Subscriber access provided by UNIV OF MISSISSIPPI
Communication
FRET Nano-flares for Intracellular mRNA Detection: Avoiding False Positive Signal and Minimizing Effect of System Fluctuations Yanjing Yang, Jin Huang, Xiaohai Yang, Ke Quan, He Wang, Le Ying, Nuli Xie, Min Ou, and Kemin Wang J. Am. Chem. Soc., Just Accepted Manuscript • Publication Date (Web): 25 Jun 2015 Downloaded from http://pubs.acs.org on June 25, 2015
Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.
Journal of the American Chemical Society is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.
Page 1 of 5
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
Journal of the American Chemical Society
FRET Nano-flares for Intracellular mRNA Detection: Avoiding False Positive Signal and Minimizing Effect of System Fluctuations Yanjing Yang‡, Jin Huang‡, Xiaohai Yang, Ke Quan, He Wang, Le Ying, Nuli Xie, Min Ou, Kemin Wang*， State Key Laboratory of Chemo/Biosensing and Chemometrics, College of Chemistry and Chemical Engineering, Key Laboratory for Bio-Nanotechnology and Molecular Engineering of Hunan Province, Hunan University, Changsha 410082, P. R. China
Supporting Information Placeholder ABSTRACT: A new class of intracellular nanoprobe, termed FRET nano-flares, was developed to sense mRNA in living cells. It consists of a gold nanoparticle (AuNP), recognition sequences and flares. Briefly, the AuNP functionalized with recognition sequences hybridized to flares, which are designed as hairpin structures and fluorescently labeled donors and acceptors at two ends, respectively. In the absence of targets, the flares are captured by binding with the recognition sequences, separating of the donor and acceptor, inducing low FRET efficiency. However, in the presence of targets, the flares are gradually displaced from the recognition sequences by the targets, subsequently forming hairpin structures, bringing the donor and acceptor into close proximity and resulting in high FRET efficiency. Compared to the conventional single-dye nano-flares, the upgraded FRET nano-flares can avoid false positive signals by chemical interferences (such as nuclease and GSH) and thermodynamic fluctuations. Moreover, the signal generation in FRET nano-flares can be easily made with ratiometric measurement, minimizing the effect of system fluctuations.
signals in case that the thermodynamic fluctuations, glutathione (GSH) competition, nuclease degradation or protein binding released those single-dye-labeled flares from AuNPs.13 To meet the demand for sensitive and selective detection of mRNA in vivo and to overcome limitations of existing AuNPbased probes, we plan to develop an new and upgraded nanoflares, which utilize two-fluorophore-labeled ‘flares’ for ratiometric fluorescent measurement of mRNA in living cells based on fluorescence resonance energy transfer (FRET). Since FRET involves the nonradiative transfer of energy from an excited-state fluorophore (donor) to a second chromophore (acceptor) in a close proximity (less than 10 nm).14 FRET imaging that allows the simultaneous recording of two emission intensities at different wavelengths in the presence or absence of analytes can provide a feasible approach for precise detection.15 Recognition sequence AuNP
TTTTTTTTTTTGTAGCGAGTGTCTTTGGCATACTTGATCA 3’ ATACGGTTTACATCGCTCACAGAAACCGTAT 5’
Flare Acceptor
Donor Target
