Functional Analysis of Novel Variants in the Organic Cation

May 11, 2013 - (4-8) hOCTN1 expression is up-regulated by pro-inflammatory cytokines such as TNF-α.(9, 10). hOCTN1 plays a key physiological role in ...
0 downloads 0 Views 3MB Size
Download PDF
Article pubs.acs.org/molecularpharmaceutics

Functional Analysis of Novel Variants in the Organic Cation/ Ergothioneine Transporter 1 Identified in Singapore Populations Dorothy Su Lin Toh,†,‡ Florence Shin Gee Cheung,† Michael Murray,†,§ Tan Kuan Pern,⊥ Edmund Jon Deoon Lee,‡ and Fanfan Zhou*,† †

Faculty of Pharmacy, University of Sydney, NSW 2006, Australia Department of Pharmacology, Yong Loo Lin School of Medicine, National University of Singapore, Singapore 119245 § Discipline of Pharmacology, School of Medical Sciences, The University of Sydney, NSW 2006, Australia ⊥ Bioinformatics Institute, Agency for Science, Technology and Research (A*STAR), Singapore 138632 ‡

ABSTRACT: The human organic cation/ergothioneine transporter 1 (hOCTN1, gene symbol SLC22A4) is responsible for the cellular uptake of substances, such as L-ergothioneine, which is an important antioxidant in mammalian cells. The common-function-altered variant L503F-hOCTN1 has been associated with susceptibility to Crohn’s disease in certain populations. Previously, we identified eight novel nonsynonymous singlenucleotide polymorphisms (SNPs) in the SLC22A4 gene in the Chinese and Indian populations of Singapore. The present study evaluated the impact of these novel SNPs on hOCTN1 transport function in HEK-293 cells. Transport uptake assays with L-ergothioneine were used to assess the function of the variant transporters. Cell surface biotinylation and Western blot analysis were used to characterize cellular transporter expression. Comparative modeling was used to locate amino acid substitutions in the topology of hOCTN1 in order to account for altered transport function. Transporter activity was markedly impaired in four of the naturally occurring hOCTN1 variants (R63H, R83P, G482D, and I500N). Multiple glycosylated isoforms of hOCTN1 proteins were identified in the plasma membrane and in the whole cell. Either the total cellular or membrane expression of the functionally deficient transporter variants was lower than that of the wild-type hOCTN1. The underlying mechanism involves both impaired transporter−substrate binding affinity and turnover rate. Considered together, several naturally occurring SNPs in the SLC22A4 gene encode variant hOCTN1 transporters that may impact the cellular uptake of L-ergothioneine and other substrates, with the potential to influence the antioxidant capacity of human cells. KEYWORDS: human organic cation/ergothioneine transporter 1, SLC22A4, single-nucleotide polymorphisms, transporter function, L-ergothioneine

■

in gabapentin secretion by the renal tubules.14,15 More recently, it was reported that hOCTN1 regulates hERG channel activity in human cardiomyocytes.16 Taken together, hOCTN1 has a diverse range of important effects on cellular physiology and drug action by regulating solute transport. A number of single-nucleotide polymorphisms (SNPs) have been identified in the SLC22A4 gene,3,17,18 but information on the functional consequences of these variants is limited.19,20 However, variants in the SLC22A4 and the related SLC22A5 genes have been associated with the incidence of rheumatoid arthritis and susceptibility to Crohn’s disease in Europeans.21,22 Individuals with Crohn’s disease carrying the hOCTN1-L503F variant also have an enhanced risk of adverse effects with mushrooms, possibly due to altered L-ergothioneine uptake23 because L-ergothioneine is enriched in mushrooms.24−27 hOCTN1 reconstituted in liposomes appears to mediate the

INTRODUCTION The SLC22 genes are members of the major facilitator superfamily that comprises 23 families of transporters from bacteria, plants, animals, and humans.1,2 These proteins mediate the transport of organic cations, zwitterions/cations, and organic anions across cell membranes. SLC22A4, the gene encoding for the human organic cation/ergothioneine transporter 1 (hOCTN1), consists of 10 exons and is located in the cytokine cluster region on chromosome 5q31.3 hOCTN1 is a bidirectional and pH-dependent transporter, consists of 551 amino acids, and has a predicted molecular mass of 62.4 kDa. hOCTN1 is expressed in the kidney, small intestine, ocular epithelium, erythrocytes, as well as in mitochondria from cultured skin fibroblasts.4−8 hOCTN1 expression is upregulated by pro-inflammatory cytokines such as TNF-α.9,10 hOCTN1 plays a key physiological role in the transport of Lergothioneine, a low molecular weight antioxidant obtained from the diet.5,11−13 Thus, hOCTN1 is an integral component of the antioxidant defense system of the skin and other organs. hOCTN1 also influences the cellular uptake of the anticancer agents doxorubicin and mitoxantrone and has an important role © 2013 American Chemical Society

Received: Revised: Accepted: Published: 2509

September 5, 2012 May 7, 2013 May 11, 2013 May 11, 2013 dx.doi.org/10.1021/mp400193r | Mol. Pharmaceutics 2013, 10, 2509−2516

Molecular Pharmaceutics

Article

Table 1. Primer Sequences for Mutagenesis variants

forward primer (5′ to 3′)

reverse primer (5′ to 3′)

