Folic Acid-Derived Hydrogel Enhances the Survival and Promotes

Subscriber access provided by Washington University | Libraries

Biological and Medical Applications of Materials and Interfaces

Folic Acid-Derived Hydrogel Enhances the Survival and Promotes Therapeutic Efficacy of iPS Cells for Acute Myocardial Infarction Hekai Li, Jie Gao, Yuna Shang, Yongquan Hua, Min Ye, Zhimou Yang, Cai wen Ou, and Minsheng Chen ACS Appl. Mater. Interfaces, Just Accepted Manuscript • DOI: 10.1021/acsami.8b08659 • Publication Date (Web): 05 Jul 2018 Downloaded from http://pubs.acs.org on July 5, 2018

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 31 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Applied Materials & Interfaces

Folic Acid-Derived Hydrogel Enhances the Survival and Promotes Therapeutic Efficacy of iPS Cells for Acute Myocardial Infarction Hekai Li,†, § Jie Gao,‡, § Yuna Shang,‡ Yongquan Hua,† Min Ye,† Zhimou Yang,‡, * Caiwen Ou†, * and Minsheng Chen†, * †

Guangdong Provincial Center of Biomedical Engineering for Cardiovascular Diseases, Southern

Medical University, and Zhujiang Hospital of Southern Medical University, Guangzhou 510280, P. R. China; ‡State Key Laboratory of Medicinal Chemical Biology, Key Laboratory of Bioactive Materials, Ministry of Education, College of Life Sciences, and Collaborative Innovation Center of Chemical Science and Engineering (Tianjin), Nankai University, Tianjin 300071, P. R. China. KEY WORDS: induced pluripotent stem cell (iPS); myocardial infarction; cardiac regeneration; hydrogel; self-assembly

ACS Paragon Plus Environment

1

ACS Applied Materials & Interfaces 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 31

Abstract: Stem cell therapy has obtained extensive consensus to be an effective method for post myocardial infarction (MI) intervention. Induced pluripotent stem (iPS) cells, which is able to differentiate into multiple cell types, have the potential to generate cardiovascular lineage cells for myocardial repair after ischemic damage, but their poor retention rate significantly hinders the therapeutic efficacy. In the present study, we developed a supramolecular hydrogel which is formed by the self-assembly of folic acid-modified peptide via a biocompatible method (glutathione reduction), and was suitable for cell encapsulation and transplantation. The iPS cells labeled with CM-DIL were transplanted into the MI hearts of mice with or without FA hydrogel encapsulation. The results corroborated that FA hydrogel significantly improved the retention and survival of iPS in MI hearts post injection, leading to augment of therapeutic efficacy of iPS including better cardiac function and much less adverse heart remodeling, by subsequent differentiation towards cardiac cells and stimulation of neovascularization. This study reported a novel supramolecular hydrogel based on FA-peptides capable of improving the therapeutic capacity of iPS, which held big potential in the treatment of MI.


2

Page 3 of 31 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Introduction Cardiovascular diseases are the leading cause of death in both developing and developed countries, among which myocardial infarction (MI) is the most common type.1 The loss of working myocardium during MI leads to an irreversible heart function exacerbation and the survived cardiomyocytes after myocardial infarction always failed to repair the injured myocardium due to their poor regeneration capacity. Advanced therapeutic modalities such as heart transplantation have been developed and considered to be the optimum paradigm for the treatment of diseased heart. However, such surgical operation is applicable to only a small subset of patients because of the donor organ shortages and the incidence of immune rejection.2 These problems have prompted the development of regenerative medicine including the transplantation of stem cells.3-5 Induced pluripotent stem cell (iPS) is a kind of embryonic stem cell (ESC) like pluripotent cells. It is originally generated from reprogrammed somatic cells by retroviral introduction of several factors which are critical in the stemness and proliferation of ESC.6,7 while ESC is derived from human embryos that is ethically contentious.8 The iPS possesses similar differentiation capacity to ESC which can produce specific cell types as need in vitro and in vivo.9 It has been reported that functional cardiomyocytes can be robustly generated by iPS10, and potential therapeutic benefits has been obtained in porcine or rodent model of myocardial infarction.11,12 However, low retention rate and viability of transplanted cells in the insulted myocardium have hindered the further clinical translation of iPS.13-15 Tissue engineering, an intelligent strategy that combines biomaterials with cells or cytokines to improve the attachment and survival of transplanted cells in vivo, is becoming a promising strategy to solve this problem.16 Hydrogels, consisting of polymers, proteins or self-assembling small molecules, have attracted


3


Page 4 of 31

extensive attention among various biomaterials owing to their unique advantages such as biocompatible and bioactive, injectable, and extracellular matrix (ECM) mimicking properties.17 A variety of polymeric hydrogels, including natural or synthetic ones, have been evaluated as stem cell transplantation matrix in cardiac regeneration research.18-25 The hydrogel encapsulated stem cells displayed prolonged retention time and thus providing a more preeminent therapeutic efficacy. Recently, supramolecular hydrogels of self-assembling peptides emerge as promising biomaterials for regenerative medicine and tissue engineering .26-32 Those formed by pure peptides and peptide amphiphiles have been used directly or in combine with stem cells to treat cardiovascular diseases such as MI and limb ischemia.33-36 Owing to the ease of design and synthesis, supramolecular hydrogels formed by short peptides are versatile for large scale preparation and practical applications. Owing to rational design of peptide sequence and relatively fast degradation in vivo, they also have advantages such as diversity of bioactive components and excellent biocompatibility. Though they have shown big potential in drug delivery,37,38 sensing,39-41 cancer cell inhibition42-44 and immune modulation,45-47 their potential in tissue engineering and stem cell therapy has rarely explored. In order to construct supramolecular hydrogelators of short peptides, many aromatic capping groups are linked with short peptides through covalent bonds, in order to drive selfassembly by introducing π-π interaction into the molecules. Until now, naphthyl-, pyrenyl-, fluorenyl-, phenothiazinyl- and several therapeutic agents containing aromatic rings have been demonstrated as powerful aromatic capping groups to construct hydrogelators of short peptides.48-57 However, the tissue engineering application of these aromatic capping groups is hindered by their biocompatible concerns. In our study, we use a necessary vitamin for human being, folic acid (FA) to modify short peptides to make supramolecular hydrogels. Folic acid is


4

Page 5 of 31 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


biocompatible and has been made into food additive and supplement for pregnant women. The designed FA-modified peptides and their degradation products are highly biocompatible because they are constituted by natural amino acids and vitamin. We therefore assume that hydrogels of FA-modified peptides may be a desirable candidate in stem cell based therapy for myocardial infarction, which is demonstrated in this study.

