Four-Way Junction Formation Promoting Ultrasensitive

Sep 18, 2013 - Department of Chemistry, University of Central Florida, 4000 Central Blvd, Orlando, Florida 32816, United States. § The Burnett School...
1 downloads 8 Views 366KB Size
Download PDF
Subscriber access provided by University of Chicago Library

Letter

Four-Way Junction Formation Promotes Ultrasensitive Electrochemical Detection of MicroRNA Mahmoud Labib, Shahrokh M. Ghobadloo, Nasrin Khan, Dmitry Mikhaylovich Kolpashchikov, and Maxim V Berezovski Anal. Chem., Just Accepted Manuscript • DOI: 10.1021/ac402416z • Publication Date (Web): 18 Sep 2013 Downloaded from http://pubs.acs.org on September 19, 2013

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

Analytical Chemistry is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 6

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Analytical Chemistry

Four-Way Junction Formation Promotes Ultrasensitive Electrochemical Detection of MicroRNA Mahmoud Labiba, Shahrokh M. Ghobadlooa, Nasrin Khana, Dmitry M. Kolpashchikovb,c and Maxim V. Berezovskia* a

b

Department of Chemistry, University of Ottawa, 10 Marie Curie, Ottawa, Ontario K1N 6N5, Canada. Department c of Chemistry, University of Central Florida, 4000 Central Blvd, Orlando, FL 32816, USA. The Burnett School of Biomedical Sciences, College of Medicine, University of Central Florida, Orlando, FL, USA. *Corresponding author: M.V. Berezovski ([email protected]) Supporting Information Placeholder ABSTRACT: MicroRNAs (miRNAs) represent a class of biomarkers that are frequently deregulated in cancer cells and have shown a great promise for cancer classification and prognosis. Here, we endeavored to develop a DNA four-way junction based electrochemical sensor (4J-SENS) for ultrasensitive miRNA analysis. The developed sensor can be operated within the dynamic range from 10 aM to 1 fM and detect as low as 2 aM of miR-122 (~36 molecules per sample), without PCR amplification. Furthermore, the 4J-SENS was employed to profile endogenouse hsa-miR-122 in healthy human and chronic lymphocyitc leukemia (CLL) patient serum and the results were validated by qPCR analysis.

MicroRNAs are an emerging class of diagnostic markers that can signify the presence of diseases and can be employed to 1 predict its course. The expression profiles of circulating miRNAs are correlated with various diseases, including tu2 3 4 mor metastasis, diabetes, viral infections, and tissue dam5 age after stroke. Although RNA molecules were thought to be unstable, circulating miRNAs are in fact highly stable in blood inside microparticles and exosomes or in a complex 6 with RNA binding proteins like Nucleophosmin1. Therefore, these circulating miRNAs can be utilized as minimally inva7 sive biomarkers for diagnosis of human cancers. Over the last four decades, hybridization based techniques have been extensively used for the analysis of nucleic acids, including 8 real-time polymerase chain reaction (PCR), microarray 9 10 based methods, capillary electrophoresis, and electrochem11 ical sensors. Unfortunately, PCR is susceptible to contamination, lacks portability, and requires highly qualified per12 sonnel. Also, the lack of sensitivity of existing arrays is related to the type of readout used, namely fluorescence sig13-15 nals emitted from a labeled RNA. On the contrary, electrochemical sensors have long been viewed as particularly attractive for bioanalysis because of their high sensitivity, 16 rapidity, low cost, and ease of use. In this context, an impressive attomolar level of sensitivity for miRNA detection was achieved using a hybridization based electrochemical

