Fluorophore-dependent cleavage of disulfide bond leading to a highly

Subscriber access provided by UNIV OF SOUTHERN INDIANA

Article

Fluorophore-dependent cleavage of disulfide bond leading to a highly selective fluorescent probe of thioredoxin Huiyi Jia, Guodong Hu, Danfeng Shi, Lu Gan, Hong Zhang, Xiaojun Yao, and Jianguo Fang Anal. Chem., Just Accepted Manuscript • DOI: 10.1021/acs.analchem.9b01779 • Publication Date (Web): 10 Jun 2019 Downloaded from http://pubs.acs.org on June 10, 2019

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 9 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Analytical Chemistry

Fluorophore-dependent cleavage of disulfide bond leading to a highly selective fluorescent probe of thioredoxin Huiyi Jia‡a, Guodong Hu‡a, Danfeng Shia, Lu Ganb, Hong Zhangb, Xiaojun Yaoa, and Jianguo Fanga* a

State Key Laboratory of Applied Organic Chemistry, College of Chemistry and Chemical Engineering, Lanzhou University, Lanzhou, Gansu 730000, China. b Department of Heavy Ion Radiation Medicine, Institute of Modern Physics, Chinese Academy of Sciences, Lanzhou, Gansu 730000, China. * Corresponding author, Email: [email protected]

ABSTRACT: Finding specific small molecule probes of a biological target is extremely desired but remains a big challenge. We reported herein a highly selective fluorescent probe, NBL-SS, for thioredoxin (Trx), a ubiquitous redox-regulating protein essentially involved in cell growth, differentiation and death. Besides, NBL-SS displayed multiple favorable properties, such as red emission, fast response and high fluorescence signal, which enabled the probe to readily image Trx functions in live cells and in vivo. The fluorophore-dependent selectivity indicates that manipulation of weak interactions between probes and their target biomacromolecules could further improve the probes’ specificity. In addition, our discovery, i.e., the preference reduction of simple disulfide bonds by Trx over glutathione, also advances the development of disulfide cleavage-based probes, prodrugs and theranostic agents.

The favorable properties of fluorescent dyes, such as good biocompatibility, high sensitivity and super spatiotemporal resolution, have enabled them to be indispensable tools in biomedical research.1-6 However, finding a specific probe of a target is highly challenging, but is critical for drawing convincing conclusions from experimental observations. Probes with poor quality might give ambiguous or even misleading results.7,8 Thioredoxin (Trx) is a ubiquitous redox protein that harbors a conserved -Cys-X-X-Cys- sequence in its active site, and a major player in maintaining cellular redox homeostasis and regulating diverse redox signaling pathways. 9,10 Dysregulation of Trx functions has been demonstrated to link to multiple pathological conditions, such as cancer, neurodegeneration and cardiovascular diseases.11-14 The widely-accepted and classic Trx assay is based on the reduction of insulin disulfides by Trx with the presence of excessive thioredoxin reductase (TrxR) and NADPH.15 This method could detect the activity of purified Trx protein or the protein in crude tissue extract, but cannot be applied in live cells or in vivo. Most recently, analysis of Trx functions by NMR technique and protein fusion strategy was reported.16,17 These approaches require either the isotope-labelled Trx or the genetically encoded fluorescent fusion protein, and are not suitable for study of endogenous Trx. Two green-emitting small molecule fluorescent probes targeting the mitochondrial Trx (Mito-Trx) and membranebound Trx (Memb-Trx) have been disclosed by Kim and coworkers.18,19 Both probes are organelle-specific, and provided valuable tools for Trx study. However, a general probe for cytosolic Trx, the predominant form of Trx isoforms, has not been reported. As our continued interest in developing chemical tools for biological redox species,20-25 we reported herein a red-emitting probe, NBL-SS, for selectively imaging Trx in

live cells and in vivo. NBL-SS displayed multiple improved properties, and the comparison of NBL-SS with the reported two organelle-specific Trx probes was summarized in Table 1. Table 1. Comparison of NBL-SS with previous Trx probes. Probes

NBL-SS

Mito-Trx

Memb-Trx

610/661

428/540

438/540

9160

5120

-

>30

~14

~10

~20

~30

~30

Working pH

6.5-9.5

-

-

Applications

Live cells, in vivo

Live cells

Live cells

ex/em (nm) Selectivity F/F0

a

b

Time (min)

c

a

Selectivity was calculated by comparing the second-order rate constants of probes reacting with Trx and glutathione (GSH). b Folds of fluorescence increase after probes reacting with Trx. c Response time of probes toward Trx.

EXPERIMENTAL SECTION Materials and Instruments. The detailed sources of all materials used in this study were given in the Supporting Information (SI). Absorption spectra were recorded on UV−vis spectrometer evolution 200 (Thermo Scientific). Fluorescence studies were carried out using a Cary Eclipse Fluorescence Spectrophotometer (Agilent Technologies), and the slit width