Results and Discussion Hydrogelator design and synthesis. Short peptides containing di-phenylalanine (-FF-) sequence are excellent hydrogelators, and folic acid monomers are capable of forming stable tetramers through hydrogen bonds58 so that are helpful for self-assembly59,60. Previously, we have developed a method of glutathione triggered molecular self-assembly to prepare supramolecular hydrogels.61 We therefore firstly used standard Fmoc- solid phase peptide synthesis method to design and synthesize three FA-modified peptide derivatives of FA-FFF-ss-EE, FA-VVV-ss-EE, and FA-AAA-ss-EE with different amphiphilicities (Figure 1A). The three compounds were able to form clarified solutions in PBS (phosphate buffer saline, pH = 7.4) solution up to a concentration of 2 wt% (20 mg/mL). Subsequently, the formation of FA-FFF-Thiol, FA-VVVThiol, and FA-AAA-Thiol occured when disulfide bond was reduced by glutathione (4 equiv. to the peptide). As shown in Figure 1B, the resulting FA-FFF-Thiol formed an non-transparent hydrogel with the minimum concentration of 0.5 wt% (0.5 mg/mL), while the other two compounds could only form clear solutions at concentrations up to 2 wt%. These observations indicated that tripeptide of FFF was a powerful self-assembling molecules to construct supramolecular hydrogelators, which was consistent with other pioneering works about efficient


5


Page 6 of 31

hydrogelators based on FF and FFF.62,63 Since the hydrogel from FA-FFF-ss-EE was opaque that was not an ideal one for cell culture and encapsulation, we introduced an additional hydrophilic and bioactive peptide ligand of RGD to the gelator. We then designed and synthesized the molecule FA-FFFRGD-ss-EE (compound 1, Figure 1C) as the pro-gelator. The cell adhesive ligand arginine-glycine-aspartic (RGD) was incorporated to promote cell adhesion and survival. We found that compound 1 could also form clear solutions, which could be converted to hydrogels by the addition of glutathione in various solutions including PBS, DMEM (Dulbecco's modified Eagle medium) and complete medium (DMEM containing 10% FBS) at the concentration of 1.0 wt% (Figure 1D). Hydrogels formed in these solutions were clear, suggesting their potential in cell culture. The hydrogel of 1 remained unchangeable within one month at 37 oC (Figure S11B), while the hydrogel of FA-FFF-Thiol collapsed and became viscous solution after being kept at 37 oC for 3 days (Figure S11C). Furthermore, to investigate the role that folic acid has played in the self-assembly, we synthesized FFFRGD-ss-EE to see whether it can form hydrogel after disulfide bond reduction. As shown in Figure S11D, the molecule can dissolve well in PBS solution, but formed precipitates soon after the addition of glutathione, demonstrating that the folic acid is also very important for the formation of hydrogel.


6

Page 7 of 31 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 1. (A) The chemical structures of FA-FFF-ss-EE, FA-VVV-ss-EE and FA-AAA-ss-EE and their corresponding compounds formed by glutathione (GSH) reduction. (B) From top to bottom: optical images of opaque hydrogel of FA-FFF-Thiol and solutions of FA-VVV-Thiol and FA-AAA-Thiol in PBS, respectively. (C) The chemical structure of FA-FFFRGD-ss-EE (1) and the gelator obtained by GSH reduction. (D) From left to right: optical images of the PBS solution containing 1.0 wt% of 1, hydrogels formed by GSH reduction in PBS, serum-free DMEM and cell culture medium, respectively. (E) Representative image of hydrogel formed by 1.0 wt% of 1 in PBS captured by a TEM (Scale bar:2 00 nm). The dynamic frequency sweep ( 1% strain) of hydrogels from (F) 1.0 wt% of 1 and (G) 2.0 wt% of 1 mixing with equally volume of cell culture medium containing 2 million/mL cells.


7


Page 8 of 31

Hydrogel characterization. We therefore characterized the hydrogels of 1 by TEM (transmission electron microscopy), and the image shown in Figure 1E demonstrated that the fine nanofibers were about 6 nm in the diameter. These mutually entangled nanofibers formed exquisite 3-D networks which might provide a ECM mimicking niche for the attachment of encapsulated cells.

The mechanical characteristics of the hydrogel was then analysed by

rheology. As shown in Figure 1F, 24 hours after the addition of GSH to the pro-gelator solution (1.0 wt% of 1), the storage modulus value (elasticity or G’) of the resulting gel was dominant than the loss modulus value (viscosity or G”). Both G’ and G” showed weak frequency dependences range from 0.1 to 100 rad s-1, indicating that the hydrogel was composed of elastic networks. Strain sweep characterization of the hydrogel (Figure S12) showed that the hydrogel showed linear behavior of G’ and G” up to 30% strain. We then analyzed the mechanical property of the hydrogel after encapsulating cells. Upon mixing the cell culture medium containing 2.0 million mL-1 cells with equal volume of hydrogel of 1 by 30 seconds of vortex, the mixture turned into a viscous fluid that could convert back a self-supporting hydrogel after 10 minutes in a cell incubator at 37 oC. Results showed that the G’ value of the gel with cells decreased around 28%, while the value of G” was still one magnitude less than that of G’ (Figure 1G), suggesting that the recovered material remained to be a true hydrogel. FA hydrogel is biocompatible to iPS cells. The mechanical property of hydrogels is crucial for their biocompatibility to iPS cells and their further performance in the injured heart. Thus we prepared hydrogels of different concentration of 1 (1.0, 2.0, 3.0 wt%), and performed rheology tests. Results of dynamic frequency sweep showed that when the concentration of 1 was increasing, the mechanical strength of hydrogel was growing simultaneously (Figure S13). The


8

Page 9 of 31 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


G’ value for each hydrogel was about 400 Pa, 400 Pa and 1100 Pa, respectively. To test the biocompatibility of hydrogels of 1 with different mechanical characteristics, We then seeded mouse iPS on the surface of these three hydrogels in cell culture medium. After being cultured for 1, 2 and 3 days, the cell proliferation was revealed by the CCK-8 assay, the results indicated that iPS kept increasing on the surface of the hydrogels over the span of 3 days. We found that iPS had higher proliferation rate on 1.0 wt% hydrogel than on 2.0 wt% or 3.0wt% ones (Figure S14). 2.0 wt% hydrogel prohibited the growth of iPS slightly, while 3.0 wt% hydrogel had a significantly inhibitory effect on the growth of iPS. Spreading of the iPS cell colonies cultured on the surface of the hydrogels was then tested by the Live/Dead assay. After 3 days of culture, iPS cells cultured on each hydrogel were alive and cells aggregated well during the 3-day period.. Living cells formed larger colonies on 1.0 wt% hydrogel than those on 2.0 wt% or 3.0 wt% hydrogel in 3 days (Figure S15). The above results indicated that 1.0 wt% FA hydrogel had the optimal biocompatibility and would be the best candidate as a cell carrier among the three hydrogel of different concentration. Thus we chose the hydrogel made from 1.0 wt% of compound 1 in cell culture medium for the following experiments, which is termed ‘FA hydrogel’ in the following sections. FA hydrogel has no adverse impact on cardiac lineage commitment of iPS cells in vitro. To investigate the differentiation of iPS cells to cardiac lineages on FA hydrogel, we adopted spontaneous differentiation method and examined the gene expression level of the specific marker at different differentiation stages. Undifferentiated iPS cells (day 0) highly expressed Oct3/4, a stemness factor, which disappeared gradually after producing their progeny cells(ectodermal, mesodermal and endodermal) Mesodermal lineages started to express Mesp1 on day 3 and the peak of expression appeared on day 5. Isl-1 expression arose from day 5 and


9


Page 10 of 31

diminished substantially on day 15,which revealed that cardiovascular lineage commitment occurred during the time period , And cardiac progenitor cells came on stage on day7,as indicated by Gata4 MHC and cTnT, functions in cardiac muscle contraction, expressed from day 7, and increased rapidly in the following days (Figure S16A). As another offspring of cardiovascular progenitor cells, endothelial cells appeared on day 7, as demonstrated by the expression of vWF (Figure S17A). All the results above is consistent with the differentiation of iPS without FA hydrogel. Immunofluorescence confocal microscopy confirmed that iPS seeded on the surface of FA hydrogel expressed cTnT, MHC and vWF, and cell morphology of iPS differentiated cardiomyocytes was identical with that of control group (Figures S16B and S17B). These findings reveals that FA hydrogel provides a cozy environment for the cardiac differentiation of iPS cells. In Vivo degradation kinetics of FA hydrogel in mice heart. To evaluate the degradative kinetics of FA hydrogel in heart tissue, the hydrogel was intramyocardially injected into the left ventricular wall of the hearts of C57BL/6 mouse. Mouse were euthanized at 1, 2 and 4 weeks after injection and hearts were harvested for H&E staining. Hydrogel was identified as the homogeneous substance without any biological tissue that was apparently distinct from the surrounding heart tissue. We could observe hydrogels at injection sites at 1 and 2 weeks, but could not observe them around the injection site at 4 weeks (Figure S18). The results from histological analysis indicated that FA hydrogel gradually degraded within 4 weeks. FA hydrogel increased survival and cardiac differentiation of transplanted iPS in vivo. To gain validation of the effect of FA hydrogel on long-term retention and survival of iPS in mice heart, we labeled the iPS cells with CM-DIL and transplanted them intramyocardially into MI hearts of mice with or without FA hydrogel encapsulation. It is well known that iPS cells