R63H

CCTGAGCAGCGCCTGGCA CAACAACAGTGTCCCGCTGCG GTGCCCCACAGCTGCAGCCCCTA CCGGCTCGCCACCATCGC TCGTGACCGAGTGGAATAT GGTGTGTGAGGACAACT CATCAGAGACTGGCGGATCCT GCTGCTGGCGCTGACG GCCATAATGACCATTAAGTCT TTGCTGCTATGGATGCTGAC CCTACTTTGTTTACCTCGAT GCTTACAACAGAATGCT TCGGTGCTTACAACAGAA CGCTGCCCTACATCGTCA GTCTGACTGTCCTGAATGG AATCCTCACCCTTTTTTTC

CGCAGCGGGACACTGTTGTTGTG CCAGGCGCTGCTCAGG GCGATGGTGGCGAGCCGGTAGGG GCTGCAGCTGTGGGGCAC AGTTGTCCTCACACACCA TATTCCACTCGGTCACGA CGTCAGCGCCAGCAGCAGG ATCCGCCAGTCTCTGATG GTCAGCATCCATAGCAGCAAAGA CTTAATGGTCATTATGGC AGCATTCTGTTGTAAGCAT CGAGGTAAACAAAGTAGG TGACGATGTAGGGCAGCG TTCTGTTGTAAGCACCGA GAAAAAAAGGGTGAGGATTCCAT TCAGGACAGTCAGAC

R83P L134M M258I M344K G482D M487L I500N

aciotti Centre, University of New South Wales, Randwick, NSW, Australia). Expression of hOCTN1 Variants in HEK-293 Cells. Human embryonic kidney (HEK)-293 cells were maintained at 37 °C and 5% CO2 in Dulbecco’s modified Eagle’s medium supplemented with 10% fetal calf serum. Cells were transfected with plasmid DNA using Lipofectamine 2000 reagent (Invitrogen, Mount Waverley, VIC, Australia) following the manufacturer’s instructions. Twenty-four hours after transfection, substrate transport activities were measured. Transport Studies. Uptake of [3H]-L-ergothioneine was initiated at room temperature in phosphate-buffered saline (PBS), pH 7.4, containing 5 mM glucose and 1 μM [3H]-Lergothioneine and was terminated at intervals by rapidly washing the cells in ice-cold PBS. The cells were then solubilized in 0.2 M NaOH, neutralized with 0.2 M HCl, and aliquoted for liquid scintillation counting. Uptake count was standardized to the amount of protein in each well. Data are presented as mean ± SE (n = 3). Kinetic studies were performed with varying concentrations of unlabeled Lergothioneine (1−100 μM) added to the uptake buffer, and apparent Km and Vmax values for transporter activity were then calculated (GraphPad Prism 5.0; GraphPad Inc., LaJolla, CA, USA). Preliminary experiments indicated that hOCTN1mediated L-ergothionine uptake was linear over a 15 min time frame in the buffer (125 mM NaCl; 25 mM HEPES, pH 7.4; 5.6 mM (+)glucose; 4.8 mM KCl; 1.2 mM KH2PO4; 1.2 mM CaCl2; 1.2 mM MgSO4) in HEK293 cells,5 4 min was then selected for measurement of initial uptake rates. Cell Surface Biotinylation of hOCTN1 Variants. Cell surface expression levels of C-Flag-tagged hOCTN1 and its variants were examined using the membrane impermeant biotinylation reagent NHS-SS-biotin (Quantum Scientific, Lane Cove West, NSW, Australia). The transporter cDNAs were expressed in HEK-293 cells in six-well plates using Lipofectamine 2000, as previously described. After 24 h, the medium was removed, and the cells were washed successively with 3 mL aliquots of ice-cold PBS (pH 8.0). Cells were incubated on ice with 1 mL of freshly prepared NHS-SS-biotin (0.5 mg/mL in PBS) for 30 min with gentle shaking. After biotinylation, cells were washed with 3 mL of PBS containing 100 mM glycine and then incubated on ice for 20 min to ensure complete quenching of the unreacted NHS-SS-biotin. The cells were then treated

non-neuronal transport of acetylcholine, which could contribute to the pathogenesis of Crohn’s disease.28,29 The C1507T SNP that encodes the common L503F-hOCTN1 variant alters human cardiomyocyte hERG channel activity.16 Indeed, variable transporter activity may be a potential risk factor for drug-mediated torsade de pointes. Thus, pharmacogenetic variation in SLC22A4 has been associated with the pathogenesis of several disease processes. Previously, we identified eight novel nonsynonymous variants in SLC22A4 in the Chinese and Indian populations of Singapore that encoded variant hOCTN1 transporters with the amino acid substitutions Arg63His (R63H), Arg83Pro (R83P), Leu134Met (L134M), Met258Ile (M258I), Met344Lys (M344K), Gly482Asp (G482D), Met487Thr (M487T), and Ile500Asn (I500N).17 From the previously predicted secondary structure of hOCTN1 using TOPO2 software,20 Arg63His (R63H), Arg83Pro (R83P), Met344Lys (M344K), and Ile500Asn (I500N) substitutions were predicted to impair transporter function.17 The present study was undertaken to directly evaluate the functional significance of each of these novel variants in relation to cellular Lergothioneine uptake. The major finding to emerge was that transport function was markedly impaired in the R63H-, R83P-, G482D-, and I500N-hOCTN1 variants but not in the case of L134M-, M258I-, M344K-, and M487T-hOCTN1.