Over the past decade, gold nanoparticle (AuNP)-based fluorescently DNA probes have attracted more attentions for intracellular specific RNA detection, because AuNPs possess many interesting properties, including distance-dependent optical features,1,2 enhanced nucleic acid binding,3 resistance to degradation,4 and the ability to enter cells without use of transfection agents.5 As far as we know, there are two main types of such AuNP-based fluorescently DNA probes: nanobeacons6-8 and nano-flares.9-12 Both of the probes are composed of AuNPs and single-dye-labeled DNA sequences (hairpin or linear probes), where the fluorophores are designed in close proximity to the AuNPs in the absence of targets. In the presence of targets, the targets can specifically bind, and separate the fluorophores and AuNPs, resulting in recovering the fluorescence and revealing the presence of the targets (scheme please see Figure S1). Several attempts have been reported using these probes to detect RNA in living cells with various degrees of success.6-12 However, the single-intensity-based sensing is compromised by the local distribution of probes and by drifts of light sources and detectors. Moreover, it might generate false positive
FRET
FF
FRET
N
Target 3’
AuNP
ACATCGCTCACAGAAACCGTATGAACTAGT
5’
TTTTTTTTTTTGTAGCGAGTGTCTTTGGCATACTTGATCA 3’
＋
T
C
A C A
Flare C G C C T A
Donor G
AAACCGTAT
A TTTGGCATA
Acceptor
Figure 1. Design and working principle of the specific sequenceresponsive FRET nano-flares. As illustrated in Figure 1, the newly designed probe, termed FRET nano-flares, consist of a AuNP, recognition sequences and flares. Briefly, the AuNP functionalized with recognition sequences hybridized to flares, which are designed as hairpin structures and fluorescently labeled at their 5’ and 3’ termini with donors (FAM) and acceptors (TAMRA), respectively. In the absence of targets, the flares are captured by binding with the recognition sequences, separating of the donor and acceptor, inducing low
ACS Paragon Plus Environment
Journal of the American Chemical Society FRET efficiency. In this open state, only the fluorescence of donors can be detected. However, in the presence of targets, the flares are gradually displaced from the recognition sequences by the targets, subsequently forming hairpin structures, bringing the donor and acceptor into close proximity and resulting in high FRET efficiency. In this closed state, the fluorescence of the acceptor can be detected. Thus, the fluorescence emission ration of acceptor to donor (A/D) can be used as a signal for quantitation of target sequences.
FRET nano-flares and monitored the change in fluorescence over time (Figure S4). The results showed fluorescence of FAM decreases and TAMRA increases rapidly, reaching completion in approximately 5 min, which compares favorably to traditional nucleic acid probes such as molecular beacons.16
(a)
FRET nano-flares
control add Dnase I
1.2
1.0
FRET Off
FA/FD
.8
Dnase I
.6
.4
.2
FRET off
0.0 0
20
40
60
80
100
120
140
Time(min)
(b)
160
Single-dye nano-flares
control add Dnase I 140
Fluorescence intensity(a.u)
To prepare the FRET nano-flares, 13 nm AuNPs were prepared and functionalized with thiol-terminated recognition sequences to a specific target sequence via gold-thiol bond formation (Figure S2). These nanoconjugates were then purified and allowed to hybridize with flares. Quantification of DNA surface loading by fluorescence reveals that each AuNP contains approximately 85 flares (Figure S3). To test the in vitro target sensing behavior of the FRET nano-flares design, we examined the response of the probes to synthetic DNA targets, instead of mRNA, at 37 ℃. The result of Figure 2(a) showed excellent FRET signal change according to different concentrations of target. It suggested that the A/D ratio was dependent upon the target concentrations. Moreover, the result of Figure 2(b) demonstrated that the probes respond with a 7.0-fold increase in A/D signal upon target binding, and show little increase upon one-base mismatched target DNA. These results suggested that the FRET nano-flares were efficient at signaling the presence of a specific target, and also could be used to distinguish the target with a single base mismatch.
120
Fluorescence Off 100
Dnase I
80
60
40 0
20
40
60
80
100
120
140
Fluorescenece On
1600
(a)
0 10nM 25nM 50nM 75nM 100nM 150nM 200nM 250nM
1200 1000 800
Figure 3. Dnase I effects on the background fluorescence signals of (a) FRET nano-flares and (b) Single-dye nano-flares.
