Cy5 dissolved in aqueous buffer loses ca. 30% of its fluorescence intensity, which is twice as much as the DIR complex. The loss of fluorescence is most commonly attributed to a photobleaching reaction, in which the conjugation of the lightabsorbing chromophore is disrupted (e.g., by oxidation of a C− C π bond). However, complexes of dyes with biomolecules such as proteins or nucleic acids provide an alternative pathway: damage to the protein or nucleic acid host for the dye can result in the quenching of the dye fluorescence or the dissociation of the dye altogether. Because dyes like DIR and MG are fluorogenic, the dissociation of their aptamer complexes would result in a loss of fluorescence. The inset in Figure 6A reveals an interesting difference between DIR-Pro and MG-2p: the extent of photobleaching (i.e., loss of dye absorbance) of DIR-Pro closely matches its loss of fluorescence, whereas MG-2p photobleaches to a substantially lower extent relative to its fluorescence decrease (20% loss of absorbance vs 45% loss of fluorescence). This is likely a result of ancillary damage to the

Figure 5. Fluorescence intensity of DIR2s-Apt complexes with DIR-Pro and OTB-SO3 in (A) variable [Mg2+] or (B) varying monovalent salt. [Dye] = 100 nM, [RNA] = 3 μM. 9004

DOI: 10.1021/jacs.7b04211 J. Am. Chem. Soc. 2017, 139, 9001−9009

Article

Journal of the American Chemical Society

Figure 6. Comparison of photostabilities for (A) DIR2s-Apt/DIR-Pro, MG-Apt/MG-2P, and Cy5; (B) DIR2s-Apt/OTB-SO3 and BFP. Fluorescence intensities were collected every 3 s on a 384-well Nunc microplate reader with continuous excitation for (A) (λex = 610 nm, λem = 645 nm) and (B) (λex = 380 nm, λem = 430 nm). The inset UV−vis remained absorbance ratio was calculated on the basis of A610 nm values before and after continuous excitation. Data were normalized to the t = 0 s values in all cases.

The fusion aptamer was tested on two different cell lines: A431 and HEK293, which express relatively high and low levels of EGFR, respectively.24 EGFR-DIR2s was incubated with cells in PBS (Mg2+) buffer with DIR-Pro for 30 min on ice. As shown in Figure 7, after washing to remove the unbound

RNA aptamer as MG is known to produce singlet oxygen, and, in fact, the aptamer was originally selected for chromophoreassisted light inactivation experiments that rely on this property of MG.21 We also performed photostability experiments on OTB-SO3 bound to DIR2s-Apt and compared it with blue fluorescent protein (BFP) (Figure 6B). The OTB-SO3 fluoromodule loses only ca. 10% of its fluorescence over the duration of the experiment, whereas BFP is stable, with similar results obtained by monitoring the absorbance of the samples (Figure 6B, inset). Imaging of Mammalian Cells by DIR2s-Apt Fluoromodules. We next applied the DIR2s-Apt fluoromodule to live-cell imaging. To direct the fluoromodule to a specific target, we fused the aptamer to the 3′-terminus of a previously selected anti-EGFR RNA aptamer19 to form a bifunctional aptamer called EGFR-DIR2s. A predicted secondary structure of EGFRDIR2s was generated by NUPACK (Figure S8) and shows that a structure can be formed in which the two aptamer domains fold independently. To confirm this experimentally, we first tested whether this fusion aptamer can bind DIR-Pro and OTBSO 3 . As shown in Figure S9, EGFR-DIR2s activates fluorescence of DIR-Pro to a level similar to that of DIR2sApt when in the two different buffers used to select each separate domain of the fusion aptamer. Interestingly, the fusion aptamer activates OTB-SO3 by ca. 20% more than does isolated DIR2s-Apt. Since these experiments were done in the presence of a 30-fold excess of RNA and at a concentration above the KD, this added enhancement is presumably not a result of increased binding of the dye. Rather, it is possible that the DIR2s domain folds better when fused to the EGFR aptamer, but further experiments are needed to understand this result. In contrast, no fluorescence activation was observed for either dye in the presence of the isolated anti-EGFR aptamer (Figure S9). These results confirm that the dye-binding domain of the EGFR-DIR2s fusion aptamer folds properly, suggesting that the protein-binding domain should retain its ability to recognize EGFR. In preparation for imaging studies, we tested the toxicity of DIR-Pro and OTB-SO3 using the MTT assay. At a dye concentration of 5 μM, no effect on viability was observed in A431 cells (Figure S10). All imaging experiments were done at dye concentrations lower than this.