■

MATERIALS AND METHODS

Materials. [3H]-L-Ergothioneine (1.7 Ci/mmol) was purchased from BioScientific Pty. Ltd., Gymea, New South Wales, Australia. Culture medium was from Thermo Scientific (Lidcombe, NSW, Australia). All other chemicals were purchased from Sigma-Aldrich (Castle Hill, NSW, Australia). Construction of SLC22A4 Gene Variants. A plasmid containing the full-length human SLC22A4 cDNA (reference sequence: NM_003059) was obtained from Gene-Ethics (Asia) Pte Ltd., Singapore. Specific nucleotide changes were generated by site-directed mutagenesis using Pfu DNA polymerase (Promega, Singapore) following the manufacturer’s instructions and with the reference clone as template. The sequences of the oligonucleotides used in mutagenesis are shown in Table 1. Flag tags (DYKDDDDK) were inserted at the C-termini of wild-type and variant OCTN1 cDNAs. All sequences were confirmed by the dideoxy chain termination method (Ram2510

dx.doi.org/10.1021/mp400193r | Mol. Pharmaceutics 2013, 10, 2509−2516

Molecular Pharmaceutics

■

Article

RESULTS Transport of [3H]-L-Ergothioneine by hOCTN1 Variants. To evaluate the impact of the hOCTN1 variants on transporter function, the uptake of [3H]-L-ergothioneine (5 μM) was measured in transfected HEK-293 cells. As shown in Figure 1, transport function of the R83P variant was only ∼10%

with 400 mL of lysis buffer (10 mM Tris, 150 mM NaCl, 1 mM EDTA, 0.1% SDS, 1% Triton X-100, and containing the protease inhibitors phenylmethylsulfonyl fluoride, 200 mg/mL, and leupeptin, 3 mg/mL, pH 7.4) for 30 min. Unlysed cells were removed by centrifugation at 14 100g at 4 °C. Streptavidin-agarose beads (50 μL; Quantum Scientific) were then added to the supernatant to isolate biotinylated cell membrane proteins by rotating at 4 °C for 1 h. The biotinylated membrane protein was released from the streptavidin-agarose beads by incubation in sample buffer at 55 °C for 30 min. Biotinylated hOCTN1 proteins were deglycosylated by treatment with PNGase F for 1 h at 37 °C following the manufacturer’s instructions (Genesearch, Arundel, QLD, Australia). Electrophoresis and Immunoblotting. Protein samples were loaded onto 7.5% polyacrylamide minigels and electrophoresed using a mini cell (Bio-Rad, Gladesville, NSW, Australia). Proteins were transferred to polyvinylidene fluoride (PVDF) membranes in an electroelution cell (Bio-Rad) and blocked for 1 h with 5% nonfat dry milk in PBS-Tween (80 mM Na2HPO4, 20 mM KH2PO4, 100 mM NaCl, and 0.05% Tween 20, pH 7.5), washed, and then incubated overnight at 4 °C with anti-Flag antibody (1:1000; Genesearch). The membranes were washed, incubated with goat anti-rabbit IgG conjugated to horseradish peroxidase (1:5000), and signals were detected using a SuperSignal West Dura extended duration kit (Thermo Scientific). The signal was quantified by Quantity One software (Biorad, Gladesville, NSW, Australia). Comparative Modeling. No close homologues (sequence identity >30%) of hOCTN1 are currently available in the Protein Data Bank (PDB);30 therefore, only coarse-grained modeling was attempted.31 OCTN1 belongs to the major facilitator superfamily as indicated by BLAST searching32 of the nonredundant protein database. Of the four nonredundant structures (PDB: 1PW4, 2CFP, 2GFP, 3O7Q) of the superfamily deposited in the Orientations of Proteins in Membranes database,33 the Escherichia coli glycerol-3-phosphate transporter (GlpT; PDB: 1PW4) was used as the template for comparative modeling in consideration of sequence similarity. Topologies of hOCTN1 and GlpT were estimated by the TransMembrane prediction using Hidden Markov Models approach.34,35 However, because of the low sequence similarity between GlpT and hOCTN1 (20%), the actual topological structure of hOCTN1 could differ from that predicted. From alignments with other SLC transporters, hOCTN1 was predicted to form 12 transmembrane (TM) domain α-helixes and to possess several extracellular and intracellular domains. Amino acid residues 43−141 in hOCTN1 are predicted to form a large extracellular domain. In this study, the transmembrane, intracellular, and extracellular regions of hOCTN1 and GlpT were aligned separately using CLUSTALW.36,37 The individual segments were then reassembled to produce the final alignment. In 3D model building, additional α-helix constraints were applied to the predicted TM domains of hOCTN1. Comparative modeling was performed using MODELER v9.9.38 Statistics. The Student’s t test was used to test for differences between two data sets. Differences in transport function and inhibition of hOCTN1 and its multiple variants were detected by one-way analysis of variance and Dunnett’s testing. The criterion of significance was taken to be p < 0.05.