1 ACS Paragon Plus Environment

Analytical Chemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

was 5 nm for both excitation and emission. The absolute quantum yields (ϕ) of NBL-SS with and without Trx were determined on FLS920 spectrometer (Edinburgh Instruments, U.K.) with λex = 610 nm. 1H and 13C NMR spectra were recorded on Bruker Advance 400, and tetramethylsilane (TMS) was used as a reference. MS spectra were recorded on Shimadzu LCMS-2020 system. HRMS was obtained on Orbitrap Elite (Thermo Scientific). The fluorescence images of cells were acquired on a Floid cell imaging station (life technology) or an inverted fluorescent microscopy (Leica DMI4000). The relative intracellular fluorescence intensity (RFI) from the fluorescent images was quantified by ImageJ. The fluorescence images of zebrafish were taken with a fluorescence microscope (Olympus BX51, Japan). Analysis of the intracellular fluorescence intensity was performed on a flow cytometry (FACSCantoTM, BD Biosciences). HPLC analysis was performed on Shimadzu LCMS-2020 system with a Wondasil C18 Superb reversed-phase column (5 μm, 4.6 × 150 mm) equipped with a photodiode array (PDA) detector. The test compounds were dissolved in DMSO, which was no more than 1% (v/v) in the in vitro assays, and no more than 0.1% (v/v) in the cell experiments. All procedures for in vivo experiments were carried out in accordance with the institutional guidelines (Guidance of the Care and Use of Laboratory Animals) and were approved by the Ethics Committee of Lanzhou University, China. Preparation of Recombinant Thioredoxin. The pET-28ahuman Trx1 plasmid was used as a template to construct mutant Trx plasmids by a site-directed mutagenesis procedure via extension of overlapping gene segments by PCR. The following primers were used as mutagenic primers (C32S, 5'GACTTCTCAGCCACGTGGTCTGGGCCTTGCAAAATGA TC-3', 5'GATCATTTTGCAAGGCCCAGACCACGTGGCTGAGAA GTC-3'; C35S, 5'GCCACGTGGTGTGGGCCTTCCAAAATGATCAAGCCTT TC-3', 5'GAAAGGCTTGATCATTTTGGAAGGCCCACACCACGT GGC-3'; C32S/C35S, 5'GACTTCTCAGCCACGTGGTCTGGGCCTTCCAAAATGA TCAAGCCTTTC-3', 5'GAAAGGCTTGATCATTTTGGAAGGCCCAGACCACGT GGCTGAGAAGTC-3') and flanking primers (5'GTGCCGCGCGGCAGCCATATGGTGAAGCAGATCGAG AGCAAGACTG-3', 5'CAGTGGTGGTGGTGGTGGTGCTCGAGTTAGACTAATT CATTAATGGTG-3') to generate mutant human Trx1 plasmids. NdeI and XhoI sites were introduced at the 5' and 3' ends. Final product was inserted into NdeI- and XhoI-digested pET28a vector to generate larger quantities of DNA. The pET-28aC32S Human-Trx, pET-28a-C35S Human-Trx and pET-28aC32S/C35S Human-Trx plasmids were transformed into Escherichia coli Rosetta cells using the heat shock method. And the recombinant Trx was expressed as fusion proteins containing six histidine residues and was induced in logarithmic cultures of Escherichia coli by the addition of 1.5 mM iso-propyl β-thiogalactopyranoside (IPTG). After 8 h, bacteria were centrifuged and lysed by sonication under nondenaturing conditions. Thioredoxin was purified by using a Ni-NTA (PrePacked Gravity Column). The purified protein fraction was reduced by DTT (100 mM) at room temperature in TE buffer

Page 2 of 9

(50 mM Tris-HCl, 1 mM EDTA, pH = 7.4) for 30 min, then removed a large amount of DTT with a column of Sephadex G-25 to obtained the stock solution of reduced Trx. Synthesis of NBL-SS. The compound HEDS (1 mmol, 154 mg) was dissolved in anhydrous dichloromethane (DCM, 10 mL), and N, N-diisopropylethylamine (DIPEA, 0.6 mmol, 776 mg) was added. Then the solution of triphosgene (0.4 mmol, 119 mg) in anhydrous DCM (5 mL) was added dropwise to the above mixture. The resulting mixture was stirred at room temperature for 2 h and then refluxed for 3 h. After cooling to room temperature, the solvent was removed under reduced pressure. The reaction mixture was dissolved in anhydrous DCM (5 mL) and added dropwise to the solution of compound 1 (nile blue derivative, NBL) (The synthesis of compound 1 was given in SI) (0.28 mmol, 150 mg) and triethylamine (TEA, 1.3 mmol, 0.18 mL) in anhydrous DCM/tetrahydrofuran (20 mL, v/v = 1:1) at 0 oC. After stirring overnight at room temperature, the solvent was evaporated and the resulting residue was purified by silica gel chromatography (methanol/dichloromethane: 1/100) to afford NBL-SS as a dark-red solid (62 mg, 31%). 1H NMR (400 MHz, CDCl3) δ: 8.65 (d, J = 8.0 Hz, 1H), 8.47 (d, J = 8.0 Hz, 1H), 7.70 (t, J = 7.2 Hz, 1H), 7.65-7.61 (m, 2H), 6.71 (s, 1H), 6.69 (d, J = 2.8 Hz, 1H), 6.67 (d, J = 2.4 Hz, 1H), 6.49 (d, J = 2.4 Hz), 4.58 (t, J = 6.8 Hz, 2H), 3.93 (t, J = 5.6 Hz, 2H), 3.79 (t, J = 7.2 Hz, 4H), 3.72 (s, 6H), 3.11 (t, J = 6.8 Hz, 2H), 2.95 (t, J = 5.8 Hz, 2H), 2.68 (t, J = 7.4 Hz, 4H), 2.27 (s, 1H). 13C NMR (100 MHz, CDCl3) δ: 171.85, 163.71, 161.57, 149.68, 149.32, 146.28, 141.53, 131.57, 131.30, 131.09, 130.99, 130.23, 125.85, 125.51, 124.02, 109.91, 100.51, 97.25, 64.23, 60.28, 52.03, 46.96, 41.76, 37.46, 32.13. ESI-MS (m/z): [M]+ 614.15. HRMS (ESI) calculated for [C29H32N3O8S2]+ [M]+ requires m/z = 614.1625, found 614.1621. The syntheses of other probes were given in SI. Reduction of disulfide compounds by Trx and GSH. Different disulfides (100 μM each) were incubated with NADPH (200 μM)/TrxR (50 nM) or NADPH (200 μM)/GR (0.5 U/mL) in TE buffer (50 mM Tris-HCl, 1 mM EDTA, pH 7.5) at 37 oC for 5 min, and then Trx (10 μM) or GSH (1 mM) was added to the above reaction systems. The decrease of absorbance at 340 nm, due to the conversion of NADPH to NADP+, was recorded. Response of probes to Trx and GSH. Probes (5 μM each) were incubated with reduced Trx (10 μM) or GSH (1 mM) in TE buffer at 37 oC. The emission intensities were measured every 5 min for 60 min, respectively. The folds of fluorescence increase (F/F0) were normalized to the base fluorescence intensity of probes. The reduced Trx was prepared by incubating the protein with dithiothreitol (DTT, 100 mM) at room temperature in TE buffer for 30 min. The excess DTT was removed by a Sephadex G-25 desalting column. Spectral response of NBL-SS to Trx. The time-dependent absorbance and fluorescence spectra (λex = 610 nm) were acquired as the following procedures. NBL-SS (5 μM) was incubated with the reduced Trx (10 μM) in TE buffer at 37 oC. The absorbance and emission spectra were scanned every 2 min for 30 min. To acquire the emission spectra of NBL-SS towards different concentrations of Trx, NBL-SS (5 μM) was incubated with increasing concentrations of Trx in TE buffer at 37 oC.