17-19

sensor. However, this sensor required nanostructuring of patterned microelectrodes using photolithography. In this work, we developed a DNA four-way junction based electrochemical sensor (4J-SENS) for miRNA analysis that would feature the convenience of commercial screen-printed based electrochemical sensing and augment the sensitivity required to detect low abundant blood circu20 lating miRNAs such as hsa-miR-122, a biomarker for several 21 types of cancer. Typical levels of circulating miRNAs in se22 rum were estimated to be from 200 aM to 20 pM range. Hence, there is an urge for sensors that can operate in the atto-femtomolar range to guard against the potential underestimation of miRNA level. The 4J-SENS is a multicomponent sensor that consists of a universal interfacial probe (UIP) and two DNA adaptor strands, namely strand C and a biotin-labeled strand H, which cooperatively hybridize with both UIP and the target miRNA. A schematic representation of the sensor is shown in Fig. 1A, whereas the detailed sensor design is provided in Fig. S1. Each adaptor strand has a fragment complementary to UIP (UIP-binding arm) and a fragment complementary to the analyzed RNA (miRNAbinding arm). In the absence of the target miRNA, the adaptor strands do not interact with the surface-bound UIP, because the UIP stem-loop structure is more thermodynamically stable than the associate with the adaptor strands. The adaptor strands were designed with a short UIP-binding arm to prevent their hybridization with the detection probe in absence of the miRNA. In the presence of the target sequence, the two adaptor strands hybridize to UIP and miRNA, thus resulting in the formation of a quadripartite complex with a four-way junction structure. This complex can capture a large streptavidin molecule (~53 kDa with nearneutral pI) to produce a significant increase in the interfacial resistance of the sensor surface and hence improve the sensitivity. Prior to experiments, a gold nanoparticles-modified screen-printed carbon electrode (Dropsens, Spain) was washed thoroughly with deionized nuclease-free water then dried with N2. Afterward, the electrode was incubated with 1 µM of the HPLC purified UIP, with the sequence HO-(CH2)6-

ACS Paragon Plus Environment

Analytical Chemistry 5'

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

3'

S-S-(CH2)6– (T10)CGCGTTAACATACAATAGATCGCG , modified at the 5' position with a 6-hydroxyhexyl disulfide linker in the incubation buffer, 25 mM phosphate buffer (pH 23 7) containing 25 mM NaCl, for 5 days at 4 °C. Finally, the electrode was incubated with 0.1 mM 2-mercaptoethanol in ethanol for 5 min to reduce the non-specific adsorption onto the surface. All oligonucleotides were custom-made by Integrated DNA Technologies (U.S.).

Figure 1. (A) Schematic representation of the 4J-SENS for detection of miR-122. (a) A thiol-modified UIP probe was self-assembled onto the electrode surface followed by back-filling the unoccupied spots with 2-mercaptoethanol. Afterward, the sensor was incubated with a mixture of strand C, biotin-labeled strand H, and miR-122. (b) Incubation of the sensor with streptavidin causes a decrease in the current density, measured by square wave voltammetry (SWV). (B) Square wave voltammograms obtained using (a) buffer alone (b) 1 aM, (c) 10 aM, (d) 100 aM, and (e) 1 fM of miR-122 in the incubation buffer. The current density was measured (a) after surface backfilling, jb, (red curve) and (b) after incubation with streptavidin, ja, (green curve). (C) A calibration plot of the change in current density, Δj (jb – ja) vs. log concentration of miR-122 in M.

Prior to titration experiments, aliquots containing different concentrations of the miR-122, 5' 3' pUGGAGUGUGACAAUGGUGUUUG , including 2 aM, 20 aM, 200 aM, and 2 fM in 15 µL of the incubation buffer were mixed with 7.5 µL of 1 µM of strand C 5' 3' ( CAAACACCATTATGTTAAC ) and 7.5 µL of 1 µM of biotinlabeled strand H (5Biosg– 5' 3' (T10)GATCTATTGTGTCACACTCCA , modified at the 5' position with biotin, and the mixture was incubated with each electrode at 25°C for 1 h in a dark humidity chamber. Subsequently, the electrodes were washed with the incubation buffer and then incubated with 8.3 µM of streptavidin –1 (0.001 U µL , Jackson ImmunoResearch, Laboratories, Inc., U.S.) at 25 °C for 30 min. After washing with the incubation buffer, square wave voltammetry (SWV) was performed at each concentration in the detection buffer, 25 mM phosphate buffer (pH 7), containing 25 mM NaCl, 4 mM K3[Fe(CN)6], and 10 µM [Ru(NH3)6]Cl3. It was observed that the binding between miR-122 and the immobilized capture probe followed by incubation with streptavidin causes a decrease in the current density (signal OFF), as shown in Fig. 1B. Experimental details of the electrochemical measurements are provided in the Supporting Information. The current density was measured (a) after surface backfilling, jb, and (b) after