Figure 1. Transport of 5 μM [3H]-L-ergothioneine in HEK-293 cells expressing wild-type and naturally occurring nonsynonymous variants of the SLC22A4 gene that were obtained by site-directed mutagenesis. Uptake was conducted over a 4 min experimental duration. Radioactivity in cells was standardized to the amount of protein in each well. Values are mean ± SE (n = 3). Different from wild-type hOCTN1, ****p < 0.0001.

of wild-type, while those of the R63H, G482D, and I500N variants were significantly decreased to ∼50% of control (P < 0.0001). Intrinsic transport function was essentially intact in the case of the other four variants (L134M, M258I, M344K, and M487T). Similar observations were made in transfected Cos7 cells and in the case of the C-Flag-tagged wild-type and variant OCTN1 transporters in transfected HEK293 cells (data not shown). Immunoblot Analysis of the Membrane and Total Cellular Expression of hOCTN1 and Its R63H, R83P, G482D, and I500N Variants. Biotinylation and immunoblotting analysis was undertaken in transfected HEK-293 cells to evaluate the plasma membrane and total cell expression of the variant hOCTN1 transporters in which function was significantly different from the wild-type transporter: R63H-, R83P-, G482D-, and I500N-hOCTN1 (Figure 2). Because initial immunoblotting studies with a commercial antihOCTN1 yielded multiple signals, we constructed a series of C-Flag-tagged SLC22A4 cDNAs corresponding to the hOCTN1 variants for use in transfection studies (Figure 2A− C). From the topology model of hOCTN1 predicted by Burckhardt,17,39 hOCTN1 is likely to be N-glycosylated, which is consistent with the observation of multiple PNGase Fsensitive bands in the immunoblotting analysis (Figure 2D). Total cellular expression of the hOCTN1 isoform at ∼70 kDa was impaired in the case of the R63H-, R83P-, and I500NhOCTN1 variants (∼16, ∼9, and ∼21% of wild-type, respectively), while that of the G482D variant was somewhat less affected (Figure 2A,B). Total expression of the signal corresponding to the other major membrane glycosylated isoform of hOCTN1 (∼130 kDa) was slightly impaired for the I500N-hOCTN1 variant (∼70%), while expression of the other 2511

dx.doi.org/10.1021/mp400193r | Mol. Pharmaceutics 2013, 10, 2509−2516

Molecular Pharmaceutics

Article

Figure 2. Protein expression of C-Flag tagged hOCTN1 and its variants in HEK-293 cells. (A) Western analysis of total cellular expression of CFlag-tagged hOCTN1 and its variants. Top panel: Expression of C-Flag-tagged hOCTN1 variants in total cell lysates. Bottom panel: After being stripped, the blot was reprobed with anti-α-actin antibody. NC: negative control using vector transfected cells. (B) Total cellular expression of hOCTN1 wild-type and variants at the molecular masses of ∼70 kDa (black) and ∼130 kDa (gray) normalized to actin and expressed as a percentage of wild-type hOCTN1; following densitometry, the signal in the NC lane was subtracted from that in each sample lane. NC: negative control using vector transfected cells. (C) Western analysis of cell surface expression of wild-type C-Flag-tagged hOCTN1 and its variant transporters. Top panel: Cells were biotinylated, and the labeled cell surface proteins were isolated on streptavidin beads and separated by gel electrophoresis, followed by Western blotting with an anti-Flag antibody. NC: negative control using vector transfected cells. Bottom panel: Cell surface expression of hOCTN1 wild-type and variants at the molecular mass of ∼70 kDa (black) and ∼130 kDa (gray) expressed as a percentage of wild-type hOCTN1; following densitometry, the signal in the NC lane was subtracted from that in each sample lane. NC: negative control using vector transfected cells. (D) Cell surface expression of C-Flag-tagged hOCTN1 transporter with or without PNGase F treatment. Cells were biotinylated, and the labeled cell surface proteins were isolated on streptavidin beads, treated with PNGase F at 37 °C for 1 h, and then separated by gel electrophoresis, followed by Western blotting with an anti-Flag antibody. NC: negative control using vector transfected cells. Blots are shown in each panel that are representative of findings from three separate experiments.

variant transporters was not significantly altered. As shown in Figure 2C, biotinylation experiments indicated that expression of the hOCTN1 isoform (molecular mass ∼70 kDa) at the cell surface was decreased for the R83P- and I500N- hOCTN1 variants (∼18 and ∼47% of wild-type, respectively) and slightly decreased for the R63H-hOCTN1 variant (∼71% of wild-type). In contrast, the signal corresponding to the membrane glycosylated isoform of hOCTN1 at ∼130 kDa was slightly decreased for the R83P-, G482D-, and I500N-hOCTN1 variants (∼75, ∼79, and ∼84% of wild-type, respectively) and increased in the case of R63H-hOCTN1 variant (∼118% of wild-type). This expression pattern resembles that obtained in biotinylation and immunoblotting analysis with an antihOCTN1 antibody (data not shown). In control experiments, the specificity of biotinylation was assessed by reprobing the

membranes used for immunoblot analysis with an antiactin antibody. These findings are consistent with the assertion that the total cellular expression of glycosylated hOCTN1 isoforms were markedly impaired for the R63H-, R83P-, and I500NhOCTN1 variant isoforms at ∼70 kDa and slightly decreased for the I500N-hOCTN1 variant isoform at ∼130 kDa, while the membrane targeting of the surface isoforms at ∼130 kDa was impaired for the R83P- and G482D-hOCTN1 variants. Functional Characterization of hOCTN1 and Its R63H, G482D, and I500N Variants. Apart from impaired expression at the cell membrane, transport function could also be decreased as a result of altered substrate affinity or turnover. To assess these potential mechanisms, we conducted kinetic analyses in HEK293 cells that had been transiently transfected with the wild-type hOCTN1 and the R63H-, G482D-, and 2512