Figure 7. Confocal fluorescence micrographs of EGFR on living cells. (A,B) High-EGFR-expressing A431 cells were incubated with EGFRDIR2s aptamer (0.5 μM) and DIR-Pro dye (0.5 μM) in PBS buffer, containing 5 mM Mg2+, for 30 min on ice. Cells were then washed three times with 0.5 μM DIR-Pro dye in binding buffer. Distinct fluorescence signals were observed from the cell surface. (C,D) Fluorescence signal was not detected when low-EGFR-expressing HEK 293 cells were treated under the same conditions as in A and B. Scale bar = 50 μm.

aptamer, obvious fluorescence signals were observed on the cell surface of A431 cells (panels A,B), whereas no detectable fluorescence was found for HEK293 cells (panels C,D), indicating that the EGFR-DIR2s, like anti-EGFR aptamer, can label EGFR on A431 cells. The promiscuity of DIR2s-Apt provides an opportunity for dual-color labeling of EGFR in live cells. Specifically, the bifunctional aptamer EGFR-DIR2s was first incubated with A431 cells in the presence of DIR-Pro, and then the cells were washed once with an OTB-SO3 solution. As shown in Figure 8 9005

DOI: 10.1021/jacs.7b04211 J. Am. Chem. Soc. 2017, 139, 9001−9009

Article

Journal of the American Chemical Society

Figure 8. Live-cell dual-color imaging of EGFR by confocal fluorescence microscopy. A431 cells were treated by EGFR-DIR2s aptamer (0.5 μM) and DIR-Pro dye (0.5 μM) in PBS buffer, containing 5 mM Mg2+, for 30 min on ice. Cells were then washed once with 2 μM OTB-SO3 dye. Distinct fluorescence signals were observed from the cell surface in both the (A) DIR channel (λex = 633 nm, λem = 658 nm) and the (B) OTB channel (λex = 405 nm, λem= 445 nm), indicating EFGR can be simultaneously labeled with either dye. Cells were then further washed twice with 2 μM OTB-SO3, leading to loss of DIR-Pro signal (C) but retention of OTB-SO3 signal (D). Scale bar = 50 μm.

Figure 9. Flow cytometry profiles for A431 cells incubated with EGFR-DIR2s, DIR2s-Apt (control RNA), or dye alone. (A) Staining with DIR-Pro (0.5 μM) is evident for fusion aptamer, but not DIR2sApt or dye alone. (B) Specific staining is also observed with OTB-SO3 dye (1 μM) although with stronger nonspecific background compared with DIR-Pro. In both experiments, signal from cells labeled with dye alone gave no detectable signal.

labeled with EGFR-DIR2s/OTB-SO3 for 30 min at the higher temperature of 37 °C, where EGFR-binding by the aptamer is known to promote endocytosis.19 After washing to remove external fusion aptamer and dye, cells were stained with EGFRDIR2s/DIR-Pro on ice to prevent further internalization. A strong DIR-Pro signal is observed predominantly at the cell surface, whereas the OTB-SO3 signal is restricted to the internalized receptor pool (Figure 10, panels A−C). In contrast, performing the experiment with DIR2s-Apt (i.e., without the EGFR-binding domain) led to weak OTB-SO3 and DIR-Pro fluorescence (panels D−F). This experiment demonstrates that two populations of an endogenous biological target (i.e., EGFR) can be discriminated using a single affinity reagent that can be labeled separately with blue or red fluorogenic dyes, with particular utility in studies of receptor internalization.