Page 2 of 6

incubation with streptavidin, ja, and the change in current density, Δj = (jb – ja), was calculated for each miR-122 concentration. As shown in Fig. 1C, the Δj value increases linearly with increasing the concentration of miR-122, in the range from 10 aM to 1 fM, which corresponds to approximately 6 8 6×10 to 6×10 molecules/L. A regression equation of y = – 350.83x + 6571.3 (R2 = 0.964) was obtained, where y is the Δj −2 value in µA cm and x is the logarithmic concentration of miR-122 in M. The relative standard deviation (RSD) values were between 7.0% and 24.4%. Beyond the upper miR-122 level, the response became nonlinear, indicating the saturation of the surface with the target molecules. The limit of 5 detection (LOD) is 2 aM (~12×10 molecules/L or 36 molecules per 30 µL sample), estimated from 3(Sb/m), where Sb is the standard deviation of the measurement signal for a 1 fM of a non-specific binder (miR-32) and m is the slope of the 24 analytical curve in the linear region. To assess the enhanced sensitivity of the developed 4J-SENS, we compared it with a hybridization based sensor (H-SENS) developed for miR-122, as shown in Fig. 2A. Briefly, the cleaned electrode was incubated with 1 µM of the detection probe for miR-122 with the sequence 5' 3' pCAAACACCAUUGUCACACUCCA –(CH2)6-S-S-(CH2)6OH, containing a phosphate group at the 5' position (denoted with p) and modified at the 3' position with a 6-hydroxyhexyl disulfide group in the incubation buffer. Subsequently, the surface of the electrode was back-filled by incubation with 0.1 mM 2-mercaptoethanol in ethanol for 5 min.

Figure 2. (A) Schematic representation of the H-SENS for detection of miR-122. (a) A thiol-modified complementary probe for miR-122 was self-assembled onto the electrode surface followed by backfilling the unoccupied spots with 2-mercaptoethanol. (b) Incubation with miR-122 causes an increase in the current density measured by square wave voltammetry (SWV). (B) Square wave voltammograms obtained using (a) buffer alone, (b) 1 fM, (c) 10 fM, (d) 100 fM, (e) 1 pM, and (f) 10 pM of miR-122 in the incubation buffer. The current density was measured (a) after surface backfilling, jb, (red curve) and (b) after incubation with miR-122, ja, (blue curve). (C) A calibration plot of the change in current density, Δj (jb – ja) vs. log concentration of miR-122 in M.

Prior to titration experiments, aliquots containing different concentrations of the miR-122, including 1 fM, 10 fM, 100 fM, 1 pM, and 10 pM in 30 µL of the incubation buffer were incubated with the probe-modified electrode surface at 37 °C for 1 h in a dark humidity chamber. After washing with