dx.doi.org/10.1021/mp400193r | Mol. Pharmaceutics 2013, 10, 2509−2516

Molecular Pharmaceutics

Article

to identify any major differences in the susceptibility of hOCTN1 variants to potential inhibitors. Comparative Modeling of the Structure of hOCTN1. The sequence alignment of GlpT and hOCTN1 is shown in Figure 4 and indicates the location of putative TM domains. Structural modeling was also undertaken to locate the amino acid residues that are subject to polymorphisms in Singaporean populations. The 3D model of hOCTN1 from which the extracellular domain is excluded shows the location of the residues M258, M344, G482, and I500 (Figure 5A). The model indicated that residues M344 and I500 are located within αhelixes that comprise TM domains 7 and 12, respectively, while M258 (TM domain 6) and G482 and M487 (extracellular loop) are likely located at the cell membrane boundary, and R63, R83, and L134 are in the large extracellular loop (Figure 5B). For the extracellular loop region ranging from residues 43−141, the secondary structure prediction consists of ∼75% unstructured residues, a short helix (indicated by H in Figure 5C) and 18 residues in extended conformation (E in Figure 5C). From this prediction, R63 is located in the middle of the short helix, R83 is not associated with secondary structure, and L134 is adjacent to the extended structure.

I500N-hOCTN1 variants. Analysis of the R83P-hOCTN1 variant could not be undertaken because of its extremely low capacity for L-ergothioneine uptake. As shown in Figure 3, the efficiency of L-ergothioneine transport by the R63H-hOCTN1 variant (Vmax/Km) was

■

DISCUSSION The present study evaluated the functional significance of eight SLC22A4 gene variants that were identified previously in the Chinese and Indian populations of Singapore.17 Transporter function toward the substrate L-ergothioneine was significantly decreased in four of the eight novel nonsynonymous variants compared to the wild-type hOCTN1. The SNPs coding these functionally deficient variants were found in the Indian population in our earlier study (allele frequency 0.01 to 0.05).17 Amino acid substitutions in two of the variants (R63H and R83P) occurred in the vicinity of important Nglycosylation sites in the large extracellular loop of the transporter that regulates plasma membrane orientation (N56, N64, and N91).39 To our knowledge, these are the first naturally occurring nonsynonymous SNPs that encode amino acid substitutions in the large extracellular loop between TM domains 1 and 2 that is highly conserved in SLC22 family members.3,18,20 Plasma membrane expression and transport function were markedly impaired by replacement of the arginine residue by proline in the variant R83P-hOCTN1. The Grantham value of 103 for this amino acid substitution reflects the dissimilarity between these residues.40,41 It is noteworthy that an amino acid substitution at the corresponding residue (R83L) in the closely related hOCTN2 transporter has been detected in subjects with primary carnitine deficiency.42,43 Carnitine transport by this variant was abolished due to defective maturation to the plasma membrane and retention in the cytoplasm. The amino acid substitution R63H in hOCTN1 was found in the present study to decrease the relative efficiency of L-ergothioneine transport to around 50% of wild-type control. This residue is adjacent to the glycosylation site at residue N64, and replacement of the corresponding residue in hOCTN2 (N64Q) also decreased the apparent Vmax for carnitine transport and increased the Km.44 L-Ergothioneine transport was impaired in the case of the G482D-hOCTN1 variant. This residue is located at small loop between TM domains 11 and 12. There was a marked reduction in the substrate turnover, albeit there were no resulting changes to the substrate affinity. Glycine at the position 482 of hOCTN1 is evolutionarily conserved in both

Figure 3. Michaelis−Menten plot showing kinetic analysis of Lergothioneine transport mediated by hOCTN1 and its variants. Uptake was conducted over a 4 min experimental duration. Radioactivity in cells was corrected for nonspecific uptake by vector transfected cells and was also standardized to the amount of protein in each well. Apparent kinetic parameters were calculated using GraphPad Prism 5. Values are mean ± SE (n = 3).

decreased to ∼50% of the wild-type hOCTN1. Thus, the apparent Km for L-ergothioneine influx was increased (64 ± 7 μM vs 48 ± 7 μM), while the apparent Vmax was decreased [125.4 ± 6.7 pmol/(μg*4 min) vs wild-type 182.8 ± 10.9 pmol/(μg*4 min)]. Similar decreases in apparent Vmax/Km were also noted for the G482D- and I500N-hOCTN1 variants, although these impairments were due primarily to decreased apparent Vmax and to both decreased apparent Km and Vmax, respectively. Decreased apparent Vmax values are consistent with the decreased presence of transporter protein isoforms at the plasma membrane. To further characterize the variant hOCTN1 transporters, their susceptibility to inhibition by a range of cationic substrates was also assessed. Uptake of [3H]-L-ergothioneine (1 μM) by wild-type hOCTN1 was decreased by L-ergothioneine, cimetidine, pyrilamine, and verapamil to 16−63% of control (when tested at 1 mM); differences between hOCTN1 variants with respect to inhibitor sensitivities were minimal. In contrast, carnitine, guanidine, 1-methyl-4-phenylpyridinium, spermine, and p-aminohippurate were noninhibitory toward L-ergothioneine uptake by any variants (data not shown). These findings are consistent with previous reports that Ki values for the inhibition of L-ergothioneine uptake by pyriliamine and verapamil were 182 and 11 μM, respectively.5,13 However, it should be added that these studies were undertaken primarily 2513

dx.doi.org/10.1021/mp400193r | Mol. Pharmaceutics 2013, 10, 2509−2516

Molecular Pharmaceutics

Article

Figure 4. Sequence alignments of hOCTN1 with Escherichia coli glycerol 3-phosphate transporter GlpT (PDB: 1PW4). Predicted transmembrane regions (TM1−TM12) in hOCTN1 and GlpT were aligned separately, after which these fragments were assembled to produce the final alignment.