Page 3 of 9 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Analytical Chemistry pH-Dependent fluorescence response of NBL-SS to Trx. The fold of fluorescence increase at 661 nm excited at 610 nm was determined after mixing NBL-SS (5 μM) with the reduced Trx (10 μM) at 37 oC for 30 min in different buffers (pH 3.09.5). Selective recognition of NBL-SS by Trx. The fold of fluorescence increase at 661 nm excited at 610 nm was determined after mixing NBL-SS (5 μM) with various analytes (Trx, GSH, Cys, Hcy, Sec, TrxR and DTT) for 5 min in TE buffer at 37 oC. In addition, the response of NBL-SS with Trx and other putative nonthiol species was studied (Figure S9). NBL-SS (5 μM) was mixed with 1 mM of metal ions, 5.0 mM of H 2O2 and nonthiol amino acids, and 10 μM of reduced Trx. All fluorescence changes were acquired after incubating NBL-SS with different species for 30 min in TE buffer at 37 oC. Response of NBL-SS to Trx mutants. The reactivity of NBL-SS (5 μM) with different Trx proteins (10 μM), i.e., wild Trx (H-Trx1) and mutant Trx proteins, i.e., Cys32→Ser32 mutant Trx (H-Trx1, C32S), Cys35→Ser35 mutant Trx (HTrx1, C35S), and Cys32→Ser32/Cys35→Ser35 mutant Trx (H-Trx1, C32S/C35S), were explored. The emission spectra (λex = 610 nm) were recorded after incubating the probe with proteins in the presence of 0.5 mM DTT in TE buffer for 5 min at 37 oC. Imaging Trx in live HeLa cells. HeLa cells were cultured in DMEM supplemented with 10% FBS, 2 mM glutamine, and 100 units/mL pencillin/streptomycin and maintained in atmosphere of 5% CO2 at 37 oC. The cells were seeded in 12-well plates at 2 × 104 cells per well in 1 mL growth medium and incubated for 24 h at 37 oC, and then the cells were incubated with NBL-SS (5 µM) for 0-30 min at 37 oC. After washing the cells with PBS twice to remove the remaining NBL-SS, the fluorescence images were acquired with a Floid cell imaging station (Life Technology). Inhibition the cellular Trx by PX-12. HeLa cells were seeded in 12-well plates at 2×104 cells per well in 1 mL growth medium and incubated for 24 h at 37 oC. To inhibit the cellular Trx, the cells were exposed to PX-12 (10 µM) for 1h and then the cells were washed with PBS twice, and then 1 mL growth medium was added. The cells were further treated with NBLSS (5 µM) for 5 min at 37 oC. The cells were rinsed with PBS twice to remove the remaining NBL-SS, and the fluorescence images were acquired with a Floid cell imaging station (Life Technology). Imaging Trx in living 6-day-old Zebrafish larvae. Zebrafish maintenance and embryo collection were performed according to standard operating procedures as described. Briefly, The 6day-old zebrafish larvae were incubated with PX-12 (20 µM) in E3 culture medium for 1h, and washed three times with E3, and further incubated with NBL-SS (10 µM) in E3 culture medium for 30 min at 28 °C, After that, the larvae were washed three times with E3 and anaesthetized using 0.01% MS 222 (Sigma, USA). The fluorescence images were taken with a fluorescence microscope at × 60 magnification. Knockdown of Trx1 Expression using Short Hairpin RNAs. We used one shRNA plasmid (shTrx-A set of 250) specifically targeting human Trx1 gene and one shRNA with scrambled sequence (SJNC) as a control for Trx1 knockdown experiments. HeLa cells were seeded in 6-wells plates at 3×105 cells

per well in 2 mL growth medium and incubated overnight at 37 oC. When the cell density reached 60% - 80% confluence, we conducted transfection with different shRNA plasmids using GP-Transfect-Mate reagent according to the manufacturer's instruction. After 4-6 h of transfection, the cells were maintained in DMEM supplemented with 10% FBS, 2 mM glutamine, and 100 units/mL pencillin/streptomycin and maintained in atmosphere of 5% CO2 at 37 oC. After 48 h of transfection, knockdown of the Trx1 expression in the cells was analyzed by Western blotting. Imaging Trx in Trx1-Knowndown HeLa cells. After 48 h of transfection, the cells were seeded in 24-well plates at 1×104 per wells in 500 µL growth medium and incubated for 24 h at 37 oC, and then the cells were treated with NBL-SS (5 µM) for 5 min at 37 oC. The cells were washed with PBS twice, and the fluorescence images were acquired with an inverted fluorescent microscopy (Leica DMI4000) and the relative fluorescence intensity (RFI) in cells was quantified by the software of ImageJ. Quantification of intracellular fluorescence intensity by flow cytometry. After 48 h of transfection, the cells were seeded in 6-well plates at 5×104 per well in 2 mL growth medium. After incubated for 24 h at 37 oC, the cells were washed three times with PBS and then digested with trypsin. The cells were collected in sterile Eppendorf tubes and centrifuged. The cells were washed with PBS and then incubated with NBL-SS (5 µM) in PBS buffer (containing 0.1 mg/mL glucose) for 5 min at 37 oC. Next, we measured the fluorescence intensity by using a flow cytometry equipped with a 633 nm Helium-neon laser and a 660/20 nm band pass filter and interfaced to System II software (Beckman Coulter). And 1×104 events were counted in each sample. All experiments were tested in quadruplicates. Covalent molecular docking simulation. Covalent molecular docking was performed to study the interaction between four probe molecules and Trx in Schrödinger software (Schrödinger, LLC, New York, NY, 2015). Probe molecules were prepared and optimized in the LigPrep module. The 3D structure of Trx was derived from the PDB database (PDB accession number: 1AIU) and prepared with the Protein Preparation Wizard using OPLS-2005 force field. During the molecular docking process, the putative binding pocket on Trx surface was predicted and the centroid of four residues (Trp31 ， Asn60，Gln63，Lys72) in the vicinity of Cys32 was defined as the binding site and the sulfhydryl group on the Cys32 was defined as the covalent reactive group. The binding poses of the four probes were selected by docking score and the conformational stability was evaluated by the MM-GBSA binding free energy (Figure S11).