ACS Paragon Plus Environment

Page 3 of 6

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Analytical Chemistry

the incubation buffer, SWV was performed at each concentration using the same electrocatalytic reporter, 4 mM K3[Fe(CN)6] and 10 µM [Ru(NH3)6]Cl3 in the incubation buffer. This electrocatalytic reporter system was previously utilized for electronic amplification and high-sensitivity 25 readout. The approach relies on the primary electron accep3+ tor [Ru(NH3)6] , which is attracted electrostatically to the electrode surface at levels that are correlated with the amount of bound probe molecules. The inclusion of 3− [Fe(CN)6] during the electrochemical measurement serves III to regenerate the Ru and allow multiple reductions per III metal center. Subsequently, the Fe is repelled electrostatically from the electrode and hence primarily undergoes II chemical reduction by Ru . Admittedly, some direct electroIII chemical reduction of Fe is expected to occur. As shown in Fig. 2B, it was observed that the binding between miR-122 and the immobilized capture probe causes an increase in the current density (signal ON). This increase in current upon hybridization can be attributed to the increase in the number 3+ of the primary electron acceptor molecules, [Ru(NH3)6] , 26 which is attracted electrostatically to the RNA molecules. The current density was measured (a) after surface backfilling, jb, and (b) after incubation with miR-122, ja, and the change in current density, Δj = (ja – jb), was calculated for each miR-122 concentration. As shown in Fig. 2C, the Δj value decreases linearly with increasing the concentration of miR-122, in the range from 1 fM to 10 pM, (corresponds to 8 12 approximately 6×10 to 6×10 molecules/L). A regression equation of y = 96.01x + 1613.2 (R2 = 0.9467) was obtained, −2 where y is the Δj value in µA cm and x is the logarithmic concentration of miR-122 in M. The RSD values are between 5.1% and 19.8%. Beyond the upper miR-122 level, the response became nonlinear, indicating the saturation of the surface 7 with the target molecules. The LOD is 0.14 fM (~8.4×10 molecules/L or ~2500 molecules per sample).

gle-base mismatch containing strand and a fully-matched one.

As shown in Fig. 3A and Fig. S2, the selectivity of the developed 4J-SENS was tested with reference to incubation with 1 fM of fully-matched miR-122 and 1 µM of the adaptor strands, followed by incubation with 8.3 µM of strep−2 tavidin (100%, 1128.4 µA cm ). Incubation of buffer with the adaptor strands followed by incubation with straptavidin −2 caused 21.4% increase in the Δj value (241.6 µA cm ). Incubation of the sensor with 1 fM of miR-122 with a middle singlebase mismatch (C allele, M-SBMc) with the sequence, 5' 3' pUGGAGUGUGACAAUGGCGUUUG , and the adaptor strands followed by incubation with streptavidin caused −2 55.5% increase in the Δj value (626.7 µA cm ). Incubation of the sensor with 1 fM of miR-122 with a middle single-base mismatch (U allele, M-SBMu) with the sequence, 5' 3' pUGGAGUUUGACAAUGGCGUUUG , and the adaptor strands followed by incubation with streptavidin caused −2 63.3% increase in the Δj value (714.7 µA cm ). Incubation of the sensor with 1 fM of miR-122 with a terminal single-base mismatch (C allele, T-SBMc) with the sequence, 5' 3' pUGGAGUGUGACAAUGGCGUUUC , and the adaptor strands followed by incubation with streptavidin caused −2 86.2% increase in the Δj value (972.3 µA cm ).

Figure 3. (A) Selectivity of the 4J-SENS employed for detection of 1 fM of fully-matched miR-122 in buffer. Eight control experiments were performed using a mixture of the adaptor strands and (i) buffer; (ii) 1 fM miR-122 with a middle single-base mismatch (C allele, MSBMc); (iii) 1 fM miR-122 with a middle single-base mismatch (U allele, M-SBMu); (iv) 1 fM miR-122 with a terminal single-base mismatch (C allele, T-SBMc); (v) 1 fM of miR-21; (vi) 1 fM of miR-32; (vii) 100 pM of UIP complement, followed by incubation with the adaptor strands and miR-122; and (viii) miR-122 alone in absence of the adaptor strands. (B) Performance of the 4J-SENS employed for detection of endogenous hsa-miR-122 in healthy human serum and CLL patient serum. Five control experiments were performed using: (i) 5.1 mg mL–1 HSA; (ii) 100 mg mL–1 yeast tRNA; (iii) a thiol-modified A/U rich probe, instead of UIP, incubated with a mixture of the adaptor strands and healthy human serum; (iv) 100 pM UIP complement followed by incubation of the sensor with the adaptor strands and human serum; (v) healthy human serum alone in absence of the adaptor strands. All experiments in (A) and (B) were followed by incubation with 8.3 µM of streptavidin. Measurements of the current densities were performed after (a) surface backfilling (jb) and (b) after incubation with the test solution (ja). The inset represents the comparison of level of hsa-miR-122 in healthy human and CLL patient sera obtained by qRT-PCR with 40 cycles. The values of standard deviation were obtained from three independent measurements.