rats and mice. The amino acid change from a neutral glycine to anionic aspartic acid may affect the membrane targeting of the glycosylated hOCNT1 isoform of molecular mass ∼130 kDa (Figure 2). The naturally occurring I500N substitution that is located within TM domain 12 exhibited a marked decrease in Lergothioneine transport capacity. In the I500N variant, the replacement of the nonpolar hydrophobic isoleucine by the polar asparagine residue is an unfavorable structural change (Grantham value 149). By inspection of the present 3D model, it is apparent that the residue I500 is located around the central region of TM domain 12. Findings from immunoblotting analysis are consistent with impaired membrane insertion of the glycosylated isoform of molecular mass ∼130 kDa, as well as decreased total cellular and membrane expression of the ∼70 kDa isoform. In accordance with previous reports, the L503FhOCTN1 variant, which is common in European populations and leads to altered transport function, also carries an amino

acid replacement in TM domain 12. This variant showed higher substrate affinity and lower maximal transport velocity in the uptake of L-ergothionine45 and tetraethylammonium (TEA).20

■

CONCLUSION In summary, the present study has characterized the impact of eight novel nonsynonymous SNPs in the SLC22A4 gene on hOCTN1 function. Transport function was essentially abolished in the case of the R83P variant and considerably decreased with three other variants (R63H, G482D, and I500N). The underlying mechanism involves impaired transporter protein membrane targeting, total cellular protein expression, transporter−substrate binding affinity, and turnover rate. The present findings may assist in the development of personalized therapy with hOCTN1 substrates, such as Lergothioneine and gabapentin, in Chinese and Indian individuals. 2514

dx.doi.org/10.1021/mp400193r | Mol. Pharmaceutics 2013, 10, 2509−2516

Molecular Pharmaceutics

Article

(3) Saito, S.; Iida, A.; Sekine, A.; Ogawa, C.; Kawauchi, S.; Higuchi, S.; Nakamura, Y. Catalog of 238 variations among six human genes encoding solute carriers (hSLCs) in the Japanese population. J. Hum. Genet. 2002, 47 (11), 576−584. (4) Grundemann, D. The ergothioneine transporter controls and indicates ergothioneine activitya review. Prev. Med. 2012, 54 (Suppl), S71−S74. (5) Grundemann, D.; Harlfinger, S.; Golz, S.; Geerts, A.; Lazar, A.; Berkels, R.; Jung, N.; Rubbert, A.; Schomig, E. Discovery of the ergothioneine transporter. Proc. Natl. Acad. Sci. U.S.A. 2005, 102 (14), 5256−5261. (6) Koepsell, H.; Lips, K.; Volk, C. Polyspecific organic cation transporters: structure, function, physiological roles, and biopharmaceutical implications. Pharm. Res. 2007, 24 (7), 1227−1251. (7) Lamhonwah, A. M.; Tein, I. Novel localization of OCTN1, an organic cation/carnitine transporter, to mammalian mitochondria. Biochem. Biophys. Res. Commun. 2006, 345 (4), 1315−1325. (8) Tamai, I.; Yabuuchi, H.; Nezu, J.; Sai, Y.; Oku, A.; Shimane, M.; Tsuji, A. Cloning and characterization of a novel human pHdependent organic cation transporter, OCTN1. FEBS Lett. 1997, 419 (1), 107−111. (9) Maeda, T.; Hirayama, M.; Kobayashi, D.; Miyazawa, K.; Tamai, I. Mechanism of the regulation of organic cation/carnitine transporter 1 (SLC22A4) by rheumatoid arthritis-associated transcriptional factor RUNX1 and inflammatory cytokines. Drug Metab. Dispos. 2007, 35 (3), 394−401. (10) Tokuhiro, S.; Yamada, R.; Chang, X.; Suzuki, A.; Kochi, Y.; Sawada, T.; Suzuki, M.; Nagasaki, M.; Ohtsuki, M.; Ono, M.; Furukawa, H.; Nagashima, M.; Yoshino, S.; Mabuchi, A.; Sekine, A.; Saito, S.; Takahashi, A.; Tsunoda, T.; Nakamura, Y.; Yamamoto, K. An intronic SNP in a RUNX1 binding site of SLC22A4, encoding an organic cation transporter, is associated with rheumatoid arthritis. Nat. Genet. 2003, 35 (4), 341−348. (11) Markova, N. G.; Karaman-Jurukovska, N.; Dong, K. K.; Damaghi, N.; Smiles, K. A.; Yarosh, D. B. Skin cells and tissue are capable of using L-ergothioneine as an integral component of their antioxidant defense system. Free Radical Biol. Med. 2009, 46 (8), 1168−1176. (12) Cheah, I. K.; Halliwell, B. Ergothioneine; antioxidant potential, physiological function and role in disease. Biochim. Biophys. Acta 2012, 1822 (5), 784−793. (13) Grigat, S.; Harlfinger, S.; Pal, S.; Striebinger, R.; Golz, S.; Geerts, A.; Lazar, A.; Schomig, E.; Grundemann, D. Probing the substrate specificity of the ergothioneine transporter with methimazole, hercynine, and organic cations. Biochem. Pharmacol. 2007, 74 (2), 309−316. (14) Okabe, M.; Szakacs, G.; Reimers, M. A.; Suzuki, T.; Hall, M. D.; Abe, T.; Weinstein, J. N.; Gottesman, M. M. Profiling SLCO and SLC22 genes in the NCI-60 cancer cell lines to identify drug uptake transporters. Mol. Cancer Ther. 2008, 7 (9), 3081−3091. (15) Urban, T. J.; Brown, C.; Castro, R. A.; Shah, N.; Mercer, R.; Huang, Y.; Brett, C. M.; Burchard, E. G.; Giacomini, K. M. Effects of genetic variation in the novel organic cation transporter, OCTN1, on the renal clearance of gabapentin. Clin. Pharmacol. Ther. 2008, 83 (3), 416−421. (16) McBride, B. F.; Yang, T.; Liu, K.; Urban, T. J.; Giacomini, K. M.; Kim, R. B.; Roden, D. M. The organic cation transporter, OCTN1, expressed in the human heart, potentiates antagonism of the HERG potassium channel. J. Cardiovasc. Pharmacol. 2009, 54 (1), 63−71. (17) Toh, D. S.; Koo, S. H.; Limenta, L. M.; Yee, J. Y.; Murray, M.; Lee, E. J. Genetic variations of the SLC22A4 gene in Chinese and Indian populations of Singapore. Drug Metab. Pharmacokinet. 2009, 24 (5), 475−481. (18) Feng, Y.; Zheng, P.; Zhao, H.; Wu, K. SLC22A4 and SLC22A5 gene polymorphisms and Crohn’s disease in the Chinese Han population. J. Dig. Dis. 2009, 10 (3), 181−187. (19) Tahara, H.; Yee, S. W.; Urban, T. J.; Hesselson, S.; Castro, R. A.; Kawamoto, M.; Stryke, D.; Johns, S. J.; Ferrin, T. E.; Kwok, P. Y.; Giacomini, K. M. Functional genetic variation in the basal promoter of