RESULTS AND DISCUSSION Reduction of small molecule disulfides by Trx and GSH. The thioredoxin system and the glutathione system are two major disulfide-reducing systems in cells.26,27 We first examined the reduction of small molecule disulfides by Trx and GSH. Five disulfides with varying terminal groups (Figure 1A), i.e., bis-(2-hydroxyethyl) disulfide (HEDS), bis-(2aminoethyl) disulfide (AEDS), bis-(2-carboxyethyl) disulfide (CEDS), bis-propyl disulfide (PDS) and cystine, were chosen for this study. As shown in Figures 1B & 1C, both cystine and



AEDS were good substrates of Trx and GSH, while neither Trx nor GSH could reduce CEDS and PDS. Interestingly, HEDS was reduced by Trx, but appeared a poor substrate of GSH. These results motivated us to further connect various fluorophores, including aminomethylcoumarin (AMC), aminotrifluoromethylcoumarin (AFC), aminonaphthalimide (ANA) and nile blue (NBL) to HEDS to prepare a series molecules (Figure 2A, Scheme S1 & Figures S13-S25) with an aim to find selective Trx probes.

Page 4 of 9

termined the reaction rate constants of the probes with Trx and GSH, and the second-order rate constants were summarized in Table 2. The details of the calculation were shown in Figures S1-S8 and Tables S1-S8. In general, reaction of the probes with Trx was much faster than that with GSH. The probes showed a similar reaction rate to GSH with a rate constant ranging from 0.35 to 0.74 (M s)−1. Interestingly, the probes showed a fluorophore-dependent reaction rate to Trx, and NBL-SS had the highest rate constant. We reasoned that the varying rate constants of the probes to Trx were due to the different weak interactions and the energies of the reaction intermediates, which were supported by molecular docking (vide infra). As the rate constant of NBL-SS with Trx showed more than 9000 times higher than that of NBL-SS with GSH, we thus picked up NBL-SS for the follow-up studies. Table 2. Second-Order Rate Constants for the Reaction of NBL-SS, AFC-SS, ANA-SS, AMC-SS with Trx and GSH.

Figure 1. Reduction of disulfides by Trx and GSH. Structures of disulfides were shown in (A), and their reduction by NADPH/TrxR/Trx and NADPH/GR/GSH in TE buffer (50 mM Tris-HCl, 1 mM EDTA, pH 7.4) at 37 oC were shown in (B) and (C).

Figure 2. Response of probes (5 μM) to Trx (10 μM) and GSH (1 mM). Structures of probes were shown in (A), and their fluorescence signal activation by Trx and GSH in TE buffer at 37 oC were shown in (B) and (C).

Response of probes to Trx and GSH. With these four probes in hands, we first performed a kinetic screening of the response of the probes to Trx and GSH. Among the four probes, NBL-SS showed the fastest response to both Trx and GSH (Figure 2B & 2C). In spite of the fact that GSH (1 mM) is 100 times more abundant than Trx (10 μM) in the assay, the response of NBL-SS to Trx is much faster than that to GSH. The emission intensity reached saturation within 20 min when incubating NBL-SS with Trx, while the fluorescence kept increasing when incubating the probe with GSH. Next, we de-

Probes

kTrx (× 103) a

kGSH a

kTrx/kGSH (× 103) b

NBL-SS

6.82 ± 0.45

0.74 ± 0.08

9.16

AFC-SS

1.43 ± 0.10

0.56 ± 0.10

2.53

ANA-SS

1.20 ± 0.11

0.43 ± 0.06

2.81

AMC-SS

1.01 ± 0.16

0.35 ± 0.07

2.90

a The second order rate constants were expressed as (M s)−1. b The relative ratio of the rate constants of Trx to those of GSH.

Selective activation of NBL-SS by Trx. Firstly, we examined the absorption and emission spectra of NBL-SS in response to Trx. After incubating NBL-SS (5 μM) with Trx (10 μM), the probe’s maximum absorption (530 nm) was red-shifted to 610 nm (Figure 3A), and the reaction completes within 20 min. The inset showed the time-dependent changes of absorbance at 530 nm and 610 nm. A time course of emission change of NBL-SS towards Trx was shown in Figure 3B. NBL-SS itself had little emission (quantum yield ϕ < 0.1%) excited at 610 nm. After incubation with Trx, the fluorescence intensity at 661 nm (excited at 610 nm) increased progressively, and reached saturation within 20 min (ϕ = 2.86%). The inset showed the time-dependent change of emission at 661 nm. Next, the fluorescence intensity of NBL-SS (5 μM) at varying Trx concentrations (0-20 μM) was studied (Figure 3C). The emission intensity increased as Trx concentrations increased, and the emission intensity was linear to the Trx concentrations with the range of 0-5 μM (R2 = 0.99, inset in Figure 3C). The detection limit of NBL-SS for Trx was calculated to be 49 nM with the equation of detection limit = 3σ/k. The nanomolar level detection limit of NBL-SS is much lower than the micromolar range of cellular Trx concentrations.28,29 In addition, the pH-dependent emission change of NBL-SS in response to Trx was also investigated (Figure 3D). The probe showed a steady response to Trx in a broad pH range of 6.5-9.5 (F/F0 > 30), which covers most of the biological conditions. We further studied the response of NBL-SS to various reducing species (Figure 3E). As NBL-SS had a fast reaction kinetic, we incubated the probe with analytes for 5 min. Under such conditions, all of the tested species, such as GSH, cysteine (Cys),


Page 5 of 9 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Analytical Chemistry homocysteine (Hcy), dithiothreitol (DTT), selenocysteine (Sec), TrxR and glutathione reductase (GR), gave little fluorescence signal. Other common metal ions, hydrogen peroxide and non-thiol amino acids also showed negative response to NBL-SS (Figure S9). These results indicated that NBL-SS showed high preference to be activated by Trx.