(panels A,B), the cells were simultaneously stained both red and blue because of incomplete displacement of DIR-Pro by OTB-SO3. Further washing by OTB-SO3 successfully removes residual DIR-Pro, resulting in a significant reduction in the DIR channel (Figure 8, panels C,D). We also performed a control experiment in which the cells were treated with RNase A after staining with the bifunctional aptamer and either DIR-Pro or OTB-SO3. This led to a significant reduction in the cell-surface labeling, confirming that the labeling was mediated by the RNA aptamer (Figure S11, panels B,E). In addition, neither dye generated strong background signals, indicating that these dyes are good for cell-surface image assays. Flow cytometry provides further evidence of cell-surface labeling by the EGFR-DIR2s fusion aptamer. As shown in Figure 9A, a significant shift in the histogram of fluorescence was observed when EGFR-DIR2s/DIR-Pro was applied to A431 cells. In contrast, performing the same experiment with DIR2s/DIR-Pro (i.e., without the EGFR targeting domain) or DIR-Pro alone (i.e., no aptamer) led to no detectable staining of the cells, demonstrating the specificity of the labeling. In Figure 9B, when OTB-SO3 was used instead of DIR-Pro, qualitatively similar results were obtained, although the shift in the histogram was noticeably smaller. This is attributed to stronger background staining by OTB-SO3 alone or in combination with DIR2s-Apt. It is also worth noting that the flow cytometry experiments were performed without washing to remove unbound aptamer/dye, which likely contributes to the relatively high background from OTB-SO3. Nevertheless, the images shown in Figure 8 demonstrate the utility of this fluorogenic dye in the violet/blue region of the spectrum, for which there are fewer staining options as compared with the green and red regions. Finally, we tested whether our fusion aptamer can be applied to dynamic imaging of EGFR. In particular, distinguishing between cell-surface and internalized EGFR should be enabled by the promiscuity of the dye-binding domain. In contrast to labeling A431 cells on ice (as in Figures 7 and 8), cells were

■

DISCUSSION Even though protein fluoromodule technologies such as GFP,25,26 SNAP,27,28 HaloTag,5 FlAsH/ReAsH,29 and others are well established, corresponding tools for RNA labeling are less developed. The first example of an RNA fluoromodule based on an aptamer was reported by Tsien and co-workers, who demonstrated that an aptamer selected for MG that was developed for use in chromophore-assisted light inactivation (CALI) experiments21 also induced a significant increase in MG fluorescence.8 Numerous other aptamer fluoromodules were reported subsequently,9,11,30 but actual deployment in imaging experiments lagged until the more recently developed Spinach12 and Mango10 systems were selected and optimized. An important feature of these fluoromodules is the noncovalent binding of a fluorogenic dye. In principle, a dye that remains dark until it is bound to its cognate RNA should minimize background fluorescence (although a recent report indicates that fluorogenic dyes can give substantial background fluorescence in the absence of their cognate RNAs31). Even though covalent binding of the dye to the RNA would prevent undesirable dissociation of the dye from the aptamer target, noncovalent binding allows the dye to be washed out and 9006

DOI: 10.1021/jacs.7b04211 J. Am. Chem. Soc. 2017, 139, 9001−9009

Article

Journal of the American Chemical Society

Figure 10. Confocal fluorescence micrographs of A431 cells for imaging EGFR endocytosis and cell surface labeling. Cells were first treated by EGFR-DIR2s aptamer (2 μM) and OTB-SO3 dye (0.5 μM) for 30 min at 37 °C. Cells were then washed three times with 0.5 μM DIR-Pro and further incubated with EGFR-DIR2s (0.5 μM) and DIR-Pro (0.5 μM) for 5 min on ice. Cells were then washed three times with 0.5 μM DIR-Pro prior to imaging. Distinct fluorescence signals were observed inside the cell in the OTB-SO3 fluorescent channel (A) and on the cell surface in the DIR-Pro channel. Merging the two channels reveals internal OTB-SO3 fluorescence and surface DIR-Pro fluorescence (C). Panels D−F are analogous to A−C, except the EGFR-DIR2s fusion aptamer was replaced by DIR2s-Apt (control RNA). Scale bar = 50 μm.