Figure 5. Predicted 3D model of hOCTN1. (A) Homology model of hOCTN1 using GlpT (PDB: 1PW4) as a partial structural template (excluding residues 43−141 of the extracellular domain). The positions of amino acid substitutions evaluated in this study (M258, M344, G482, M487, and I500) are indicated as dotted regions. (B) Three-dimensional model of the putative first extracellular domain (A43−A141). (C) Secondary structure prediction of the putative first extracellular domain (residues 43−141). Residues in red were predicted to constitute an α-helix (H), and residues in blue were predicted to be in extended conformation (E). The positions of 3 mutants evaluated in this study (R63, R83, and L134) are indicated.

■

AUTHOR INFORMATION

Corresponding Author

*Tel: 61-2-9036-3015. Fax: 61-2-9036-3244. E-mail: fanfan. [email protected]. Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS The authors are grateful to Dr. Cynthia Sung for her assistance with the statistical aspects of this study. This work was supported in part by The National Health and Medical Research Council of Australia.

■

ABBREVIATIONS hOCTN1, human organic cation/ergothioneine transporter 1; PDB: Protein Data Bank; SNPs, single-nucleotide polymorphisms; TM, transmembrane; GlpT, glycerol 3-phosphate transporter

■

REFERENCES

(1) Pao, S. S.; Paulsen, I. T.; Saier, M. H., Jr. Major facilitator superfamily. Microbiol. Mol. Biol. Rev. 1998, 62 (1), 1−34. (2) He, L.; Vasiliou, K.; Nebert, D. W. Analysis and update of the human solute carrier (SLC) gene superfamily. Hum. Genomics 2009, 3 (2), 195−206. 2515