10

Page 11 of 31 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


experience several stages before they differentiate to functionally mature Cardiomyocytes (CMs) in vitro, implanting the cells at appropriate stage is crucial for their therapeutic effects, because immature iPS derived cells may form tumor or undesired cell types while too mature iPS derived cells is not capable of integrating with the host tissue. Hence we choose the cells of embryonic body obtained from 4-7 days’ culturing of iPS in myocardial differentiation media as candidates for transplantation, because EBs at this stage included cardiovascular progenitor cells that were not only able to differentiate to CMs but also possessed the propensity for revascularization.64 We firstly labeled the 7-day EBs with CM-DIL and then dispersed them into single cells before transplantation. Mice were randomly assigned to two groups: ‘FA hydrogel + iPS group’ and ‘iPS only group’, which received injection of labeled iPS right after myocardial infarction with or without FA hydrogel encapsulation, respectively. Following sacrificing mice at day 30, we performed immunofluorescence to examine the in vivo survival of iPS. Confocal microscopic images of the heart sections demonstrated that and the survival/retention rate of iPS in FA hydrogel + iPS group was significantly increased by about 2.5 folds compared with iPS only group, indicated by detection of CM-DIL positive cells around the transplantation site (Figure 2A). The results indicated that co-transplantation with FA hydrogel dramatically improved the retention and survival of the transplanted iPS. We also analyzed the differentiation of the encapsulated iPS in vivo, by staining the heart sections in the FA hydrogel + iPS group with cardiac specific marker myosin heavy chain (MHC) and cardiac troponin T (cTnT). Colocalization of CM-DIL red fluorescence and green fluorescence of MHC or cTnT was found in infarct and peri-infarct myocardium, indicating that the iPS in FA hydrogel differentiated towards cardiomyocyte like cells (Figure 2B). These observations suggested the big potential of FA hydrogel for cell transplantation the treatment of MI. We also observed colocalization of


11


Page 12 of 31

fluorescence of vWF and CM-DIL in the heart sections of FA hydrogel + iPS group, suggesting that some of the iPS had differentiated into endothelial cells (Figure 2C). However, the proportion of iPS cells that differentiated into endothelial cells was much smaller than those differentiated into cardiomyocyte like cells (indicated by the density of colocalized fluorescence in Figure S19 and S20). We thus decided to gain further insight into the effect of FA hydrogel on the neovascularization in the ischemic myocardium, which will be discussed in the next section. On the other hand, in iPS only group, the differentiation of iPS cells toward cardiac like cells or endothelial cells was very rare. (Figure S21 and S22).


12

Page 13 of 31 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60



13


Page 14 of 31

Figure 2. Survival of iPS in the infarcted myocardium and cardiac differentiation of iPS in myocardial environment. Heart sections were collected 30 days after myocardial infarction with injection of CM-DIL (red) labeled iPS encapsulated with or without FA hydrogel. (A) Confocal fluorescence microscope was used to detect cell retention in the ischemic myocardium (DAPI: blue fluorescence, CM DIL, red fluorescence, ##p < 0.01 vs iPS only group. n = 4), (B) Immunofluorescence staining of the heart sections with MHC and cTnT to examine cardiomyocyte differentiation of iPS in vivo,. Colocalization of CM DIL and MHC or cTnT was indicated by white arrow. (MHC, cTnT: green fluorescence) (C) Immunofluorescence staining of the heart sections with von Willebrand factor (vWF) to examine endothelial cell differentiation of iPS, and the pictures were captured by a confocal Fluorescence microscope. Colocalization of CM DIL and vWF was indicated by white arrow. Details are shown in the enlarged images of the original merged picture in C. (vWF: green fluorescence). Scale bars: 50µm.

Transplantation of iPS encapsulated in FA hydrogel enhanced neovascularization in MI heart. To examine the neovascularization in the infarcted hearts, we stained the heart sections with vWF and isolectin GS-IB4 to assess blood vessel and capillary density in the infarction and border zone respectively at day 30 post-MI. vWF staining showed that co-transplation of ips with FA hydrgogel obviously improved vessel density in infarct zone compared with other groups (Figures 3A and 3B, p < 0.01 vs PBS group or FA hydrogel group, p < 0.05 vs iPS only group). The density of capillaries in the peri-infarct area was evaluated by isolectin GS-IB4 staining. In comparison with other treatment groups, iPS encapsulated in FA hydrogel remarkably enhanced capillary density in the peri-infarct area. (Figures 3C and 3D). These results indicated that iPS could promote neovascularization in the infarcted heart, and their encapsulating in FA hydrogel could further enhance such therapeutic effect, due to better iPS survival and retention at the injection sites. According

to several pioneering reports, autocrine or paracrine cytokines

released from stem cell could stimulate c-kit and flk-1 positive cells to convert to vascular smooth muscle cells and endothelial cells,65 we speculated that the newly formed vessels observed in FA hydrogel + iPS group and iPS only group were formed by both differentiated iPS cells and c-kit and flk-1 positive cells stimulated by cytokines released from iPS cells.


14

Page 15 of 31 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 3. Transplantation of iPS encapsulated in FA hydrogel enhanced neovascularization and capillary density in the infarcted hearts. (A) 30 days after MI, immunofluorescence was used to stain the heart section with vWF to detect the vessel density in the infarct area, and the pictures were captured by a fluorescence microscope(400×). (B) Quantative analysis of the blood vessel in each treatment group. (C) 30 days after MI, heart sections were stained with isolectin GS-IB4 to detect the capillary density in the peri-infarct area, and the pictures were captured by a fluorescence microscope (400×). (D) Quantative analysis of the capillary density in each treatment group. #p < 0.05, ##p < 0.01 vs PBS group, *p > 0.05 vs PBS group. n = 4. Bars denote mean ± S.E.M. Scale bars: 50 µm.


15


Page 16 of 31

Transplantation of iPS encapsulated in FA hydrogel improved cardiac function after MI. Next, we determined cardiac function 30 days post MI in each group. The mice were divided into five experimental groups at random, among which one group received all the surgical operation but substantial LAD ligation was defined as sham group, while the others received the following reagents into the peri-infarct zone right after MI surgery: PBS (PBS group), FA hydrogel (FA hydrogel group), iPS (iPS only group) and iPS encapsulated in FA hydrogel (FA hydrogel + iPS group). Echocardiography was performed 30 days after transplantation. The results in Figure 4A showed that all the surgery groups exhibited deteriorative heart function and enlarged left ventricular cavity compared with sham group, all the other groups displayed left ventricular enlargement and heart function impairment. However, the injection of iPS along with FA hydrogel obviously improved contractile function of the infarcted heart compared with other groups, indicating by the augment of ejection fraction (EF) and fractional shortening (FS) (Figure 4B, p < 0.01 vs PBS group, p < 0.01 vs FA hydrogel group, p < 0.05 vs iPS only group). Compared with PBS group, cardiac function of mice in iPS only group was also improved (p < 0.05 vs PBS group). No significant difference was observed between FA hydrogel and PBS group (p > 0.05 vs PBS group). We therefore concluded that iPS could improve the heart function after MI, especially with the co-administration of FA hydrogel.