here;16 further selections are also likely to yield more versatile RNA aptamers in this regard. The DIR2s fluoromodule proved its utility through fusion to another aptamer selected separately for binding to EGFR. Although fusion of two aptamers does not necessarily preserve their respective functions, as alternative folding pathways are available to the longer fusion construct, the DIR-2s/EGFR aptamer is truly bifunctional, retaining the dye-recognition domain and also being able to selectively stain cells that express higher levels of EGFR. The results shown in Figure 10 are particularly noteworthy in that two different populations of EGFR can be labeled red and blue based on when the sample was stained with each color. A similar experiment was reported using scFv reagents,35 but those relied on engineering scFvtagged versions of the receptor protein, whereas bifunctional aptamers allow endogenous proteins to be labeled. Whereas antibody reagents could be used in lieu of bifunctional aptamers, concern about batch-to-batch variation in performance36,37 and the need for two different antibodies (distinguished by labeling with different dyes) to achieve the same image as obtained with a single aptamer and two separate fluorogenic dyes is less appealing. In principle, one could also perform this experiment using two anti-EGFR aptamers covalently labeled with different colors. However, the length of the aptamer (104 nucleotides) would make synthesizing endlabeled aptamers difficult and expensive. Control experiments demonstrated some degree of nonspecific binding of DIR and OTB-SO3 to yeast tRNA, calf thymus DNA, and a different aptamer selected for binding to MG (Figure S4). Nonetheless, we were able to perform cellular imaging experiments without significant background staining by the dyes. This is likely a result of the low cell permeability and/ or weak activation of the dyes by cellular nucleic acids. (Note that in the fusion aptamer experiments, endocytosis after binding to cell-surface EGFR leaves the aptamer bound to the inner surface of the endosomal membrane, so the dyes should not be freely diffusing in the cytoplasm nor should they have

exchanged with a separate dye, a property that can (a) replace dye that is, for example, photobleached in order to restore signal or (b) generate additional colors from the same RNA. The latter property was explored for both Spinach and Mango, wherein modest wavelength tuning was reported for the former because of the introduction of substituents on the fluorogenic dye.14 For Mango, the aptamer is able to bind to two different fluorogenic cyanines that differ in terms of the conjugation length, leading to a wider wavelength range than that accessible with Spinach.10 The DIR2s aptamer described in this paper also exhibits promiscuity. Although it was selected for binding to DIR, the same aptamer also binds to members of the OTB class of fluorogens, which differ in terms of both the heterocycles and methine bridge length. The origin of this promiscuity is unclear, as seemingly subtle structural changes, such as changing from propyl sulfonate to hexanoate in the OTB-T series, significantly diminish fluorogen activation (Figure 3). The synthesis of additional dyes and the determination of a high-resolution structure for the dye-aptamer complexes are needed to better understand this system. The promiscuity of the DIR2s aptamer allows access to both red and blue emission from the same aptamer, depending on which fluorogen is used. Both the red and blue versions of the fluoromodule exhibit nanomolar affinity, moderate quantum yields, and good photostability. Affinity maturation of DIR2sapt could lead to tighter binding, although enhanced brightness would not necessarily follow. Nevertheless, in a separate publication, we have identified single-chain variable fragment (scFv) proteins that bind and activate OTB-SO3 with quantum yields of ca. 100%,17 so it is certainly possible that brighter aptamers could be obtained. Using a screening method that selects for fluorescence intensity32−34 as opposed to the simple affinity selection that led to DIR2s-apt would increase the chances of finding aptamers that generate brighter fluorescence. Also, scFv proteins have been identified that bind and activate a broader range of cyanine fluorogens than the aptamer reporter 9007