dx.doi.org/10.1021/mp400193r | Mol. Pharmaceutics 2013, 10, 2509−2516

Molecular Pharmaceutics

Article

the organic cation/carnitine transporters OCTN1 (SLC22A4) and OCTN2 (SLC22A5). J. Pharmacol. Exp. Ther. 2009, 329 (1), 262− 271. (20) Urban, T. J.; Yang, C.; Lagpacan, L. L.; Brown, C.; Castro, R. A.; Taylor, T. R.; Huang, C. C.; Stryke, D.; Johns, S. J.; Kawamoto, M.; Carlson, E. J.; Ferrin, T. E.; Burchard, E. G.; Giacomini, K. M. Functional effects of protein sequence polymorphisms in the organic cation/ergothioneine transporter OCTN1 (SLC22A4). Pharmacogenet. Genomics 2007, 17 (9), 773−782. (21) Peltekova, V. D.; Wintle, R. F.; Rubin, L. A.; Amos, C. I.; Huang, Q.; Gu, X.; Newman, B.; Van Oene, M.; Cescon, D.; Greenberg, G.; Griffiths, A. M.; St. George-Hyslop, P. H.; Siminovitch, K. A. Functional variants of OCTN cation transporter genes are associated with Crohn disease. Nat. Genet. 2004, 36 (5), 471−475. (22) Taubert, D.; Jung, N.; Goeser, T.; Schomig, E. Increased ergothioneine tissue concentrations in carriers of the Crohn’s disease risk-associated 503F variant of the organic cation transporter OCTN1. Gut 2009, 58 (2), 312−314. (23) Petermann, I.; Triggs, C. M.; Huebner, C.; Han, D. Y.; Gearry, R. B.; Barclay, M. L.; Demmers, P. S.; McCulloch, A.; Ferguson, L. R. Mushroom intolerance: a novel diet-gene interaction in Crohn’s disease. Br. J. Nutr. 2009, 102 (4), 506−508. (24) Ey, J.; Schomig, E.; Taubert, D. Dietary sources and antioxidant effects of ergothioneine. J. Agric. Food Chem. 2007, 55 (16), 6466− 6474. (25) Chen, S. Y.; Ho, K. J.; Liang, C. H.; Tsai, C. H.; Huang, L. Y.; Mau, J. L. Preparation of culinary-medicinal king oyster mushroom Pleurotus eryngii-fermented products with high ergothioneine content and their taste quality. Int. J. Med. Mushrooms 2012, 14 (1), 85−93. (26) Dubost, N. J.; Ou, B.; Beelman, R. B. Quantification of polyphenols and ergothioneine in cultivated mushrooms and correlation to total antioxidant capacity. Food Chem. 2007, 105, 727−735. (27) Dubost, N. J.; Peterson, B. R.; Royse, D. J. Identification and quantification of ergothioneine in cultivated mushrooms using liquid chromatography-mass spectroscopy. Int. J. Med. Mushrooms 2006, 8, 215−222. (28) Pochini, L.; Scalise, M.; Galluccio, M.; Pani, G.; Siminovitch, K. A.; Indiveri, C. The human OCTN1 (SLC22A4) reconstituted in liposomes catalyzes acetylcholine transport which is defective in the mutant L503F associated to the Crohn’s disease. Biochim. Biophys. Acta 2012, 1818 (3), 559−565. (29) Pochini, L.; Scalise, M.; Galluccio, M.; Amelio, L.; Indiveri, C. Reconstitution in liposomes of the functionally active human OCTN1 (SLC22A4) transporter overexpressed in Escherichia coli. Biochem. J. 2011, 439 (2), 227−233. (30) Berman, H. M.; Westbrook, J.; Feng, Z.; Gilliland, G.; Bhat, T. N.; Weissig, H.; Shindyalov, I. N.; Bourne, P. E. The Protein Data Bank. Nucleic Acids Res. 2000, 28 (1), 235−242. (31) Hopf, T. A.; Colwell, L. J.; Sheridan, R.; Rost, B.; Sander, C.; Marks, D. S. Three-dimensional structures of membrane proteins from genomic sequencing. Cell 2012, 149 (7), 1607−1621. (32) Altschul, S. F.; Gish, W.; Miller, W.; Myers, E. W.; Lipman, D. J. Basic local alignment search tool. J. Mol. Biol. 1990, 215 (3), 403−410. (33) Lomize, M. A.; Lomize, A. L.; Pogozheva, I. D.; Mosberg, H. I. OPM: orientations of proteins in membranes database. Bioinformatics 2006, 22 (5), 623−625. (34) Krogh, A.; Larsson, B.; von Heijne, G.; Sonnhammer, E. L. Predicting transmembrane protein topology with a hidden Markov model: application to complete genomes. J. Mol. Biol. 2001, 305 (3), 567−580. (35) Sonnhammer, E. L.; von Heijne, G.; Krogh, A. A hidden Markov model for predicting transmembrane helices in protein sequences. Proc.-Int. Conf. Intell. Syst. Mol. Biol. 1998, 6, 175−82. (36) Thompson, J. D.; Higgins, D. G.; Gibson, T. J. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 1994, 22 (22), 4673−4680.

(37) Larkin, M. A.; Blackshields, G.; Brown, N. P.; Chenna, R.; McGettigan, P. A.; McWilliam, H.; Valentin, F.; Wallace, I. M.; Wilm, A.; Lopez, R.; Thompson, J. D.; Gibson, T. J.; Higgins, D. G. Clustal W and Clustal X version 2.0. Bioinformatics 2007, 23 (21), 2947− 2948. (38) Sali, A.; Blundell, T. L. Comparative protein modelling by satisfaction of spatial restraints. J. Mol. Biol. 1993, 234 (3), 779−815. (39) Burckhardt, G.; Wolff, N. A. Structure of renal organic anion and cation transporters. Am. J. Physiol. Renal Physiol. 2000, 278 (6), F853−F866. (40) Grantham, R. Amino acid difference formula to help explain protein evolution. Science 1974, 185 (4154), 862−864. (41) Li, W. H.; Wu, C. I.; Luo, C. C. Nonrandomness of point mutation as reflected in nucleotide substitutions in pseudogenes and its evolutionary implications. J. Mol. Evol. 1984, 21 (1), 58−71. (42) Makhseed, N.; Vallance, H. D.; Potter, M.; Waters, P. J.; Wong, L. T.; Lillquist, Y.; Pasquali, M.; Amat di San Filippo, C.; Longo, N. Carnitine transporter defect due to a novel mutation in the SLC22A5 gene presenting with peripheral neuropathy. J. Inherit. Metab. Dis. 2004, 27 (6), 778−780. (43) Amat di San Filippo, C.; Pasquali, M.; Longo, N. Pharmacological rescue of carnitine transport in primary carnitine deficiency. Hum. Mutat. 2006, 27 (6), 513−523. (44) Filippo, C. A.; Ardon, O.; Longo, N. Glycosylation of the OCTN2 carnitine transporter: study of natural mutations identified in patients with primary carnitine deficiency. Biochim. Biophys. Acta 2011, 1812 (3), 312−320. (45) Taubert, D.; Grimberg, G.; Jung, N.; Rubbert, A.; Schomig, E. Functional role of the 503F variant of the organic cation transporter OCTN1 in Crohn’s disease. Gut 2005, 54 (10), 1505−1506.

2516

dx.doi.org/10.1021/mp400193r | Mol. Pharmaceutics 2013, 10, 2509−2516