Functional and Evolutionary Characterization of a UDP-Xylose

Article pubs.acs.org/biochemistry

Functional and Evolutionary Characterization of a UDP-Xylose Synthase Gene from the Plant Pathogen Xylella fastidiosa, Involved in the Synthesis of Bacterial Lipopolysaccharide Valquíria Campos Alencar,† Daniela Leite Jabes,† Fabiano Bezerra Menegidio,† Guilherme Lanzi Sassaki,‡ Lucas Rodrigo de Souza,§ Luciano Puzer,§ Maria Cecília Zorél Meneghetti,∥ Marcelo Andrade Lima,∥ Ivarne Luis dos Santos Tersariol,∥ Regina Costa de Oliveira,† and Luiz R. Nunes*,§ †

Núcleo Integrado de Biotecnologia, Universidade de Mogi das Cruzes (UMC), Av. Dr. Cândido Xavier de Almeida Souza, 200, Mogi das Cruzes, SP CEP 08780-911, Brazil ‡ Setor de Ciências Biológicas-Departamento de Bioquímica e Biologia Molecular Laboratório de Química de Carboidratos, Universidade Federal do Paraná (UFPR), Rua Cel. Francisco H. dos Santos, 100, Curitiba, Paraná CEP 81531-980, Brazil § Centro de Ciências Naturais e Humanas, Universidade Federal do ABC (UFABC), Rua Santa Adélia, 166, Santo André, SP CEP 09210-170, Brazil ∥ Departamento de Bioquímica, Universidade Federal de São Paulo (UNIFESP), Rua Três de Maio, Vila Clementino, São Paulo CEP 04044-020, Brazil S Supporting Information *

ABSTRACT: Xylella fastidiosa is a plant-infecting bacillus, responsible for many important crop diseases, such as Pierce’s disease of vineyards, citrus variegated chlorosis, and coffee leaf scorch (CLS), among others. Recent genomic comparisons involving two CLS-related strains, belonging to X. fastidiosa subsp. pauca, revealed that one of them carries a frameshift mutation that inactivates a gene encoding an oxidoreductase of the short-chain dehydrogenase/reductase (SDR) superfamily, which may play important roles in determining structural variations in bacterial glycans and glycoconjugates. However, the exact nature of this SDR has been a matter of controversy, as different annotations of X. fastidiosa genomes have implicated it in distinct reactions. To confirm the nature of this mutated SDR, a comparative analysis was initially performed, suggesting that it belongs to a subgroup of SDR decarboxylases, representing a UDP-xylose synthase (Uxs). Functional assays, using a recombinant derivative of this enzyme, confirmed its nature as Xf Uxs, and carbohydrate composition analyses, performed with lipopolysaccharide (LPS) molecules obtained from different strains, indicate that inactivation of the X. fastidiosa uxs gene affects the LPS structure among CLS-related X. fastidiosa strains. Finally, a comparative sequence analysis suggests that this mutation is likely to result in a morphological and evolutionary hallmark that differentiates two subgroups of CLS-related strains, which may influence interactions between these bacteria and their plant and/or insect hosts.

Xylella fastidiosa is a Gram-negative bacillus that inhabits the xylem of plants and is transmitted by xylem-feeding insects.1,2 Different isolates of this bacterium have been historically implicated in the development of diseases in many economically important crops across the American continent, which are responsible for million-dollar damages per year, such as citrus variegated chlorosis (CVC) and Pierce’s disease (PD) of vineyards.3,4 However, X. fastidiosa’s capacity to infect several host species (including ornamental plants) is contributing to the spread of this plant pathogen outside the American continent.4 For example, a PD outbreak has been recently detected in Taiwan,5 and a newly identified X. fastidiosa strain (Codiro) has been found in association with olive quick decline syndrome, a disease responsible for devastating tens of thousands of acres of olive grooves in southern Italy.6,7 So © XXXX American Chemical Society

far, steps taken to contain X. fastidiosa have not fully prevented its entry into the European continent, because infections have recently been detected in Corsica and on the French mainland.8 Moreover, infected coffee plants, imported from Central and South America by a breeding company, have been identified (in a confined facility) in France, raising concerns regarding the spreading of coffee leaf scorch (CLS), another X. fastidiosaassociated disease with potential to cause severe economic losses.9,10 CLS was originally described in Brazil in the mid1990s11,12 and later detected in Costa Rica in 2001.13 Disease Received: September 2, 2016 Revised: January 12, 2017

A

DOI: 10.1021/acs.biochem.6b00886 Biochemistry XXXX, XXX, XXX−XXX

Article

Biochemistry

has been cloned in an expression vector and the recombinant enzyme has been purified. Direct biochemical tests were employed to characterize its activity, confirming that it belongs to the group of UDP-glucuronate decarboxylases.29 More precisely, the experiments described herein show that the enzyme encoded by Xf 0611 is a UDP-xylose synthase (Uxs), which belongs to a subgroup of UDP-glucuronate decarboxylases that are responsible for producing UDP-xylose, the activated sugar-nucleotide that serves as a donor of xylose moieties that are incorporated into bacterial glycans and glycoconjugates, such as LPS. 30 In fact, carbohydrate composition analyses confirmed that xylose can be found in LPS molecules obtained from X. fastidiosa 9a5c (carrying a functional copy of the uxs gene), but not in LPS obtained from X. fastidiosa 6c (which carries the frameshift-inactivated homologue). Finally, it was also demonstrated that the frameshift mutation identified in strain 6c is present in all isolates that belong to the same subgroup of CLS-related bacteria, causing them to lack xylose moieties in the structure of their outer membrane LPS, a molecule that has been found to mediate interactions of X. fastidiosa with both plant hosts and insect vectors.31,32