DOI: 10.1021/jacs.7b04211 J. Am. Chem. Soc. 2017, 139, 9001−9009

Article

Journal of the American Chemical Society

°C and allowed to slowly cool to RT. The process was repeated two more times, and RNAs were precipitated with isopropanol/glycogen. The progression of the selection was monitored by the ability of each RNA pool to cause an increase of DIR fluorescence. For this, the fluorescence intensity of a 200 nM DIR solution in SELEX buffer or 200 nM RNA pool was measured, then the ratio of DIR fluorescence in the presence versus absence of RNA was calculated to determine the fold activation. After the reverse transcription, the cDNA was used as template for the next round PCR. cDNAs from the cycle 14 were cloned into the pCR2.1 plasmid and sequenced by Genewiz with the M13R universal sequencing primer. RNA Aptamer Generation. Double-stranded DNA(dsDNA) templates were prepared by extension reaction of primers and amplified by PCR. RNA aptamers were synthesized by in vitro transcription of dsDNA templates by T7-flash kit (Epicenter Biotechnologies). After treatment with DNase I (New England Biolabs), RNAs were purified by denaturing PAGE. Elution from the gel was performed using 0.3 M NaOAc (pH 5.0) followed by ethanol precipitation. Aptamer sequences are given in Table S1 (Supporting Information). Dissociation Constant (KD) Measurement. KD for the RNAfluorophore complexes were determined by measuring the increase in fluorescence as a function of increasing fluorophore concentration in the presence of a fixed concentration of DIR2s aptamer or a fixed concentration of the dye. For each concentration of fluorophore measured, a background signal for fluorophore alone was also measured and subtracted from the signal measured for RNA and fluorophore together. Curves were determined using a nonlinear regression analysis in Prism software and matched by least-squares fitting to a standard dose−response model for 1:1 complexation. Quantum Yield Measurement. Quantum yields (Φf) were determined by comparing the integral of the corrected emission spectra for each RNA-fluorophore complex with the corresponding integral obtained from a solution of the same concentration of lucifer yellow (Φf = 0.21) and Cy5.29 (Φf = 0.30). Integrals at various concentrations were then plotted against the absorbance obtained at the wavelength corresponding to the excitation wavelength, and the slope of the curve was compared to the slope of the curves found for reference fluorophores. All measurements for RNA-fluorophore complexes were taken in the presence of excess RNA to avoid interference from unbound fluorophores. Photobleaching Curves. RNA aptamers were incubated with fluorophores in the dark for 1 h, and the fluorescence of RNAfluorophore complex was captured every 10 s by excitation with a Tecan spectrophotometer at the indicated wavelengths. Total fluorescence was then plotted against exposure time and normalized to the maximum intensity of each fluorophore. Live-Cell Imaging. A431, A549, and HEK 293 cells were cultured in DMEM medium containing 10% FBS. The cells were incubated with indicated concentrations of RNAs and dyes on ice or at 37 °C. The images were recorded on a Carl Zeiss LSM-510 Meta/UV DuoScan Inverted Spectral Confocal Microscope. Flow Cytometry Assays. The fluorescence intensity was determined by counting 10 000 events using a FACScan cytometer (Becton Dickinson, Franklin Lakes, NJ, USA). The experimental data were analyzed with the Flowjo 7.6.1 software (TreeStar Inc., Ashland, Oregon, USA).

access to the nucleus.) Future work will focus on synthesizing cell-permeable versions of these dyes and selecting/engineering RNA aptamers for expression in the cytoplasm. There are numerous other approaches that involve fluorogenic signaling. These include various light-up hybridization probe designs that generate fluorescent responses upon binding to complementary DNA or RNA.38−45 A recent report of a near-IR fluorogenic probe for RNA imaging is particularly noteworthy for its long wavelength excitation/emission, which should be very useful for applications in cell culture and animal models.46 Although such probes are directed to RNA targets, one could imagine extending them to protein targets by attaching the corresponding reactive groups to different components of a split aptamer, wherein target recognition drives aptamer assembly and the dye-generating click reaction.47 In conclusion, the results presented above demonstrate the selection, characterization, and application of a new RNA fluoromodule that allows either red or blue fluorescent labeling. It remains to be seen whether this fluoromodule will be useful for intracellular imaging, in which RNA folding and dye delivery will need to be optimized. However, advances in intracellular aptamer selection and the development of cell-permeable cyanine dyes make this goal approachable. The ability to tune the spectral properties of cyanines over a broad range as shown here, as well as to tune more subtly through the judicious incorporation of substituents onto the heterocycles should provide great versatility in development of additional RNA fluoromodules.