C32S/C35S were inactive to NBL-SS. The H-Trx1, C35S showed a moderate activity to activate NBL-SS, but was much less efficient than the wild type Trx. These results indicated that reduction of NBL-SS by Trx followed the similar mechanism as that of reducing protein disulfides by Trx. As NBL-SS is an asymmetric disulfide, there are two possible pathways for attacking the disulfide by Trx (Pathway 1 and Pathway 2 in Scheme S2). As the fluorescence increase triggered by wild type Trx is almost 3-fold of that triggered by H-Trx1, C35S, we thus proposed that the 3-step activation of the probe (Pathway 1) is a favorable pathway, and the probe-Trx mixed disulfide is a major intermediate. The reaction mixture of Trx and NBL-SS was further analyzed by HPLC, and the production of the NBL fluorophore was confirmed (Figure S10)

Figure 4. (A) Defining the binding pocket around the active site of Trx. (B) The binding mode of NBL-SS with Trx by covalent docking.

Figure 3. Evaluation of NBL-SS. Time-dependent absorbance (A) and emission spectra (B, λex = 610 nm) of NBL-SS (5 μM) in responding to Trx (10 μM) in TE buffer at 37 oC. The insets in (A) and (B) showed the time-dependent changes of absorbance (530 nm and 610 nm) and emission (661 nm), respectively. (C) Dose-dependent fluorescence intensity of NBL-SS (5 μM) in responding to varying concentrations of Trx (0-20 μM). The inset showed the linear response of NBLSS to Trx in a range of 0-5 μM. (D) pH-Dependent fluorescence change of NBL-SS (5 μM) in responding to Trx (10 μM). (E) Selective response of NBL-SS to Trx. NBL-SS (5 μM) was incubated with different analytes for 5 min in TE buffer at 37 oC, and the fluorescence change was recorded (λex = 610 nm, λem = 661 nm). (F) Response of NBL-SS (5 μM) to wild type Trx and Trx mutants (10 μM).

Reaction mechanism of NBL-SS with Trx. Besides a pair of Cys residues (Cys32 and Cys35) in the active site, human cytosolic Trx (H-Trx1) contains additional three Cys residues. The mechanism of Trx as a general protein disulfide reductase involves an initial nucleophilic attack of a substrate disulfide by the thiolate of Cys32 to form an unstable transient mixed disulfide between Cys32 in Trx and one of the Cys residues in a protein substrate.30 Subsequently, a nucleophilic attack of the mixed disulfide by Trx Cys35 gives the oxidized Trx and substrate thiols. To investigate the detail of reduction of NBL-SS by Trx, we compared the response of the probe to wild type Trx and three mutants of Trx, i.e., H-Trx1, C32S (Cys32→Ser mutant), H-Trx1, C35S (Cys35→Ser mutant) and H-Trx1, C32S/C35S (Cys32→Ser and Cys35→Ser double mutant). As shown in Figure 3F, both the H-Trx1, C32S and the H-Trx1,

Molecular docking. The above results from Trx mutants suggested that formation of the mixed disulfide intermediate between NBL-SS and Trx is favorable. In order to further understand the difference of response rates of four probes towards Trx, the intermediate conformation between each probe and Trx was predicted and evaluated by covalent molecular docking simulation (Figure 4 & Figure S11). The 3D structure of Trx was derived from the PDB database (PDB number: 1AIU).31 During the molecular docking process, the pocket on Trx was predicted and the centroid of four residues (Trp31, Asn60, Gln63, Lys72) in the vicinity of Cys32 was defined as the binding site and the thiol on Cys32 was defined as the covalent reactive group (Figure 4A). The four probe molecules formed mixed disulfide intermediates with the Cys32 and interacted with Trp31, Cys32, Val59, Ala66 and Lys72 at the binding pocket of Trx (Figure 4B & Figure S11). NBL-SS formed one additional hydrogen bond with the peptide backbone linking Cys73 and Met74, which further facilitated to form a strong π-π stacking between Trp31 and the aromatic system of the probe. The free energies of binding for NBL-SS, AFC-SS, ANA-SS and AMC-SS were calculated to be -45.6, -32.4, -32.6 and -33.6 kcal/mol, respectively. The reaction rates for four probes with Trx were in the order of NBL-SS > AFC-SS ~ ANA-SS ~ AMC-SS, which correlated well with their order of binding energies. These results provided a mechanistic understanding of the fluorophore-dependent reactivity of the probes with Trx, and shed light in designing novel Trx probes with improved properties. The fluorophoredependent activation of the four probes indicated that modification of probe’s structure to facilitate weak interactions between the probe and Trx could further improve the probe’s



selectivity. This could be generally applied to improve the selectivity of small molecule probes targeting biomacromolecules. Interestingly, replacement of the triphenylphosphonium moiety in the mitochondria targeting Trx probe with a glibenclamide unit shifted the preference of the probe to GSH over Trx,32 supporting our proposed strategy to develop novel probes with improved selectivity.

Page 6 of 9

cells. First, the fluorescence signal was directly observed under a fluorescent microscope (Figure 6B). Both the HeLa and HeLa-shNT cells had similar fluorescence intensity, while the fluorescence signal in the HeLa-shTrx1 cells decreased remarkably. Quantification of the fluorescence intensity in individual cells was performed by ImageJ, and the relative fluorescence intensity was given at the bottom of each picture. Next, we employed flow cytometry to further confirm the difference of the fluorescence intensity in the cells (Figures 6C & 6D). The average fluorescence intensity in the HeLa and HeLa-shNT cells was almost identical, but significantly stronger than that in the HeLa-shTrx1 cells. These results were consistent with those from the direct observation of the fluorescence signal by fluorescent microscope (Figure 6B). Taken together, our results demonstrated the critical contribution of Trx in activation of the fluorescence signal of NBL-SS in cells.