16

Page 17 of 31 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 4. Echocardiography performed 30 days after MI revealed that mice received iPS/FA hydrogel transplantation displayed significantly improved cardiac function. (A) Representative 2d echocardiographic images of either sham group or other treatment groups 30 days after MI. (B) Quantative analysis of cardiac systolic parameters: Ejection fraction (EF) and Fractional shortening (FS). #p < 0.05, ##p < 0.01 vs PBS group, *p > 0.05 vs PBS group.

Transplantation of iPS encapsulated in FA hydrogel alleviated adverse heart remodeling after MI. We also performed masson trichrome staining to quantitative analyze the infarct size and the degree of fibrosis. As shown in Figure 5A, infarct size was significantly smaller in FA hydrogel + iPS group in comparison to PBS (0.1628±0.01100 vs 0.3119±0.02912, p < 0.01), iPS only (0.1628±0.01100 vs 0.2408±0.02199, p < 0.01) and FA hydrogel groups (0.1628± 0.01100 vs 0.3124±0.02502, p < 0.01). The fibrosis of FA hydrogel group was almost the same with PBS group (0.3119±0.02912 vs 0.3124±0.02502, p > 0.05), while both groups containing


17


Page 18 of 31

iPS showed significantly reduced fibrosis and the FA hydrogel + iPS group showed the minimal fibrosis. These results were consistent with those obtained by echocardiography examination, which further suggested the big potential of FA hydrogel for the transplantation of iPS for the treatment of MI. A previous reported work demonstrated that bioactive polymeric hydrogel alone could increase the wall thickness of the peri-infarct myocardium,66 while our hydrogel alone was unable to sufficiently prevent post-MI LV remodeling, this is probably due to the weak mechanical property of the supramolecular hydrogels.

Figure 5. Transplantation of iPS encapsulated in FA hydrogel significantly ameliorated post-MI fibrosis. (A) Representative heart remodeling images performed by Masson’s trichrome staining of heart sections at day 30 after MI. (B) Quantative analysis of cardiac fibrosis in each treatment group. #p < 0.05, ##p < 0.01 vs PBS group,*p > 0.05 vs PBS group.

Conclusion


18

Page 19 of 31 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


In summary, we reported here a novel supramolecular hydrogel of folic acid-peptide conjugate. The FA hydrogel was formed by the addition of biocompatible GSH and therefore suitable for cell culture and transplantation. We dispersed the embryonic bodies from spontaneously differentiated iPS into single cells and labeled them with CM-DIL, and the prelabeled single cells were transplanted with or without the hydrogel encapsulation into the hearts of C57BL/6 mouse immediately after left anterior descending (LAD) branch ligation. Results showed that cell engraftment of iPS within FA hydrogel was as nearly 3 fold as that of iPS only group. Echocardiography showed that MI hearts treated with iPS with or without FA hydrogel had better cardiac function compared to other groups, and FA hydrogel + iPS group demonstrated the best cardiac function among all groups. This was consistent with the histology analysis that collagen content was significantly decreased in FA hydrogel + iPS group. What’s more, we observed cardiomyocyte differentiation of the transplanted cell on the myocardium and neovascularization promotion in the FA hydrogel + iPS group, which could play important role in MI heart repair. .On account of the advantages in easily design and synthesis, we envisioned the big potential of our injectable FA hydrogel for tissue engineering, drug release and regenerative medicine by incorporating other therapeutic agents including stem cells and bioactive molecules.

Methods Animals. 8-10 weeks old male adult C57BL/6 mice were obtained from Guangdong laboratory animal center. All animal experiments has been approved by the Southern Medical University


19


Page 20 of 31

animal care and use committee and conform to the US National Institutes of Health guidelines on animal care and use. FA Hydrogel formation. 1 mg of FA-FFFRGD-CS-EE was dissolved in 150 µL of solvents (PBS buffer, DMEM or cell culture medium), which contained 6 equiv. of Na2CO3 to make the final pH value to 7.4. After that, 50 µL of solvents with 4 equiv. of GSH in it was added. Then the solution was standing at 25 °C for 12 hours, and after that the hydrogels formed. Rheology. AR 2000ex (TA instrument) system was used to perform rheology test. 40 mm parallel plates were used, and the gap was set to be 500 µm. Hydrogel was added to the rheometer directly. For frequency sweep, the region of 0.1-100 rad/s and the strain of 1% were chosen. For time sweep, the frequency was set to be 1 rad/s and the strain was 1%. For strain sweep, the frequency was set to be 1 rad/s. In addition, for 3D cell culture test, we mixed gel and media containing cells homogeneously. After the viscous liquid changed back to a gel, we performed dynamic time sweep as described above. Transmission electron microscopy (TEM). A MODEL H-800 electron microscope was used to characterize the microscopic morphology of the samples. The acceleration voltage is 100 kV. The images were captured by a Gatan multiscan CCD. We used a micropipette to place hydrogel containing 1 wt% of compound 1 onto a carbon film support TEM grid. Then we put the TEM grid samples in a dessicator to drying them. Spreading and proliferation of mouse iPS on FA hydrogel. In order to examine the spreading capacity of mouse iPS (MiPS) on FA hydrogel, we coated 24-wells plate with 0.1% gelatin followed by 10µl of 1.0 wt%, 2.0 wt% or 3.0 wt% FA hydrogel, and seeded iPS on the bottom of the plate. Live/dead viability/cytotoxicity kit (Thermofisher, USA) was performed on day 1, 2, 3


20

Page 21 of 31 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


and the images were captured by a fluorescence microscope (Leica DMI8, Germany). As for the proliferation of MiPS on FA hydrogel, we seeded MiPS in 96-well plates, we replaced the medium with 100 µl DMEM containing 10% cck-8 instead. The 96-well plate was incubated in the cell incubator for 2h, the optical density was read by Varioskan LUX Multimode Microplate Reader (Thermo Fisher). Gene expression analysis (Quantitative real-time PCR). To evaluate the differentiation capacity of MiPS on FA hydrogel, we seeded MiPS on 6-wells plates precoated with either 1.0 wt%, 2.0 wt% or 3.0 wt% FA hydrogel, we examined the stage-specific gene expression level of EBs. Total RNA was extracted from EBs at different culture times (day0, day3, day5, day7, day11, day15) using RNAsio (Takara Japan). cDNA was synthesized with PrimesScript RT Master Mix (Takara Japan). And we conducted RT-qPCR with following conditions: Initial denaturation, 95 oC for 30s; denaturation, 95 oC for 10s; annealing/extension, 60 oC for 30s. The primer sequences used for RT-PCR were as follows: OCT3/4: AGCACGAGTGGAAAGCACT (forward), CTCATTGTTGTCGGCTTCCT (reverse); MESP1: GGAGCCCAGTCCCTCATCTC (forward), CATGTTGGTATCACTGCCGCC (reverse); Isl-1: GCCACAAGCGTCTCGGGAT (forward), TGACATGAAAAGTGGCAAGTCTCC (reverse); GATA4: GCCTTGGTGACTATGGCTCATCT (forward), GGGGACATCTTCTCCCGTCTA (reverse); MHC: ATCCTGGCTGAGTGGAAGCAG (forward), CAGCTGTTTGCGGATCTTCTCC (reverse);