■

EXPERIMENTAL SECTION

Materials. All DNA oligonucleotides except the initial DNA library were purchased from Integrated DNA Technologies, Inc. (www. idtdna.com) as lyophilized powders and were dissolved in nanopure water upon receipt. The initial DNA library was purchased from The Midland Certified Reagent Company Inc., Midland, Texas. Taq DNA polymerase, dNTPs, and the plasmid preparation kit were purchased from Genscript. T7 RNA polymerase, DNase I, and M-MulV reverse transcriptase were purchased from New England Biolabs. rNTPs were purchased from Promega. Phenol/chloroform/isoamyl alcohol (24:25:1) and the streptavidin-coated beads were purchased from Sigma. RNaseOUT and the TA-cloning kit were purchased from Invitrogen. Plastic columns were purchased from BioRad. DNA sequencing was performed by Genewiz (www.genewiz.com). All chemicals were purchased from Sigma unless mentioned otherwise. Synthesis of fluorogenic cyanine dyes was described elsewhere.9,17,48 Aptamer Selection. The sequence of the randomized DNA pool was ACGATGTGCTTGACCGTCAC-N40-CTGCCGAAGCAG-N12GCAATCTGTCCGATGTTCCC; the forward primer was ACGATGTGCTTGACCGTCAC; the reverse primer was ATGTAATACGACTCACTATAGGGAACATCGGACAGATTGC. The original DNA pool (1 nmol) was PCR-amplified on a Thermo Electron thermocycler using the following protocol: 30 s at 94 °C, 30 s at 50 °C, 1 min at 72 °C, repeat 14 times, followed by 5 min at 72 °C. The subsequent DNA pools were amplified using the following protocol: 30 s at 95 °C, 30 s at 54 °C, 40 s at 72 °C, repeat 25 times. The in vitro transcription reactions were quenched by adding DNase I, then the RNA pool was extracted twice with phenol/chloroform/isoamyl alcohol (24:25:1), ethanol precipitated, purified on 8% polyacrylamide gels, and dissolved in SELEX buffer (50 mM KCl, 150 mM Tris-HC1, pH 7.5, 5 mM MgCl2). After annealing, the RNA pool was incubated with the selection column (biotinylated DIR/streptavidin-coated agarose beads). The negative selection column contained no biotinylated DIR. The details of all SELEX cycles are listed in Table S2. To elute the RNA, the column was washed by the SELEX buffer, and incubated with 160 μM DIR. The column was heated to 75−80

■

ASSOCIATED CONTENT

S Supporting Information *

The Supporting Information is available free of charge on the ACS Publications website at DOI: 10.1021/jacs.7b04211. UV−vis spectra, binding titrations, RNA secondarystructure predictions, RNA sequences, fluorescence from bifunctional aptamers, and in vitro selection details (PDF) 9008