Figure 5. Imaging Trx activity in live cells and in vivo. (A) Time course of fluorescence signal from NBL-SS (5 μM) in HeLa cells. (B) Suppression of fluorescence signal by Trx inhibitor, PX-12 (10 μM). The relative fluorescence intensity (RFI) in individual cells was given. (C) Imaging Trx activity in zebrafishes. Scale bars: 20 μm in (A) & (B), and 0.5 mm in (C).

Imaging of Trx activity in live cells and in vivo. In view of the multiple favorable properties of NBL-SS, such as fast response, long emission wavelength, low detection limit and high selectivity, we next performed experiments to determine whether the probe is suitable to image Trx in biological systems. Prior to the imaging experiments, we evaluated the cytotoxicity of NBL-SS by the trypan blue exclusion assay. NBLSS showed low cytotoxicity, and the cell viability was over 80% even the cells were treated with the probe at 50 µM (Figure S12). When HeLa cells were incubated with NBL-SS (5µM), a clear time-dependent increase of the fluorescence was observed (Figure 5A). The relative fluorescence intensity (RFI) in cells was quantified by the software ImageJ and was given at the bottom of each picture. The fluorescence signal appeared within 2 min, and the signal reached saturation at ~20 min. Pretreatment of the cells with PX-12, a Trx inhibitor,18,19,33,34 remarkably suppressed the fluorescence (Figure 5B), supporting a selective activation of NBL-SS by Trx. The probe was also suitable to image Trx in zebrafishes, and pretreatment of the fishes with PX-12 also inhibited the fluorescence signal (Figure 5C). Validation of specific recognition of Trx by NBL-SS. To further investigate the contribution of Trx to the activation of fluorescence of NBL-SS in cells, we constructed a Trxknockdown HeLa cell line (HeLa-shTrx1) by transfecting a shRNA plasmid specifically targeting the cytosolic Trx. A control cell line (HeLa-shNT), i.e., the cells transfected with a non-targeting plasmid, was also generated. The knockdown efficiency was confirmed by the Western blotting (Figure 6A). We then compared the fluorescence signal of NBL-SS in these

Figure 6. Evaluation of the specificity of NBL-SS in imaging Trx in live cells. (A) Efficiency of Trx knockdown in HeLa cells determined by Western blotting. (B) Direct observation of the fluorescence signal under fluorescent microscope. Scale bars: 20 μm. (C) Analysis of intracellular fluorescence signal by flow cytometry, and quantification of the histograms was shown in (D).

The reversible thiol-disulfide exchange reaction is a chemical foundation of biological redox regulation. As two principal disulfide reductases, Trx and GSH play an essential role in maintaining cellular redox homeostasis. In this work, we reported that Trx and GSH showed different reactivity to small molecule disulfides, and identified that HEDS is a selective substrate of Trx over GSH. Encouraged by this observation, we further modified HEDS to generate four potential probes of Trx. After a detailed study of the reaction kinetics between the probes and Trx/GSH, we found that reduction of the disulfide in HEDS-based probes is dependent on the fluorophore connected to HEDS, and NBL-SS displayed the highest reactivity toward Trx. However, GSH showed a similar reactivity to these probes. Molecular docking results indicated the presence of multiple favorable weak interactions between the NBL fluorophore and the binding pocket close to the Trx redox center, which further stabilized the probe-Trx mixed disulfide intermediate. This fluorophore-dependent reduction of HEDS-based probes also suggested that further modifica-


Page 7 of 9 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Analytical Chemistry tion of the probe’s structure could be an efficient strategy to construct novel probes with improved properties. Although the physiological concentration of GSH (in a range of millimolar)35 is ~1000-fold higher than that of Trx (in a range of micromolar),28,29 the reaction of NBL-SS with Trx is ~9000-fold faster than that with GSH. This may account for the observed highly selectivity of the probe to recognize Trx in live cells and in vivo. The previous two cell organelle-specific probes shared the same ANA fluorophore but contained different organelle-targeting units, and the reaction of Mito-Trx with Trx showed ~5000 times faster than that with GSH.18,19 Based on these kinetic data, the probe NBL-SS is expected to have improved selectivity. Other improved properties of NBLSS, such as longer excitation/emission wavelengths, higher fluorescence signal increase, faster response rate and broader pH fidelity, were summarized in Table 1. The HEDS scaffold has been widely applied in designing probes and controlled drug delivery system.36-42 Our discovery, i.e., the preferable reduction of the disulfide bond by Trx over GSH, also advances further development of disulfide cleavage-based probes, prodrugs and theranostic agents.

CONCLUSION In conclusion, a highly selective fluorescent probe of Trx, NBL-SS, was disclosed. The probe displayed multiple favorable properties and was readily applied to image Trx activity in live cells and in vivo. The strategy in discovering NBL-SS suggested that manipulation of weak interactions between a probes and its target biomacromolecule could be an efficient way to improve the probes’ specificity. In addition, the different preference in reducing disulfide bonds by Trx and GSH may further advance the development of novel disulfide cleavage-based probes, prodrugs and theranostic agents.

ASSOCIATED CONTENT Supporting Information Experimental materials and methods are included in the Supporting Information. 1H NMR, 13C NMR, MR spectra are included. The Supporting Information is available free of charge on the ACS Publications website.

AUTHOR INFORMATION Corresponding Author *E-mail: [email protected]

Author Contributions ‡

Jia and Hu contributed equally to this work.

Notes The authors declare no conflict of interest.

ACKNOWLEDGMENT The financial supports from the National Natural Science Foundation of China (21572093 & 21778028), Natural Science Foundation of Gansu Province (18JR4RA003) and the 111 project are greatly acknowledged.