The results reveal the ability of the developed sensor to distinguish between a fully matched strand and strands containing a middle single-base mismatch. However, the sensor could poorly distinguish between a terminal sin-

Incubation of the sensor with non specific miRNAs, includ5' 3' ing 1 fM miR-21 ( pUAGCUUAUCAGACUGAUGUUGA ) or 1 5' 3' fM miR-32 ( pUAUUGCACAUUACUAAGUUGCA ) and the adaptor strands followed by incubation with streptavidin

ACS Paragon Plus Environment

Analytical Chemistry −2

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

−2

caused (14%, 158.5 µA cm ) and (15.8%, 177.9 µA cm ) increase in the Δj value, respectively. Furthermore, incubation of the sensor with 100 pM of a UIP complement 5' 3' ( CGATCTATTGTATGTTAACG ), at 25 °C for 1 h followed by incubation with a mixture of miR-122 and the adaptor strands and subsequent incubation with streptavidin caused −2 33.2% decrease in the Δj value (–374.1 µA cm ). Finally, incubation of the sensor with the 1 fM of miR-122 alone followed by incubation with streptavidin caused 11.4% increase in the −2 Δj value (128.4 µA cm ). The developed 4J-SENS was employed for endogenous hsa-miR-122 detection in healthy human serum and CLL patient serum. Seven sensors were prepared; six of them were modified with 1 µM of UIP. The seventh electrode was incubated with a non-specific A/U rich probe with the se5’ 3’ quence pUAAAACUUAGUAAUGUAUAAUA –(CH2)6-S-S(CH2)6OH. All probes were dissolved in the incubation buffer and incubated with the electrodes for 5 days at 4 °C followed by back-filling with 0.1 mM 2-mercaptoethanol in ethanol for 5 min. Two samples from human serum from healthy donor pooled gender and CLL patient were purchased from Bioreclamation LLC (NY, U.S.). Prior to experiments, 1 mL of each –1 serum sample was treated with 100 µL of 100 mg mL yeast tRNA (Calbiochem, Germany) to protect the endogenous miRNAs from the action of nucleases. Subsequently, a serum aliquot was 10X diluted in the incubation buffer and heated for 15 min at 95 °C to release the miRNAs from their inclusions in microparticles and exosomes. Next, 15 µL of the diluted serum were mixed with 1 µM of strand C (7.5 µL) and 1 µM of biotin-labeled strand H (7.5 µL) in the incubation buffer at 25 °C for 1 h. Afterward, the electrode was washed with the incubation buffer and then incubated with 8.3 µM of streptavidin in the incubation buffer at 25 °C for 30 min. Five control experiments were performed, two of them were car–1 ried out using 5.1 mg mL of human serum albumin (HSA, –1 Sigma-Aldrich, U.S.) and 100 mg mL yeast tRNA (Calbiochem, Germany) instead of the serum. The third control was carried out by incubating the A/U rich probe based sensor with the healthy human serum/adaptor strands cocktail followed by incubation with streptavidin. In the fourth control, the UIP based sensor was first incubated with 100 pM of a UIP complement at 25 °C for 1 h. Subsequently, the electrode was incubated with the healthy human serum/adaptor strands cocktail followed by incubation with streptavidin. The fifth control was carried out by incubating the UIP based sensor with the healthy human serum alone followed by incubation with streptavidin. As shown in Fig. 3B and Fig. S3, the results revealed that the level of hsa-miR-122 is higher in the CLL patient serum compared to the healthy human serum. In addition, the sensor can be utilized successfully to profile the abundance of endogenous microRNAs in serum and distinguish them from background signals of HSA, tRNA, and streptavidin molecules. Quantitative real-time RT-PCR (qRT-PCR) analysis of the undiluted healthy human serum and CLL patient serum showed that the level of hsamiR-122 is higher in the CLL patient serum than the healthy human one (inset of Fig. 3B). Experimental details of miR122 extraction from serum samples and qRT-PCR analysis are provided in the Supporting Information. To sum up, we developed a DNA four-way junction based electrochemical sensor (4J-SENS) for instantaneous