2.0 1.8 1.6 1.4 1.2 1.0 .8 .6 .4 .2 0.0
(a) 0
100
200
300
FRET nano-flares
control add GSH 1.2
Concentration(nM)
600
1.0
FRET Off
400 FA/FD
Fluorescence intensity(a.u)
1400
FA/FD
Time(min)
200 0
.8
GSH .6
500
520
540
560
580
600
620
640
.4
660
Wavelength(nm)
FRET Off
.2 0
2
4
6
8
10
12
14
Time(h)
(b)
2.0
(b) 240
FA/FD
1.5
1500
.5 0.0
1000
No t
500
on ta arg e-ba rget se et mis ma
tch
ed
Single-dye nano-flares
control add GSH
220 1.0
Fluorescence intensity(a.u)
2000
Fluorescence intensity(a.u)
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
Page 2 of 5
200 180 160
Fluorescence Off
140
GSH
120 100 80
0
no target one-base mismatched target
60
Fluorescence On
40 0
2
4
6
8
10
12
14
Time(h)
500
520
540
560
580
600
620
640
660
Wavelength(nm)
Figure 2. (a) Fluorescence profile of FRET nano-flares responded to different synthetic DNA targets in vitro at 37 ℃. Inset is a plot of A/D ratio as a function of target concentrations. (b) Selectivity studies of FRET nano-flares. Inset is a histogram of A/D ratio to different targets. It is critical for probes to respond to their target rapidly if detecting intracellular mRNA. To investigate the rate of flares release we added an excess of target to a solution containing the
Figure 4. GSH effects on the background fluorescence signals of (a) FRET nano-flares and (b) Single-dye nano-flares. Compared to the conventional single-dye nano-flares,9-12 the upgraded FRET nano-flares were expected to possess excellent capability of avoiding false positive signal. The interaction of FRET nano-flares and single-dye nano-flares with Dnase I and Glutathione (GSH) was then investigated, respectively. Figure 3 compared the response of FRET nano-flares and single-dye nanoflares to nuclease Dnase I, which can cleave ssDNA and dsDNA. No false positive was observed when Dnase I was added to the
ACS Paragon Plus Environment
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
Journal of the American Chemical Society
FRET nano-flares solution. In contrast, gradually increasing false positive signal was detected that would be undistinguishable from a true target binding response. Similar results were observed when GSH was added to the probes solutions. Figure 4 showed that No false positive was observed when GSH was added to the FRET nano-flares solution. In contrast, gradually increasing false positive signal after about 2 hours was observed. Actually, both types of probes interacted with Dnase I and GSH, because DNAs were hydrolyzed by Dnase I and gold-thiol bonds were destroyed by GSH, even AuNPs possessed degrees of anti-enzymatic stability. The differences were that the single-dye nano-flares gave signal change as the single-dye-labeled flares were separated from AuNPs, but the FRET nano-flares did not because the FRET pairs were not brought together even the flares were released from AuNPs. This is critically important when the probes would be used in an intracellular environment. Furthermore, the background signals of the probes were studied with the temperature changed. The results (Figure S5) showed that the fluorescence signals of the FRET nano-flares displayed a stable and low background and the single-dye nano-flares revealed gradually increasing with temperature rising, in the absence of targets. The unusual behavior suggested that the FRET signal was much less dependent on temperature than the single-dye nano-flares. To investigate the intracellular mRNA detection, we chose TK1 mRNA as a target, which is associated with cell division and is proposed to be a marker for tumor growth.17, 18 In this work, HepG2 (human liver hepatocellular carcinoma cell line) and MCF-7 (breast cancer cell line) were selected as the positive cells. And L02 (normal human hepatocyte cell line) was selected as the negative cell. The relative high expression levels of TK1 mRNA in these three cell lines were determined in the reported literature, which showed that the L02 cell line has a lower TK1 mRNA expression level than the HepG2 and MCF-7 cell lines.8,12 First, cellular uptake study of the FRET nano-flares was performed. After incubated with L02 and HepG2 cell lines, most particles resided in cytosol as individual particles or clusters, as evidenced by TEM imaging data (Figure S6). Moreover, the fluorescence colocalization imaging data of HepG2 cell lines (Figure S7) also showed that the FRET nano-flares distributed in cytoplasm, insuring the chance to approach the cytoplasmic mRNA. Second, the incubation time of the FRET nano-flares was studied with HepG2 and L02 cell lines. ICP-MS data (Figure S8) showed that the amounts of intracellular AuNPs were gradually increased with the incubation time till saturation at about 2.5-3.0 hours, which also suggested that there were relatively equal numbers of particles in HepG2 and L02 cell lines. Furthermore, the fluorescence imaging data (Figure S9) showed that the FRET signals (red color) in HepG2 cells were gradually increased with the incubation time till 2.5 hours and then gradually faded, but the FRET