REFERENCES

(1) Zhang, J.; Chai, X.; He, X. P.; Kim, H. J.; Yoon, J.; Tian, H. Fluorogenic probes for disease-relevant enzymes. Chem. Soc. Rev. 2019, 48, 683-722. (2) Pak, Y. L.; Park, S. J.; Wu, D.; Cheon, B.; Kim, H. M.; Bouffard, J.; Yoon, J. N-Heterocyclic Carbene Boranes as Reactive Oxygen Species-Responsive Materials: Application to the TwoPhoton Imaging of Hypochlorous Acid in Living Cells and Tissues. Angew. Chem., Int. Ed. 2018, 57, 1567-1571. (3) Chen, W.; Xu, S.; Day, J. J.; Wang, D.; Xian, M. A General Strategy for Development of Near-Infrared Fluorescent Probes for Bioimaging. Angew. Chem., Int. Ed. 2017, 56, 16611-16615. (4) Lin, V. S.; Chen, W.; Xian, M.; Chang, C. J. Chemical probes for molecular imaging and detection of hydrogen sulfide and reactive sulfur species in biological systems. Chem. Soc. Rev, 2015, 44, 45964618. (5) Xue, Z.; Zhang, E.; Liu, J.; Han, J.; Han, S. Bioorthogonal Conjugation Directed by a Sugar-Sorting Pathway for Continual Tracking of Stressed Organelles. Angew. Chem., Int. Ed. 2018, 57, 1009610101. (6) Xue, Z.; Wang, S.; Li, J.; Chen, X.; Han, J.; Han, S. Bifunctional Super-resolution Imaging Probe with Acidity-Independent Lysosome-Retention Mechanism. Anal. Chem. 2018, 90, 1139311400. (7) Blagg, J.; Workman, P. Choose and Use Your Chemical Probe Wisely to Explore Cancer Biology. Cancer cell. 2017, 32, 9-25. (8) Arrowsmith, C. H.; Audia, J. E.; Austin, C.; Baell, J.; Bennett, J.; Blagg, J.; Bountra, C.; Brennan, P. E.; Brown, P. J.; Bunnage, M. E.; Buser-Doepner, C.; Campbell, R. M.; Carter, A. J.; Cohen, P.; Copeland, R. A.; Cravatt, B.; Dahlin, J. L.; Dhanak, D.; Edwards, A. M.; Frederiksen, M.; Frye, S. V.; Gray, N.; Grimshaw, C. E.; Hepworth, D.; Howe, T.; Huber, K. V.; Jin, J.; Knapp, S.; Kotz, J. D.; Kruger, R. G.; Lowe, D.; Mader, M. M.; Marsden, B.; MuellerFahrnow, A.; Muller, S.; O'Hagan, R. C.; Overington, J. P.; Owen, D. R.; Rosenberg, S. H.; Roth, B.; Ross, R.; Schapira, M.; Schreiber, S. L.; Shoichet, B.; Sundstrom, M.; Superti-Furga, G.; Taunton, J.; Toledo-Sherman, L.; Walpole, C.; Walters, M. A.; Willson, T. M.; Workman, P.; Young, R. N.; Zuercher, W. J. The promise and peril of chemical probes. Nat. Chem. Biol. 2015, 11, 536-541. (9) Lu, J.; Holmgren, A. The thioredoxin antioxidant system. Free Radical Biol. Med. 2014, 66, 75-87. (10) Hanschmann, E. M.; Godoy, J. R.; Berndt, C.; Hudemann, C.; Lillig, C. H. The thioredoxin antioxidant system. Antioxid. Redox Signaling. 2013, 19, 1539-1605. (11) Zhang, J.; Zhang, B.; Li, X.; Han, X.; Liu, R.; Fang, J. Small molecule inhibitors of mammalian thioredoxin reductase as potential anticancer agents: An update. Med. Res. Rev. 2019, 39, 5-39. (12) Zhang, J.; Li, X.; Han, X.; Liu, R.; Fang, J. Targeting the Thioredoxin System for Cancer Therapy. Trends Pharmacol. Sci. 2017, 38, 794-808. (13) Mahmood, D. F.; Abderrazak, A.; El Hadri, K.; Simmet, T.; Rouis, M. The thioredoxin system as a therapeutic target in human health and disease. Antioxid. Redox Signaling. 2013, 19, 1266-1303. (14) Holmgren, A.; Lu, J. Thioredoxin and thioredoxin reductase: current research with special reference to human disease. Biochem. Biophys. Res. Commun. 2010, 396, 120-124. (15) Arner, E. S.; Zhong, L.; Holmgren, A. Preparation and assay of mammalian thioredoxin and thioredoxin reductase. Methods Enzymol. 1999, 300, 226-239. (16) Mochizuki, A.; Saso, A.; Zhao, Q.; Kubo, S.; Nishida, N.; Shimada, I. Balanced Regulation of Redox Status of Intracellular Thioredoxin Revealed by in-Cell NMR. J. Am. Chem. Soc. 2018, 140, 3784-3790. (17) Fan, Y.; Makar, M.; Wang, M. X.; Ai, H. W. Monitoring thioredoxin redox with a genetically encoded red fluorescent biosensor. Nat. Chem. Biol, 2017, 13, 1045-1052. (18) Lee, M. H.; Jeon, H. M.; Han, J. H.; Park, N.; Kang, C.; Sessler, J. L.; Kim, J. S. Toward a chemical marker for inflammatory