21


Page 22 of 31

cTnT: CCACCTGAATGAAGACCAACTGAG (forward), CTATTTCCAACGCCCGGTGAC (reverse); vWF: GAAGTGGCTCGCCTCAAGCA (forward), CAGCACTGGGTCTTCCGGA (reverse). Biodegradation and toxicity of FA hydrogel in vivo. C57BL/6 mice received 1 wt% FA hydrogel injection into left ventricular free wall at two sites, with 10 µl for each site. And mice were sacrificed 1, 2 and 4 weeks after the injection for histological examination. To determine the biological toxicity of FA hydrogel and whether it caused inflammatory response in vivo, we used Hematoxylin and Eosin (HE) method to stain the sectioned as described67. Culture and differentiation of mouse induced pluripotent stem cell (MiPS). MiPS was routinely maintained in GS2-M media containing two selective small molecule inhibitors CHIR99021 and PD0325901 (Takara Japanese) in 25 cm2 plastic flasks pre-coated with 0.1% porcine skin gelatin type A (Sigma Aldrich Co) in PBS. Cells were passaged once confluence reached 70%. After 3 passages, MiPS was digested to single cells with accutase (Life technologies, USA) and counted. For myocardial differentiation, every 1.0×105 cells were suspended in 1ml differentiation media. Cells were suspended in 10 ml differentiation media in petridish (Thermo fisher brand) for 4 days to form Embryonic bodies(EBs).And we collected EBs using natural sedimentation method on the 5th day and transferred them to gelatin coated flasks for adherent culture.68 Induction of myocardial infarction and iPS transplantation with FA hydrogels. Prior to myocardial infarction model establishment, the 4-7 day EBs were labeled by CM-DIL (Life technologies) and dispersed to single cell suspension. 2 wt% FA hydrogel was prepared as described above and mixed with 2×107 mL-1 CM-Dil labeled cells at a volume ratio 1:1, cell density was 1×107 ml-1 in 1 wt% hydrogel for transplantation. Adult Male C57BL/6 mouse (20 ±


22

Page 23 of 31 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


5 g) were divided into 5 groups: sham group, PBS group, FA hydrogel group, iPS only group and FA hydrogel + iPS group. Anesthetization was performed on mice with 1.5% sodium pentobarbital (50 mg/kg) through introaeritoneal injection, and mice were ventilated with a rodent ventilator subsequently. We exposed mice hearts by the fourth intercostal space incision and a subsequent pericardium removal, And then we ligated the LAD permanently to perform MI generation. Immediately after the surgery, 20 µL PBS, 20 µL FA hydrogel, 2×105 iPS in 20 µL PBS or 2×105iPS in 20 µL hydrogel were transplanted into two adjacent position of the ischemic area intramyocardially through a 30 gauge needle, each site receive 10 µL of materials. Sham operation was performed with the needle passed through the heart tissue but the suture was not ligated. Echocardiography. 30 days after the surgery, mice were anaesthetized through inhalation of isoflurane (1-1.5%) in O2 and Echocardiographic examination was performed using a Vevo® 2100 Image System(FUJIFILM Visual Sonics, Inc. Toronto, Canada). Histological examination. 30 days after the induction of myocardial infarction, mice were sacrificed and hearts were explanted and immersed in 4% paraformaldehyde. After fixation for 24h, all hearts were embedded in paraffin and the specimens were cut into 5 µm thick sections along the short axis, transversely across the infarct zone. And collagen fibers in each heart was identified using Masson’s trichrome staining. The infarct fraction was measured by Image-Pro Plus software (version 6.0; Media Cybernetics, Silver Spring, MD, USA). Immunofluorescence. EBs of day 21 were incubated with 4% paraformaldehyde(PFA) and Triton X-100 (Sigma Aldrich) successively, for 20 min respectively. Afterwards, EBs were blocked with 5% BSA, followed by incubation in primary antibodies against MHC, cTnT and


23


Page 24 of 31

vWF(Abcam, USA). Following standing overnight at 4 oC, EBs were incubated with Alexa Fluor 488 goat anti-rabbit IgG (Santa Cruz, USA) and Alexa Fluor 488 goat anti-mouse IgG (Santa Cruz, USA). DAPI (Beyotime, Beijing, China) solution was used to counterstain cell nuclei. We used a Leica DMI8 to capture the fluorescence microscope images. Immunofluorescence of the paraffin sections was carried out as previously described.69 To assess cardiomyocyte differentiation of iPS in vivo, primary antibodies against MHC and cTnT (Abcam, USA) was adopted as the primary antibodies, Alexa Fluor 488 goat anti-mouse IgG (Santa Cruz, USA) as the secondary antibody. Cell nuclei were stained by DAPI. Images were captured by Leica DMI8 fluorescence microscope. To evaluate vessel density in infarct area, antibody against vWF (Abcam, USA) was employed as the primary antibody and Alexa Fluor 488 goat anti-rabbit IgG (Santa Cruz) as the secondary antibody. To detect capillaries in the peri-infarct zone, heart sections were incubated with isolectin GS-IB4 conjugated with Alexa Fluor 488(Thermo fisher, USA). Six random fields in infarct and peri-infarct area in each heart section were selected to capture pictures by a fluorescence microscope (Leica DMI8, Germany). Blood vessel density in infarct area was measured as vessels/HPF (high power field) (400×) while capillary density in peri-infarct area was measured as capillary/HPF(high power field, 400×). ASSOCIATED CONTENT Supporting Information. Proliferation and Live/Dead staining of iPS cells on the surface of FA hydrogels. Supplementary. Degradation of FA hydrogels in vivo. Synthesis and characterization of the hydrogels. More confocal images of immunofluorescence stained heart sections. These material is available free of charge via the Internet at http://pubs.acs.org.


24

Page 25 of 31 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


AUTHOR INFORMATION Corresponding Author *Zhimou Yang: [email protected] *Caiwen Ou: [email protected] *Minsheng Chen: [email protected] Author Contributions ‡H. L. and J. G. contributed equally to this work. ACKNOWLEDGMENT We acknowledge the financial supports from the National Natural Science Foundation of China (U1501222, 31671025, 51773097 and 31771099) and Young Elite Scientists Sponsorship Program by Tianjin (TJSQNTJ-2017-16). REFERENCES (1) Mozaffarian, D.; Benjamin, E. J.; Go, A. S.; Arnett, D. K.; Blaha, M. J.; Cushman, M.; Das, S. R.; de Ferranti, S.; Després, J.-P.; Fullerton, H. J.; Howard, V. J.; Huffman, M. D.; Isasi, C. R.; Jiménez, M. C.; Judd, S. E.; Kissela, B. M.; Lichtman, J. H.; Lisabeth, L. D.; Liu, S.; Mackey, R. H.; Magid, D. J.; McGuire, D. K.; Mohler, E. R.; Moy, C. S.; Muntner, P.; Mussolino, M. E.; Nasir, K.; Neumar, R. W.; Nichol, G.; Palaniappan, L.; Pandey, D. K.; Reeves, M. J.; Rodriguez, C. J.; Rosamond, W.; Sorlie, P. D.; Stein, J.; Towfighi, A.; Turan, T. N.; Virani, S. S.; Woo, D.; Yeh, R. W.; Turner, M. B. Executive Summary: Heart Disease and Stroke Statistics-2016 Update Circulation 2016, 133, 447-454. (2) Chambers, D. C.; Yusen, R. D.; Cherikh, W. S.; Goldfarb, S. B.; Kucheryavaya, A. Y.; Khusch, K.; Levvey, B. J.; Lund, L. H.; Meiser, B.; Rossano, J. W.; Stehlik, J. The Registry of the International Society for Heart and Lung Transplantation: Thirty-Fourth Adult Lung and Heart-Lung Transplantation Report-2017; Focus Theme: Allograft Ischemic Time J. Heart Lung Transplant 2017, 36, 1047-1059. (3) Keating, A. Mesenchymal Stromal Cells: New Directions Cell Stem Cell 2012, 10, 709-716. (4) Makkar, R. R.; Smith, R. R.; Cheng, K.; Malliaras, K.; Thomson, L. E. J.; Berman, D.; Czer, L. S. C.; Marban, L.; Mendizabal, A.; Johnston, P. V.; Russell, S. D.; Schuleri, K. H.; Lardo, A. C.; Gerstenblith, G.; Marban, E. Intracoronary Cardiosphere-Derived Cells for