signals in L02 cells were very low, at all times, under the same conditions. It suggested that the 2.5-hour-incubation time should be appropriate to adopted in the following experiments, and the released flares might be degraded by the intracellular environment after 2.5-hour incubation. It is important to investigate the specificity of the FRET nanoflares in living cells. A control probe (non-recognition sequence) containing a mismatched recognition sequence (three base substitutions) was prepared. HepG2 cells were incubated with recognition FRET nano-flares and control probes, and then imaged using scanning confocal microscopy. The results (Figure S10) showed that HepG2 cells treated with recognition FRET nano-flares were highly red fluorescent as compared to those treated with control probes. Further, different types of cell lines were selected to study the specificity of the FRET nano-flares. Figure 5 showed the fluorescence images of TK1 mRNA by incubating FRET nano-flares
with two positive cell lines (HepG2, MCF-7) and one negative cell line (L02) for 2.5 hours, respectively. It showed that strong FRET signals (red fluorescence) for TK1 mRNA in HepG2 and MCF-7 were observed, and almost no red fluorescence in L02 was detected. The results were consistent with the results of another conventional technique qRT-PCR (Figure S11), and further indicated that the signals of the FRET nano-flares were correlated very well with the levels of mRNA expression. FAM
TAMRA
Overlap
(a)
L02
HepG2
MCF-7
(b)
1.6 1.4 1.2 1.0
FA/FD
Page 3 of 5
.8 .6 .4 .2 0.0
L02
HepG2
MCF-7
Figure 5. (a) Fluorescence images of TK1 mRNA in L02, HepG2 and MCF-7 cells, by FRET nano-flares. Scale bars are 20 µm. (b) The histogram of the relative fluorescence intensity (A/D) of the above three cell lines. The expression levels of mRNA in cancer cells are different in the various stages of tumor progression. It is critical to determine the relative expression levels of mRNA for cancer detection and therapy. TK1 mRNA in HepG2 was chosen as an example. It was reported that tamoxifen induced the down-regulation of TK1 mRNA expression.19, 20 HepG2 cells were divided into two groups. One group was treated with tamoxifen to decrease the TK1 mRNA expression, and another was an untreated group served as a control. Figure 6 showed that the red fluorescence was lower in the tamoxifen treated HepG2 cells relative to that in the untreated cells. qRT-PCR further confirmed that the level of TK1 mRNA expression decreased after tamoxifen treatment (Figure S12). These results indicated that the fluorescence intensity correlated well with the level of tumor-related mRNA expression in living cells. Thus, the FRET nano-flares are capable of detecting changes in gene expression levels in cancer cells.
ACS Paragon Plus Environment
Journal of the American Chemical Society FAM
TAMRA
Overlap
Notes
‡Y. Yang and J. Huang contributed equally to the work.
(a)
ACKNOWLEDGMENT
control
This work was supported by the National Natural Science Foundation of China (21190044, 21205032), Hunan Provincial Natural Science Foundation of China (13JJ4032), International Science & Technology Coopration Program of China (2010DFB30300), and the Fundamental Research Funds for the Central Universities. tamoxifen treated
REFERENCES (1) Dulkeith, E.; Ringler, M.; Klar, T. A.; Feldmann, J.; Javier, A. M.; Parak, W. J. Nano Lett. 2005, 5, 585. (2)
(b)
1.6
(3) 1.4
(4)
1.2
FA/FD
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
Page 4 of 5
1.0
(5)
.8
(6)
.6
(7)
.4
(8) .2
(9)
0.0
control
tamoxifen
(10)
Figure 6. (a) Fluorescence images of TK1 mRNA in HepG2 cells treated without and with tamoxifen, by FRET nano-flares. Scale bars are 20 µm. (b) The histogram of the relative fluorescence intensity (A/D) of the above two groups.
(11) (12) (13)
In summary, we have presented a new class of intracellular nanoprobe termed FRET nano-flares. They possess the merits of conventional single-dye nano-flares, such as cellular transfection, stability and fluorescence super-quenching. Moreover, compared to the conventional nano-flares, the upgraded FRET nano-flares have their own advantages. First, they do not generate any false positive signals upon thermodynamic fluctuations and chemical interferences (such as nuclease and GSH). Second, the signal generation in FRET nano-flares can be easily made with ratiometric measurement, minimizing the effect of system fluctuations. Of course, the FRET nano-flares also have potential drawbacks including the need for dual-fluorophore labeled and more complicated probe design because each must contain both a selfcomplementary region as well as a target region. We think, with different recognition elements (such as aptamers) in engineering FRET nano-flares, the ratiometric sensing strategy could potentially be applied to create a variety of new multicolor sensors for intracellular detection. The experiments on FRET nano-flares for other targets are being conducted in our laboratory and the results will be reported in due course.