Page 4 of 6

ultrasensitive detection of miRNAs. The indirect binding of the detection probe to the analyte makes this approach readily adaptable for the analysis of any given miRNA sequence by simple replacement of the analyte-binding arms of the adaptor strands. In addition, the 4J-SENS is capable of detecting miRNA directly in human blood serum without any pre-concentration steps. Also, the developed sensor is not regenerable and based on screen-printed electrodes that are cheap and commercially available. This is envisaged to open a new venue for large-scale production of disposable one-shot miRNAs diagnostics with significant impact on early detection of diseases using biological fluids (blood, saliva, urine, etc.) in clinical settings.

ASSOCIATED CONTENT Supporting Information Electrochemical measurements, miRNA extraction from serum procedure, qPCR experiments, schematic representation of the 4J-SENS design, square wave voltammograms of the 4J-SENS selectivity and performance in serum. This material is available free of charge via the Internet at http://pubs.acs.org.”.

AUTHOR INFORMATION Corresponding Author *Maxim Berezovski, E-mail: [email protected]. Phone: 613-562-5600 (1898).

Notes The authors declare no competing financial interests.

ACKNOWLEDGMENT Authors thank the Natural Sciences and Engineering Research Council of Canada (M.V.B.), the Early Research Award from the Ministry of Economic Development and Innovation of Ontario (M.V.B.), Mitacs Elevate Fellowship Program (M.L.) for funding this work, and NIHGRI R21 HG004060 and NSF CCF 1117205 (D.M.K.) for funding this work.

REFERENCES (1) Ambros, V. Nature 2004, 431, 350-355. (2) Nicoloso, M. S.; Spizzo, R.; Shimizu, M.; Rossi, S.; Calin, G. A. Nat. Rev. Cancer 2009, 9, 293-302. (3) Nielsen, L. B.; Wang, C.; Sorensen, K.; Bang-Berthelsen, C. H.; Hansen, L.; Andersen, M. L.; Hougaard, P.; Juul, A.; Zhang, C. Y.; Pociot, F.; Mortensen, H. B. Exp. Diabetes Res. 2012, 2012, 896362. (4) Cullen, B. R. Nature 2009, 457, 421-425. (5) Laterza, O. F.; Lim, L.; Garrett-Engele, P. W.; Vlasakova, K.; Muniappa, N.; Tanaka, W. K.; Johnson, J. M.; Sina, J. F.; Fare, T. L.; Sistare, F. D.; Glaab, W. E. Clin. Chem. 2009, 55, 1977-1983. (6) Zen, K.; Zhang, C. Y. Med. Res. Rev. 2010, 32, 326-348. (7) Mitchell, P. S.; Parkin, R. K.; Kroh, E. M.; Fritz, B. R.; Wyman, S. K.; Pogosova-Agadjanyan, E. L.; Peterson, A.; Noteboom, J.; O'Briant, K. C.; Allen, A.; Lin, D. W.; Urban, N.; Drescher, C. W.; Knudsen, B. S.; Stirewalt, D. L.; Gentleman, R.; Vessella, R. L.; Nelson, P. S.; Martin, D. B.; Tewari, M. Proc. Natl. Acad. Sci. U S A 2008, 105, 10513-10518.