25


(5)

(6) (7)

(8) (9) (10)

(11)

(12)

(13)

(14) (15)

(16)

Page 26 of 31

Heart Regeneration after Myocardial Infarction (Caduceus): A Prospective, Randomised Phase 1 Trial Lancet 2012, 379, 895-904. Chong, J. J. H.; Yang, X. L.; Don, C. W.; Minami, E.; Liu, Y. W.; Weyers, J. J.; Mahoney, W. M.; Van Biber, B.; Cook, S. M.; Palpant, N. J.; Gantz, J. A.; Fugate, J. A.; Muskheli, V.; Gough, G. M.; Vogel, K. W.; Astley, C. A.; Hotchkiss, C. E.; Baldessari, A.; Pabon, L.; Reinecke, H.; Gill, E. A.; Nelson, V.; Kiem, H. P.; Laflamme, M. A.; Murry, C. E. Human Embryonic-Stem-Cell-Derived Cardiomyocytes Regenerate Non-Human Primate Hearts Nature 2014, 510, 273-277. Takahashi, K.; Yamanaka, S. Induction of Pluripotent Stem Cells from Mouse Embryonic and Adult Fibroblast Cultures by Defined Factors Cell 2006, 126, 663-676. Takahashi, K.; Tanabe, K.; Ohnuki, M.; Narita, M.; Ichisaka, T.; Tomoda, K.; Yamanaka, S. Induction of Pluripotent Stem Cells from Adult Human Fibroblasts by Defined Factors Cell 2007, 131, 861-872. McLaren, A. Ethical and Social Considerations of Stem Cell Research Nature 2001, 414, 129-131. Nelson, T. J.; Martinez-Fernandez, A.; Terzic, A. Induced Pluripotent Stem Cells: Developmental Biology to Regenerative Medicine Nat. Rev. Cardiol. 2010, 7, 700-710. Lian, X.; Hsiao, C.; Wilson, G.; Zhu, K.; Hazeltine, L. B.; Azarin, S. M.; Raval, K. K.; Zhang, J.; Kamp, T. J.; Palecek, S. P. Robust Cardiomyocyte Differentiation from Human Pluripotent Stem Cells Via Temporal Modulation of Canonical Wnt Signaling Proc. Natl. Acad. Sci. U.S.A. 2012, 109, E1848–E1857. Kawamura, M.; Miyagawa, S.; Miki, K.; Saito, A.; Fukushima, S.; Higuchi, T.; Kawamura, T.; Kuratani, T.; Daimon, T.; Shimizu, T.; Okano, T.; Sawa, Y. Feasibility, Safety, and Therapeutic Efficacy of Human Induced Pluripotent Stem Cell-Derived Cardiomyocyte Sheets in a Porcine Ischemic Cardiomyopathy Model Circulation 2012, 126, S29-37. Nelson, T. J.; Martinez-Fernandez, A.; Yamada, S.; Perez-Terzic, C.; Ikeda, Y.; Terzic, A. Repair of Acute Myocardial Infarction by Human Stemness Factors Induced Pluripotent Stem Cells Circulation 2009, 120, 408-416. Terrovitis, J.; Lautamäki, R.; Bonios, M.; Fox, J.; Engles, J. M.; Yu, J.; Leppo, M. K.; Pomper, M. G.; Wahl, R. L.; Seidel, J.; Tsui, B. M.; Bengel, F. M.; Abraham, M. R.; Marbán, E. Noninvasive Quantification and Optimization of Acute Cell Retention by in Vivo Positron Emission Tomography after Intramyocardial Cardiac-Derived Stem Cell Delivery J. Am. Coll. Cardiol. 2009, 54, 1619-1626. Robey, T. E.; Saiget, M. K.; Reinecke, H.; Murry, C. E. Systems Approaches to Preventing Transplanted Cell Death in Cardiac Repair J. Mol. Cell. Cardiol. 2008, 45, 567-581. Laflamme, M. A.; Chen, K. Y.; Naumova, A. V.; Muskheli, V.; Fugate, J. A.; Dupras, S. K.; Reinecke, H.; Xu, C.; Hassanipour, M.; Police, S.; O'Sullivan, C.; Collins, L.; Chen, Y.; Minami, E.; Gill, E. A.; Ueno, S.; Yuan, C.; Gold, J.; Murry, C. E. Cardiomyocytes Derived from Human Embryonic Stem Cells in Pro-Survival Factors Enhance Function of Infarcted Rat Hearts Nat. Biotechnol. 2007, 25, 1015-1024. O'Neill, H. S.; Gallagher, L. B.; O'Sullivan, J.; Whyte, W.; Curley, C.; Dolan, E.; Hameed, A.; O'Dwyer, J.; Payne, C.; O'Reilly, D.; Ruiz-Hernandez, E.; Roche, E. T.; O'Brien, F. J.; Cryan, S. A.; Kelly, H.; Murphy, B.; Duffy, G. P. Biomaterial-Enhanced Cell and Drug Delivery: Lessons Learned in the Cardiac Field and Future Perspectives Adv. Mater. 2016, 28, 5648-5661.