(14) (15) (16)
(17)
(18) (19) (20)
Storhoff, J. J.; Lazarides, A. A.; Mucic, R. C.; Mirkin, C. A.; Letsinger, R. L.; Schatz, G. C. J. Am. Chem. Soc. 2000, 122, 4640. Lytton-Jean, A. K. R.; Mirkin, C. A. J. Am. Chem. Soc. 2005, 127, 12754. Seferos, D. S.; Prigodich, A. E.; Giljohann, D. A.; Patel, P. C.; Mirkin, C. A. Nano Lett. 2009, 9, 308. Giljohann, D. A.; Seferos, D. S.; Patel, P. C.; Millstone, J. E.; Rosi, N. L.; Mirkin, C. A. Nano Lett. 2007, 7, 3818. Song, S.; Liang, Z.; Zhang, J.; Wang, L.; Li, G.; Fan, C. Angew. Chem. Int. Ed. 2009, 48, 8670. Jayagopal, A.; Halfpenny, K.; Perez, J.; Wright, D. J. Am. Chem. Soc. 2010, 132, 9789. Pan, W.; Zhang, T.; Yang, H. Diao, W.; Li, N.; Tang, B. Anal. Chem. 2013, 85, 10581. Seferos, D. S. Giljohann, D. A.; Hill, H. D.; Prigodich, A. E.; Mirkin, C. A. J. Am. Chem. Soc. 2007, 129, 15477. Prigodich, A. E.; Seferos, D. S. Massich, M. D.; Giljohann, D. A.; Lane, B. C.; Mirkin, C. A. ACS Nano, 2009, 3, 2147. Prigodich, A. E.; Randeria, P. S.; Briley, W. E.; Kim, N. J.; Daniel, W. L.; Giljohann, D. A.; Mirkin, C. A. Anal. Chem. 2012, 84, 2062. Li, N.; Chang, C.; Pan, W.; Tang, B. Angew. Chem. Int. Ed. 2012, 51, 7426. Rosi, N. L.; Giljohann, D. A.; Thaxton, C. S.; Lytton-Jean, A. K. R.; Han, M. S.; Mirkin, C. A. Science, 2006, 312, 1027. Roy, R.; Hohng, S.; Ha, T. A. Nat. Methods 2008, 5, 507. Chen, H. H.; Ho, Y. P.; Jiang, X.; Mao, H. Q.; Wang, T. H.; Leong, K. W. Nano Today 2009, 4, 125. Wang, K.; Tang, Z.; Yang, C.; Kim, Y.; Fang, X.; Li, W.; Wu, Y.; Medley, C.; Cao, Z.; Li, J.; Colon, P.; Lin, H.; Tan, W. Angew. Chem. Int. Ed. 2009, 48, 856. Broet, P.; Romain, S.; Daver, A.; Ricolleau, G. ; Quillien, V. ; Rallet, A. Asselain, B. ; Martin, P. M. ; Spyratos, F. J. Clin. Oncol. 2001, 19, 2778. Chen, C. ; Chang, T.; Chen, F.; Hou, M.; Hung, S.; Chong, I.; Lee, S.; Zhou, T.; Lin, S. Oncology, 2006, 70, 438. Kasid, A.; Davidson, N. E.; Gelmann, E. P.; Lippman, M. E. J. Biol. Chem. 1986, 261, 5562. Foekens, J. A.; Romain, S.; Look, M. P.; martin, P. M.; klijn, J. G. M.; Cancer Res. 2001, 61, 1421.
ASSOCIATED CONTENT Supporting Information
Procedures and additional data. This material is available free of charge via the Internet at http://pubs.acs.org.
AUTHOR INFORMATION *Corresponding Author
[email protected].
ACS Paragon Plus Environment
Page 5 of 5
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
Journal of the American Chemical Society
For TOC only: AuNP
Recognition Sequence TTTTTTTTTTTGTAGCGAGTGTCTTTGGCATACTTGATCA 3’ ATACGGTTTACATCGCTCACAGAAACCGTAT 5’ Flare Acceptor
Donor Target
Target 3’
AuNP
ACATCGCTCACAGAAACCGTATGAACTAGT
FRET
FF
FRET
N
5’
TTTTTTTTTTTGTAGCGAGTGTCTTTGGCATACTTGATCA 3’ Recognition Sequence
＋
T C
C
A C A Flare
G C C T A
G
Donor AAACCGTAT
A TTTGGCATA Acceptor
5
ACS Paragon Plus Environment