DOI: 10.1021/jacs.7b04211 J. Am. Chem. Soc. 2017, 139, 9001−9009

Article

Journal of the American Chemical Society

■

Lukyanov, S.; Gadella, T. W. J.; Chudakov, D. M. Nat. Methods 2007, 4, 555−557. (23) Subach, O. M.; Gundorov, I. S.; Yoshimura, M.; Subach, F. V.; Zhang, J.; Grüenwald, D.; Souslova, E. A.; Chudakov, D. M.; Verkhusha, V. V. Chem. Biol. 2008, 15, 1116−1124. (24) Burova, E.; Vassilenko, K.; Dorosh, V.; Gonchar, I.; Nikolsky, N. FEBS Lett. 2007, 581, 1475−1480. (25) Chalfie, M.; Tu, Y.; Euskirchen, G.; Ward, W. W.; Prasher, D. C. Science 1994, 263, 802−805. (26) Miyawaki, A.; Llopis, J.; Heim, R.; McCaffery, J. M.; Adams, J. A.; Ikura, M.; Tsien, R. Y. Nature 1997, 388, 882−887. (27) Juillerat, A.; Gronemeyer, T.; Keppler, A.; Gendreizig, S.; Pick, H.; Vogel, H.; Johnsson, K. Chem. Biol. 2003, 10, 313−317. (28) Keppler, A.; Pick, H.; Arrivoli, C.; Vogel, H.; Johnsson, K. Proc. Natl. Acad. Sci. U. S. A. 2004, 101, 9955−9959. (29) Griffin, B. A.; Adams, S. R.; Tsien, R. Y. Science 1998, 281, 269− 272. (30) Sparano, B. A.; Koide, K. J. Am. Chem. Soc. 2005, 127, 14954− 14955. (31) Ilgu, M.; Ray, J.; Bendickson, L.; Wang, T.; Geraskin, I. M.; Kraus, G. A.; Nilsen-Hamilton, M. Methods 2016, 98, 26−33. (32) Wang, J.; Gong, Q.; Maheshwari, N.; Eisenstein, M.; Arcila, M. L.; Kosik, K. S.; Soh, H. T. Angew. Chem., Int. Ed. 2014, 53, 4796− 4801. (33) Fraser, L. A.; Kinghorn, A. B.; Tang, M. S. L.; Cheung, Y.-W.; Lim, B.; Liang, S.; Dirkzwager, R. M.; Tanner, J. A. Molecules 2015, 20, 21298−21312. (34) Wiesmayr, A.; Jäschke, A. Bioorg. Med. Chem. 2011, 19, 1041− 1047. (35) Fisher, G. W.; Fuhrman, M. H.; Adler, S. A.; Szent-Gyorgyi, C.; Waggoner, A. S.; Jarvik, J. W. J. Biomol. Screening 2014, 19, 1220− 1226. (36) Baker, M. Nature 2015, 521, 274−276. (37) Bradbury, A.; Plückthun, A. Nature 2015, 518, 27−29. (38) Hovelmann, F.; Gaspar, I.; Loibl, S.; Ermilov, E. A.; Roder, B.; Wengel, J.; Ephrussi, A.; Seitz, O. Angew. Chem., Int. Ed. 2014, 53, 11370−11375. (39) Kummer, S.; Knoll, A.; Socher, E.; Bethge, L.; Herrmann, A.; Seitz, O. Angew. Chem., Int. Ed. 2011, 50, 1931−1934. (40) Oomoto, I.; Suzuki-Hirano, A.; Umeshima, H.; Han, Y.-W.; Yanagisawa, H.; Carlton, P.; Harada, Y.; Kengaku, M.; Okamoto, A.; Shimogori, T.; Wang, D. O. Nucleic Acids Res. 2015, 43, e126−e126. (41) Kleinbaum, D. J.; Miller, G. P.; Kool, E. T. Bioconjugate Chem. 2010, 21, 1115−1120. (42) Robertson, K. L.; Yu, L.; Armitage, B. A.; Lopez, A. J.; Peteanu, L. A. Biochemistry 2006, 45, 6066−6074. (43) Tyagi, S. Nat. Methods 2009, 6, 331−338. (44) Tyagi, S.; Kramer, F. R. Nat. Biotechnol. 1996, 14, 303−308. (45) Svanvik, N.; Westman, G.; Wang, D.; Kubista, M. Anal. Biochem. 2000, 281, 26−35. (46) Wu, H.; Alexander, S. C.; Jin, S.; Devaraj, N. K. J. Am. Chem. Soc. 2016, 138, 11429−11432. (47) Sharma, A. K.; Heemstra, J. M. J. Am. Chem. Soc. 2011, 133, 12426−12429. (48) Shank, N. I.; Zanotti, K. J.; Lanni, F.; Berget, P. B.; Armitage, B. A. J. Am. Chem. Soc. 2009, 131, 12960−12969.

AUTHOR INFORMATION

Corresponding Author

*[email protected] ORCID

Bruce A. Armitage: 0000-0003-0109-1461 Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS This work was supported by the National Institutes of Health (Grant U54GM103529) and the David Scaife Family Charitable Foundation (Award 141RA01).