26

Page 27 of 31 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(17) Peppas, N. A.; Huang, Y.; Torres-Lugo, M.; Ward, J. H.; Zhang, J. Physicochemical, Foundations and Structural Design of Hydrogels in Medicine and Biology Annu. Rev. Biomed. Eng. 2000, 2, 9-29. (18) Li, X.; Zhou, J.; Liu, Z.; Chen, J.; Lu, S.; Sun, H.; Li, J.; Lin, Q.; Yang, B.; Duan, C.; Xing, M.; Wang, C. A Pnipaam-Based Thermosensitive Hydrogel Containing Swcnts for Stem Cell Transplantation in Myocardial Repair Biomaterials 2014, 35, 5679-5688. (19) Leor, J.; Gerecht, S.; Cohen, S.; Miller, L.; Holbova, R.; Ziskind, A.; Shachar, M.; Feinberg, M. S.; Guetta, E.; Itskovitz-Eldor, J. Human Embryonic Stem Cell Transplantation to Repair the Infarcted Myocardium Heart 2007, 93, 1278-1284. (20) Panda, N. C.; Zuckerman, S. T.; Mesubi, O. O.; Rosenbaum, D. S.; Penn, M. S.; Donahue, J. K.; Alsberg, E.; Laurita, K. R. Improved Conduction and Increased Cell Retention in Healed Mi Using Mesenchymal Stem Cells Suspended in Alginate Hydrogel J. Interv. Card. Electrophysiol. 2014, 41, 117-127. (21) Bearzi, C.; Gargioli, C.; Baci, D.; Fortunato, O.; Shapira-Schweitzer, K.; Kossover, O.; Latronico, M. V. G.; Seliktar, D.; Condorelli, G.; Rizzi, R. Plgf-Mmp9-Engineered Ips Cells Supported on a Peg-Fibrinogen Hydrogel Scaffold Possess an Enhanced Capacity to Repair Damaged Myocardium Cell Death Dis. 2014, 5. (22) Liu, Z.; Wang, H.; Wang, Y.; Lin, Q.; Yao, A.; Cao, F.; Li, D.; Zhou, J.; Duan, C.; Du, Z.; Wang, Y.; Wang, C. The Influence of Chitosan Hydrogel on Stem Cell Engraftment, Survival and Homing in the Ischemic Myocardial Microenvironment Biomaterials 2012, 33, 3093-3106. (23) Wang, H.; Shi, J.; Wang, Y.; Yin, Y.; Wang, L.; Liu, J.; Liu, Z.; Duan, C.; Zhu, P.; Wang, C. Promotion of Cardiac Differentiation of Brown Adipose Derived Stem Cells by Chitosan Hydrogel for Repair after Myocardial Infarction Biomaterials 2014, 35, 3986-3998. (24) Chen, C. H.; Chang, M. Y.; Wang, S. S.; Hsieh, P. C. H. Injection of Autologous Bone Marrow Cells in Hyaluronan Hydrogel Improves Cardiac Performance after Infarction in Pigs Am. J. Physiol. Heart Circ. Physiol. 2014, 306, H1078-H1086. (25) Chang, M. Y.; Huang, T. T.; Chen, C. H.; Cheng, B.; Hwang, S. M.; Hsieh, P. C. H. Injection of Human Cord Blood Cells with Hyaluronan Improves Postinfarction Cardiac Repair in Pigs Stem Cells Transl. Med. 2016, 5, 56-66. (26) Boekhoven, J.; Stupp, S. I. 25th Anniversary Article: Supramolecular Materials for Regenerative Medicine Adv. Mater. 2014, 26, 1642-1659. (27) Pappas, C. G.; Sasselli, I. R.; Ulijn, R. V. Biocatalytic Pathway Selection in Transient Tripeptide Nanostructures Angew. Chem. Int. Ed. Engl. 2015, 54, 8119-8123. (28) Olive, A. G. L.; Abdullah, N. H.; Ziemecka, I.; Mendes, E.; Eelkema, R.; van Esch, J. H. Spatial and Directional Control over Self-Assembly Using Catalytic Micropatterned Surfaces Angew. Chem. Int. Ed. Engl. 2014, 53, 4132-4136. (29) Onogi, S.; Shigemitsu, H.; Yoshii, T.; Tanida, T.; Ikeda, M.; Kubota, R.; Hamachi, I. In Situ Real-Time Imaging of Self-Sorted Supramolecular Nanofibres Nat. Chem. 2016, 8, 743752. (30) Newcomb, C. J.; Sur, S.; Lee, S. S.; Yu, J. M.; Zhou, Y.; Snead, M. L.; Stupp, S. I. Supramolecular Nanofibers Enhance Growth Factor Signaling by Increasing Lipid Raft Mobility Nano Lett. 2016, 16, 3042-3050. (31) Xie, F.; Qin, L.; Liu, M. A Dual Thermal and Photo-Switchable Shrinking-Swelling Supramolecular Peptide Dendron Gel Chem. Commun. 2016, 52, 930-933.


27


Page 28 of 31

(32) Hartgerink, J. D.; Beniash, E.; Stupp, S. I. Self-Assembly and Mineralization of PeptideAmphiphile Nanofibers Science 2001, 294, 1684-1688. (33) Webber, M. J.; Han, X.; Prasanna Murthy, S. N.; Rajangam, K.; Stupp, S. I.; Lomasney, J. W. Capturing the Stem Cell Paracrine Effect Using Heparin-Presenting Nanofibres to Treat Cardiovascular Diseases J. Tissue Eng. Regen. Med. 2010, 4, 600-610. (34) Yao, X.; Liu, Y.; Gao, J.; Yang, L.; Mao, D.; Stefanitsch, C.; Li, Y.; Zhang, J.; Ou, L.; Kong, D.; Zhao, Q.; Li, Z. Nitric Oxide Releasing Hydrogel Enhances the Therapeutic Efficacy of Mesenchymal Stem Cells for Myocardial Infarction Biomaterials 2015, 60, 130140. (35) Ban, K.; Park, H.-J.; Kim, S.; Andukuri, A.; Cho, K.-W.; Hwang, J. W.; Cha, H. J.; Kim, S. Y.; Kim, W.-S.; Jun, H.-W.; Yoon, Y.-S. Cell Therapy with Embryonic Stem Cell-Derived Cardiomyocytes Encapsulated in Injectable Nanomatrix Gel Enhances Cell Engraftment and Promotes Cardiac Repair ACS Nano 2014, 8, 10815-10825. (36) Chen, G.; Li, J.; Song, M.; Wu, Z.; Zhang, W.; Wang, Z.; Gao, J.; Yang, Z.; Ou, C. A Mixed Component Supramolecular Hydrogel to Improve Mice Cardiac Function and Alleviate Ventricular Remodeling after Acute Myocardial Infarction Adv. Funct. Mater. 2017, 1701798. (37) Kalafatovic, D.; Nobis, M.; Son, J.; Anderson, K. I.; Ulijn, R. V. Mmp-9 Triggered SelfAssembly of Doxorubicin Nanofiber Depots Halts Tumor Growth Biomaterials 2016, 98, 192-202. (38) Cai, Y.; Shen, H.; Zhan, J.; Lin, M.; Dai, L.; Ren, C.; Shi, Y.; Liu, J.; Gao, J.; Yang, Z. Supramolecular “Trojan Horse” for Nuclear Delivery of Dual Anticancer Drugs J. Am. Chem. Soc. 2017, 139, 2876-2879. (39) Han, J.; You, J.; Li, X.; Duan, P.; Liu, M. Full-Color Tunable Circularly Polarized Luminescent Nanoassemblies of Achiral Aiegens in Confined Chiral Nanotubes Adv. Mater. 2017, 1606503. (40) Lock, L. L.; Reyes, C. D.; Zhang, P.; Cui, H. Tuning Cellular Uptake of Molecular Probes by Rational Design of Their Assembly into Supramolecular Nanoprobes J. Am. Chem. Soc. 2016, 138, 3533-3540. (41) Lock, L. L.; Li, Y.; Mao, X.; Chen, H.; Staedtke, V.; Bai, R.; Ma, W.; Lin, R.; Li, Y.; Liu, G.; Cui, H. One-Component Supramolecular Filament Hydrogels as Theranostic Label-Free Magnetic Resonance Imaging Agents ACS Nano 2017, 11, 797-805. (42) Versluis, F.; van Elsland, D. M.; Mytnyk, S.; Perrier, D. L.; Trausel, F.; Poolman, J. M.; Maity, C.; le Sage, V. A. A.; van Kasteren, S. I.; van Esch, J. H.; Eelkema, R. Negatively Charged Lipid Membranes Catalyze Supramolecular Hydrogel Formation J. Am. Chem. Soc. 2016, 138, 8670-8673. (43) Feng, Z.; Wang, H.; Zhou, R.; Li, J.; Xu, B. Enzyme-Instructed Assembly and Disassembly Processes for Targeting Downregulation in Cancer Cells J. Am. Chem. Soc. 2017, 139, 3950-3953. (44) Wang, H.; Feng, Z.; Wang, Y.; Zhou, R.; Yang, Z.; Xu, B. Integrating Enzymatic SelfAssembly and Mitochondria Targeting for Selectively Killing Cancer Cells without Acquired Drug Resistance J. Am. Chem. Soc. 2016, 138, 16046-16055. (45) Hudalla, G. A.; Sun, T.; Gasiorowski, J. Z.; Han, H.; Tian, Y. F.; Chong, A. S.; Collier, J. H. Gradated Assembly of Multiple Proteins into Supramolecular Nanomaterials Nat. Mater. 2014, 13, 829-836.