ACS Paragon Plus Environment

Page 5 of 6

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Analytical Chemistry

(8) Zhi, F.; Cao, X.; Xie, X.; Wang, B.; Dong, W.; Gu, W.; Ling, Y.; Wang, R.; Yang, Y.; Liu, Y. PLoS One 2013, 8, e56718. (9) Liu, C. G.; Calin, G. A.; Meloon, B.; Gamliel, N.; Sevignani, C.; Ferracin, M.; Dumitru, C. D.; Shimizu, M.; Zupo, S.; Dono, M.; Alder, H.; Bullrich, F.; Negrini, M.; Croce, C. M. Proc. Natl. Acad. Sci. U S A 2004, 101, 9740-9744. (10) Khan, N.; Cheng, J.; Pezacki, J. P.; Berezovski, M. V. Anal. Chem. 2011, 83, 6196-6201. (11) Fang, Z.; Kelley, S. O. Anal. Chem. 2009, 81, 612-617. (12) Gerasimova, Y. V.; Peck, S.; Kolpashchikov, D. M. Chem. Commun. (Camb) 2010, 46, 8761-8763. (13) Rosenfeld, N.; Aharonov, R.; Meiri, E.; Rosenwald, S.; Spector, Y.; Zepeniuk, M.; Benjamin, H.; Shabes, N.; Tabak, S.; Levy, A.; Lebanony, D.; Goren, Y.; Silberschein, E.; Targan, N.; Ben-Ari, A.; Gilad, S.; Sion-Vardy, N.; Tobar, A.; Feinmesser, M.; Kharenko, O.; Nativ, O.; Nass, D.; Perelman, M.; Yosepovich, A.; Shalmon, B.; Polak-Charcon, S.; Fridman, E.; Avniel, A.; Bentwich, I.; Bentwich, Z.; Cohen, D.; Chajut, A.; Barshack, I. Nat. Biotechnol. 2008, 26, 462-469. (14) Kolpashchikov, D. M. Chem. Rev. 2010, 110, 4709-4723. (15) Cornett, E. M.; O'Steen, M. R.; Kolpashchikov, D. M. PLoS One 2013, 8, e55919. (16) Katz, E.; Willner, I. Electroanalysis 2003, 15, 913-947. (17) Soleymani, L.; Fang, Z.; Sargent, E. H.; Kelley, S. O. Nat. Nanotechnol. 2009, 4, 844-848. (18) Yang, H.; Hui, A.; Pampalakis, G.; Soleymani, L.; Liu, F. F.; Sargent, E. H.; Kelley, S. O. Angew. Chem. Int. Ed. Engl. 2009, 48, 8461-8464. (19) Vasilyeva, E.; Lam, B.; Fang, Z.; Minden, M. D.; Sargent, E. H.; Kelley, S. O. Angew. Chem. Int. Ed. Engl. 2011, 50, 413741. (20) Labib, M.; Khan, N.; Ghobadloo, S. M.; Cheng, J.; Pezacki, J. P.; Berezovski, M. V. J. Am. Chem. Soc. 2013, 135, 302738. (21) Zhang, Y.; Jia, Y.; Zheng, R.; Guo, Y.; Wang, Y.; Guo, H.; Fei, M.; Sun, S. Clin. Chem. 2010, 56, 1830-8. (22) Tsujiura, M.; Ichikawa, D.; Komatsu, S.; Shiozaki, A.; Takeshita, H.; Kosuga, T.; Konishi, H.; Morimura, R.; Deguchi, K.; Fujiwara, H.; Okamoto, K.; Otsuji, E. Brit. J. Cancer, 2010, 102, 1174-79. (23) Shamsi, M. H.; Kraatz, H. -B. Analyst, 2011, 136, 3107-12. (24) Bard, A. J.; Faulkner, L. R. Electrochemical Methods: Fundamental and Applications; Wiley, New York, 2001. (25) Lapierre, M. A.; O'Keefe, M.; Taft, B. J.; Kelley, S. O. Anal. Chem. 2003, 75, 6327-33. (25) Gasparac, R.; Taft, B. J.; Lapierre-Devlin, M. A.; Lazareck, A. D.; Xu, J. M.; Kelley, S. O. J. Am. Chem. Soc. 2004, 126, 12270-12271.

ACS Paragon Plus Environment

Analytical Chemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

For TOC

ACS Paragon Plus Environment

Page 6 of 6