■

REFERENCES

(1) Chalfie, M.; Tu, Y.; Euskirchen, G.; Ward, W. W.; Prasher, D. C. Science 1994, 263, 802−805. (2) Tsien, R. Y. Annu. Rev. Biochem. 1998, 67, 509−544. (3) Adams, S. R.; Campbell, R. E.; Gross, L. A.; Martin, B. R.; Walkup, G. K.; Yao, Y.; Llopis, J.; Tsien, R. Y. J. Am. Chem. Soc. 2002, 124, 6063−6076. (4) Keppler, A.; Gendreizig, S.; Gronemeyer, T.; Pick, H.; Vogel, H.; Johnsson, K. Nat. Biotechnol. 2002, 21, 86−89. (5) Los, G. V.; Encell, L. P.; McDougall, M. G.; Hartzell, D. D.; Karassina, N.; Zimprich, C.; Wood, M. G.; Learish, R.; Ohana, R. F.; Urh, M.; Simpson, D.; Mendez, J.; Zimmerman, K.; Otto, P.; Vidugiris, G.; Zhu, J.; Darzins, A.; Klaubert, D. H.; Bulleit, R. F.; Wood, K. V. ACS Chem. Biol. 2008, 3, 373−382. (6) Miller, L. W.; Cai, Y.; Sheetz, M. P.; Cornish, V. W. Nat. Methods 2005, 2, 255−257. (7) Szent-Gyorgyi, C.; Schmidt, B. F.; Creeger, Y.; Fisher, G. W.; Zakel, K. L.; Adler, S.; Fitzpatrick, J. A.; Woolford, C. A.; Yan, Q.; Vasilev, K. V.; Berget, P. B.; Bruchez, M. P.; Jarvik, J. W.; Waggoner, A. Nat. Biotechnol. 2008, 26, 235−240. (8) Babendure, J. R.; Adams, S. R.; Tsien, R. Y. J. Am. Chem. Soc. 2003, 125, 14716−14717. (9) Constantin, T.; Silva, G. L.; Robertson, K. L.; Hamilton, T. P.; Fague, K. M.; Waggoner, A. S.; Armitage, B. A. Org. Lett. 2008, 10, 1561−1564. (10) Dolgosheina, E. V.; Jeng, S. C. Y.; Panchapakesan, S. S. S.; Cojocaru, R.; Chen, P. S. K.; Wilson, P. D.; Hawkins, N.; Wiggins, P. A.; Unrau, P. J. ACS Chem. Biol. 2014, 9, 2412−2420. (11) Sando, S.; Narita, A.; Hayami, M.; Aoyama, Y. Chem. Commun. 2008, 3858−3860. (12) Paige, J. S.; Wu, K. Y.; Jaffrey, S. R. Science 2011, 333, 642−646. (13) Filonov, G. S.; Moon, J. D.; Svensen, N.; Jaffrey, S. R. J. Am. Chem. Soc. 2014, 136, 16299−16308. (14) Song, W.; Strack, R. L.; Svensen, N.; Jaffrey, S. R. J. Am. Chem. Soc. 2014, 136, 1198−1201. (15) Strack, R. L.; Disney, M. D.; Jaffrey, S. R. Nat. Methods 2013, 10, 1219−1224. (16) Ö zhalici-Ü nal, H.; Lee Pow, C.; Marks, S. A.; Jesper, L. D.; Silva, G. L.; Shank, N. I.; Jones, E. W.; Burnette, J. M., III; Berget, P. B.; Armitage, B. A. J. Am. Chem. Soc. 2008, 130, 12620−12621. (17) Zanotti, K. J.; Silva, G. L.; Creeger, Y.; Robertson, K. L.; Waggoner, A. S.; Berget, P. B.; Armitage, B. A. Org. Biomol. Chem. 2011, 9, 1012−1020. (18) Yarmoluk, S. M.; Lukashov, S. S.; Ogul’chansky, T. Y.; Losytskyy, M. Y.; Kornyushyna, O. S. Biopolymers 2001, 62, 219−227. (19) Li, N.; Larson, T.; Nguyen, H. H.; Sokolov, K. V.; Ellington, A. D. Chem. Commun. 2010, 46, 392−394. (20) Davis, J. H.; Szostak, J. W. Proc. Natl. Acad. Sci. U. S. A. 2002, 99, 11616−11622. (21) Grate, D.; Wilson, C. Proc. Natl. Acad. Sci. U. S. A. 1999, 96, 6131−6136. (22) Merzlyak, E. M.; Goedhart, J.; Shcherbo, D.; Bulina, M. E.; Shcheglov, A. S.; Fradkov, A. F.; Gaintzeva, A.; Lukyanov, K. A.; 9009

DOI: 10.1021/jacs.7b04211 J. Am. Chem. Soc. 2017, 139, 9001−9009