28

Page 29 of 31 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(46) Wen, Y.; Collier, J. H. Supramolecular Peptide Vaccines: Tuning Adaptive Immunity Curr. Opin. Immunol. 2015, 35, 73-79. (47) Luo, Z.; Wu, Q.; Yang, C.; Wang, H.; He, T.; Wang, Y.; Wang, Z.; Chen, H.; Li, X.; Gong, C.; Yang, Z. A Powerful Cd8+ T-Cell Stimulating D-Tetra-Peptide Hydrogel as a Very Promising Vaccine Adjuvant Adv. Mater. 2017, 29, 1601776-n/a. (48) Bowerman, C. J.; Nilsson, B. L. A Reductive Trigger for Peptide Self-Assembly and Hydrogelation J. Am. Chem. Soc. 2010, 132, 9526-9527. (49) Piepenbrock, M.-O. M.; Lloyd, G. O.; Clarke, N.; Steed, J. W. Metal- and Anion-Binding Supramolecular Gels Chem. Rev. 2010, 110, 1960-2004. (50) Das, A. K.; Maity, I.; Parmar, H. S.; McDonald, T. O.; Konda, M. Lipase-Catalyzed Dissipative Self-Assembly of a Thixotropic Peptide Bolaamphiphile Hydrogel for Human Umbilical Cord Stem-Cell Proliferation Biomacromolecules 2015, 16, 1157-1168. (51) Nanda, J.; Biswas, A.; Adhikari, B.; Banerjee, A. A Gel-Based Trihybrid System Containing Nanofibers, Nanosheets, and Nanoparticles: Modulation of the Rheological Property and Catalysis Angew. Chem. Int. Ed. Engl. 2013, 52, 5041-5045. (52) Sun, Z.; Li, Z.; He, Y.; Shen, R.; Deng, L.; Yang, M.; Liang, Y.; Zhang, Y. Ferrocenoyl Phenylalanine: A New Strategy toward Supramolecular Hydrogels with Multistimuli Responsive Properties J. Am. Chem. Soc. 2013, 135, 13379-13386. (53) Ou, C.; Zhang, J.; Zhang, X.; Yang, Z.; Chen, M. Phenothiazine as an Aromatic Capping Group to Construct a Short Peptide-Based 'Super Gelator' Chem. Commun. 2013, 49, 18531855. (54) Raeburn, J.; Cardoso, A. Z.; Adams, D. J. The Importance of the Self-Assembly Process to Control Mechanical Properties of Low Molecular Weight Hydrogels Chem. Soc. Rev. 2013, 42, 5143-5156. (55) Jayawarna, V.; Ali, M.; Jowitt, T. A.; Miller, A. F.; Saiani, A.; Gough, J. E.; Ulijn, R. V. Nanostructured Hydrogels for Three-Dimensional Cell Culture through Self-Assembly of Fluorenylmethoxycarbonyl–Dipeptides Adv. Mater. 2006, 18, 611-614. (56) Wu, J.; Zou, Y.; Li, C.; Sicking, W.; Piantanida, I.; Yi, T.; Schmuck, C. A Molecular Peptide Beacon for the Ratiometric Sensing of Nucleic Acids J. Am. Chem. Soc. 2012, 134, 1958-1961. (57) Yang, Z.; Liang, G.; Guo, Z.; Guo, Z.; Xu, B. Intracellular Hydrogelation of Small Molecules Inhibits Bacterial Growth Angew. Chem. Int. Ed. Engl. 2007, 46, 8216-8219. (58) Sakai, N.; Kamikawa, Y.; Nishii, M.; Matsuoka, T.; Kato, T.; Matile, S. Dendritic Folate Rosettes as Ion Channels in Lipid Bilayers J. Am. Chem. Soc. 2006, 128, 2218-2219. (59) Wang, H.; Yang, C.; Wang, L.; Kong, D.; Zhang, Y.; Yang, Z. Self-Assembled Nanospheres as a Novel Delivery System for Taxol: A Molecular Hydrogel with Nanosphere Morphology Chem. Commun. 2011, 47, 4439-4441. (60) Kato, T.; Matsuoka, T.; Nishii, M.; Kamikawa, Y.; Kanie, K.; Nishimura, T.; Yashima, E.; Ujiie, S. Supramolecular Chirality of Thermotropic Liquid ‐ Crystalline Folic Acid Derivatives Angew. Chem. Int. Ed. Engl. 2004, 43, 1969-1972. (61) Ren, C.; Song, Z.; Zheng, W.; Chen, X.; Wang, L.; Kong, D.; Yang, Z. Disulfide Bond as a Cleavable Linker for Molecular Self-Assembly and Hydrogelation Chem. Commun. 2011, 47, 1619-1621. (62) Guo, C.; Arnon, Z. A.; Qi, R.; Zhang, Q.; Adler-Abramovich, L.; Gazit, E.; Wei, G. Expanding the Nanoarchitectural Diversity through Aromatic Di- and Tri-Peptide Coassembly: Nanostructures and Molecular Mechanisms ACS Nano 2016, 10, 8316-8324.


29


Page 30 of 31

(63) Reches, M.; Gazit, E. Casting Metal Nanowires within Discrete Self-Assembled Peptide Nanotubes Science 2003, 300, 625-627. (64) Christina, M.; Andreas, M.; Rojas, S. V.; Tilman, S.; Christian, R.; Natalie, S.; Sandra, M.; Silke, G.; Robert, Z.; Axel, H. Induced Pluripotent Stem Cell (Ipsc)-Derived Flk-1 Progenitor Cells Engraft, Differentiate, and Improve Heart Function in a Mouse Model of Acute Myocardial Infarction Eur. Heart J. 2011, 32, 2634-2641. (65) Yan, B.; Abdelli, L. S.; Singla, D. K. Transplanted Induced Pluripotent Stem Cells Improve Cardiac Function and Induce Neovascularization in the Infarcted Hearts of Db/Db Mice Mol. Pharm. 2011, 8, 1602-1610. (66) Plotkin, M.; Vaibavi, S. R.; Rufaihah, A. J.; Nithya, V.; Wang, J.; Shachaf, Y.; Kofidis, T.; Seliktar, D. The Effect of Matrix Stiffness of Injectable Hydrogels on the Preservation of Cardiac Function after a Heart Attack Biomaterials 2014, 35, 1429-1438. (67) Nishina, T.; Nishimura, K.; Yuasa, S.; Miwa, S.; Nomoto, T.; Sakakibara, Y.; Handa, N.; Hamanaka, I.; Saito, Y.; Komeda, M. Initial Effects of the Left Ventricular Repair by Plication May Not Last Long in a Rat Ischemic Cardiomyopathy Model Circulation 2001, 104, 241-245. (68) Wang, H.; Xi, Y.; Zheng, Y.; Wang, X.; Cooney, A. J. Generation of Electrophysiologically Functional Cardiomyocytes from Mouse Induced Pluripotent Stem Cells Stem Cell Res. 2016, 16, 522-530. (69) Tang, J. M.; Luo, B.; Xiao, J. H.; Lv, Y. X.; Li, X. L.; Zhao, J. H.; Zheng, F.; Zhang, L.; Chen, L.; Yang, J. Y. Vegf-a Promotes Cardiac Stem Cell Engraftment and Myocardial Repair in the Infarcted Heart Int. J. Cardiol. 2015, 183, 221-231.


30

Page 31 of 31 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Table of Contents Folic Acid-Derived Hydrogel Enhances the Survival and Promotes Therapeutic Efficacy of iPS Cells for Acute Myocardial Infarction


31

Folic Acid-Derived Hydrogel Enhances the Survival and Promotes

Recommend Documents