disease: a fluorescent probe for membrane-localized thioredoxin. J. Am. Chem. Soc. 2014, 136, 8430-8437. (19) Lee, M. H.; Han, J. H.; Lee, J. H.; Choi, H. G.; Kang, C.; Kim, J. S. Mitochondrial thioredoxin-responding off-on fluorescent probe. J. Am. Chem. Soc. 2012, 134, 17314-17319. (20) Li, X.; Hou, Y.; Meng, X.; Ge, C.; Ma, H.; Li, J.; Fang, J. Selective Activation of a Prodrug by Thioredoxin Reductase Providing a Strategy to Target Cancer Cells. Angew. Chem., Int. Ed, 2018, 57, 6141-6145. (21) Zhang, L.; Peng, S.; Sun, J.; Yao, J.; Kang, J.; Hu, Y.; Fang, J. A specific fluorescent probe reveals compromised activity of methionine sulfoxide reductases in Parkinson's disease. Chem. Sci. 2017, 8, 2966-2972. (22) Zhou, P.; Yao, J.; Hu, G.; Fang, J. Naphthalimide Scaffold Provides Versatile Platform for Selective Thiol Sensing and Protein Labeling. ACS Chem. Biol. 2016, 11, 1098-1105. (23) Zhang, B.; Ge, C.; Yao, J.; Liu, Y.; Xie, H.; Fang, J. Selective selenol fluorescent probes: design, synthesis, structural determinants, and biological applications. J. Am. Chem. Soc. 2015, 137, 757-769. (24) Zhang, L.; Duan, D.; Liu, Y.; Ge, C.; Cui, X.; Sun, J.; Fang, J. Highly selective off-on fluorescent probe for imaging thioredoxin reductase in living cells. J. Am. Chem. Soc. 2014, 136, 226-233. (25) Zhang, L.; Peng, S.; Sun, J.; Liu, R.; Liu, S.; Fang, J. A ratiometric fluorescent probe of methionine sulfoxide reductase with an improved response rate and emission wavelength. Chem. Commun. 2019, 55, 1502-1505. (26) Miller, C. G.; Schmidt, E. E. Disulfide reductase systems in liver. Br. J. Pharmacol. 2019, 176, 532-543. (27) Go, Y. M.; Jones, D. P. Thiol/disulfide redox states in signaling and sensing. Crit. Rev. Biochem. Mol. Biol. 2013, 48, 173-181. (28) Goswami, A.; Rosenberg, I. N. Thioredoxin stimulates enzymatic outer ring monodeiodination of reverse triiodothronine. Endocrinology. 1987, 121, 1937-1945. (29) Luthman, M.; Holmgren, A. Rat liver thioredoxin and thioredoxin reductase: purification and characterization. Biochemistry. 1982, 21, 6628-6633. (30) Holmgren, A. Thioredoxin structure and mechanism: conformational changes on oxidation of the active-site sulfhydryls to a disulfide. Structure. 1995, 3, 239-243. (31) Andersen, J. F.; Sanders, D. A.; Gasdaska, J. R.; Weichsel, A.; Powis, G.; Montfort, W. R. Human thioredoxin homodimers: regulation by pH, role of aspartate 60, and crystal structure of the aspartate 60 → asparagine mutant. Biochemistry. 1997, 36, 13979-13988. (32) Wi, Y.; Le, H. T.; Verwilst, P.; Sunwoo, K.; Kim, S. J.; Song, J. E.; Yoon, H. Y.; Han, G.; Kim, J. S.; Kang, C.; Kim, T. W. Modulating the GSH/Trx selectivity of a fluorogenic disulfide-based thiol sensor to reveal diminished GSH levels under ER stress. Chem. Commun. 2018, 54, 8897-8900. (33) Samaranayake, G. J.; Troccoli, C. I.; Huynh, M.; Lyles, R. D. Z.; Kage, K.; Win, A.; Lakshmanan, V.; Kwon, D.; Ban, Y.; Chen, S. X.; Zarco, E. R.; Jorda, M.; Burnstein, K. L.; Rai, P. Thioredoxin-1 protects against androgen receptor-induced redox vulnerability in castration-resistant prostate cancer. Nat. Commun. 2017, 8, 12041217. (34) Kirkpatrick, D. L.; Kuperus, M.; Dowdeswell, M.; Potier, N.; Donald, L. J.; Kunkel, M.; Berggren, M.; Angulo, M.; Powis, G. Mechanisms of inhibition of the thioredoxin growth factor system by antitumor 2-imidazolyl disulfides. Biochem. Pharmacol. 1998, 55, 987-994. (35) Umezawa, K.; Yoshida, M.; Kamiya, M.; Yamasoba, T.; Urano, Y. Rational design of reversible fluorescent probes for live-cell imaging and quantification of fast glutathione dynamics. Nat. Chem. 2017, 9, 279-286. (36) Qiu, L.; Zhao, L. F.; Xing, C. F.; Zhan, Y. Redox-responsive polymer prodrug/AgNPs hybrid nanoparticles for drug delivery. Chin. Chem. Lett. 2018, 29, 301-304. (37) Yan, C.; Guo, Z.; Shen, Y.; Chen, Y.; Tian, H.; Zhu, W. H. Molecularly precise self-assembly of theranostic nanoprobes within a

Page 8 of 9

single-molecular framework for in vivo tracking of tumor-specific chemotherapy. Chem. Sci. 2018, 9, 4959-4969. (38) Yan, C.; Guo, Z.; Liu, Y.; Shi, P.; Tian, H.; Zhu, W. H. A sequence-activated AND logic dual-channel fluorescent probe for tracking programmable drug release. Chem. Sci. 2018, 9, 6176-6182. (39) Ye, M.; Wang, X.; Tang, J.; Guo, Z.; Shen, Y.; Tian, H.; Zhu, W. H. Dual-channel NIR activatable theranostic prodrug for in vivo spatiotemporal tracking thiol-triggered chemotherapy. Chem. Sci. 2016, 7, 4958-4965. (40) Kong, F.; Liang, Z.; Luan, D.; Liu, X.; Xu, K.; Tang, B. A Glutathione (GSH)-Responsive Near-Infrared (NIR) Theranostic Prodrug for Cancer Therapy and Imaging. Anal. Chem. 2016, 88, 6450-6456. (41) Lee, M. H.; Sessler, J. L.; Kim, J. S. Disulfide-based multifunctional conjugates for targeted theranostic drug delivery. Acc. Chem. Res. 2015, 48, 2935-2946. (42) Lee, M. H.; Yang, Z.; Lim, C. W.; Lee, Y. H.; Dongbang, S.; Kang, C.; Kim, J. S. Disulfide-cleavage-triggered chemosensors and their biological applications. Chem. Rev. 2013, 113, 5071-5109.


Page 9 of 9 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Analytical Chemistry

for TOC only


Fluorophore-dependent cleavage of disulfide bond leading to a highly

Recommend Documents