symptoms include drying of infected branches, shortening of internode regions, chlorosis and early senescence of leaves, and decreased fruit size, affecting overall plant productivity.14 Several CLS-related X. fastidiosa strains have been characterized to date, and interestingly, the disease appears to be caused by genetically distinct isolates, currently distributed in two different subspecies, X. fastidiosa subsp. fastidiosa and X. fastidiosa subsp. pauca, which bear significant evolutionary divergence compared to each other, as estimated by their average nucleotide identity (ANI) values.15,16 Recently, a genome-level characterization of CLS-related isolates, belonging to the X. fastidiosa subsp. pauca, revealed that these bacteria seem to partition into two phylogenetically distinct subgroups, bearing differences in genes that are likely to affect their capacity to interact with both insect and plant hosts.15,17 Among such differences, a frameshift mutation, found in isolate 6c, inactivates an open reading frame (ORF) that encodes a short-chain dehydrogenase/reductase (SDR) enzyme, originally characterized as ORF Xf 0611 in X. fastidiosa strain 9a5c.18 The SDR superfamily encompasses a wide variety of enzymes that may act as epimerases, dehydratases, lyases, decarboxylases, or oxidoreductases on a broad range of substrates, playing critical roles in lipid, amino acid, carbohydrate, cofactor, and xenobiotic metabolism, as well as in redox sensor mechanisms.19,20 Although sequence similarity is known to vary significantly among SDRs, they all exhibit a Rossmann-fold NAD(P)H/NAD(P)+ binding domain and a conserved active site, often containing an Asn-Ser-Tyr-Lys catalytic tetrad. Many SDRs have been characterized as being important virulence factors in pathogenic bacteria, because of their involvement in the synthesis of outer membrane rhamnolipids and in interconversion reactions among nucleotide-activated sugars, which serve as monosaccharide donors during the synthesis of glycans, glycoproteins, and other glycoconjugates, which may act as important determinants for binding specificity in both prokaryotic and eukaryotic cells.21−23 However, the exact nature of the SDR encoded by ORF Xf 0611 in X. fastidiosa has been a matter of controversy over the past several years. It was originally annotated as a dTDPglucose 4,6-dehydratase in the genome of strain 9a5c, because of the high similarity scores obtained with homologous genes found in several microorganisms.18 This enzyme mediates the interconversion of dTDP-glucose into dTDP-4-dehydro-6deoxy-D-glucose, the second step in the dTDP-L-rhamnose pathway,24 and has been shown to be required for the proper establishment of different bacterium−plant interactions.25,26 A subsequent genomic comparison, involving different X. fastidiosa isolates, propagated this annotation to homologous genes found in strains obtained from vineyard, oleander, and almond trees.27 However, the highest similarity scores obtained during such comparisons suggested that it could encode a different type of SDR, UDP-glucose 4-epimerase, responsible for interconverting UDP-galactose into UDP-glucose, as part of the Leloir pathway, that leads to the catabolism of D-galactose in bacteria.28 Finally, in 2013, the genome of X. fastidiosa 9a5c was reannotated with the aid of the NCBI Automated Prokaryotic Annotation Pipeline, and the same gene has been described solely as a NAD-dependent dehydratase, although such annotation highlights a region of high similarity with UDP-glucuronate decarboxylase (see http://www.ncbi.nlm.nih. gov/protein/WP_004083511.1). Thus, to obtain direct information about the actual nature of the SDR encoded by OFR Xf 0611, the sequence of this gene

■

MATERIALS AND METHODS Strains, Growth Conditions, and DNA Extraction. X. fastidiosa strains used in this work have been previously described.15 For this work, bacterial stocks kept at −85 °C, in 20% glycerol, were recovered on PW agar medium and the plates maintained for 10 days at 28 °C. Isolated colonies were transferred once to new plates, containing the same medium, grown for 20 days at 28 °C, and harvested for DNA extraction, as described previously.33 Phylogenetic Analyses of SDR Genes. Sequences from several bacterial SDR-related genes, responsible for different reactions, have been obtained from the NCBI database and aligned (along with the sequence of ORF Xf 0611) with the aid of ClustalW (available at http://www.ebi.ac.uk/clustalw/). The resulting alignment was used in a phylogenetic reconstruction with the aid of Mr. Bayes,34 as previously described.15 The analysis involved 1000000 iterations, with savings at every 100th tree, 1100000 generations in four heated Monte Carlo Markov chains (MCMCs), a 0.5 annealing temperature, 100000 MCMC generation burn-in, and a 16-category C distribution. A consensus tree was generated after burn-in, using a 50% majority rule. The final tree was then edited with the online application iTOL.35 Cloning of ORF Xf 0611 from X. fastidiosa 9a5c. The coding sequence of ORF Xf 0611 was amplified via polymerase chain reaction (PCR) in 50 μL reaction mixtures, using 1 unit of Taq DNA polymerase (Invitrogen), 1 pmol of forward (5′ACGAGTCGACATATGAGTCTATATTCC3′) and reverse (5′CAATAATAAGCGGATCCACTGAAGCAGACA3′) primers, 10 mM dNTPs, and 100 ng of Xf 9a5c DNA as a template. PCRs were performed on the basis of the manufacturers’ recommendations, with the annealing temperature set at 45 °C. The PCR product was purified after agarose gel electrophoresis and digested using NdeI and BamHI restriction endonucleases. The product was cloned into Escherichia coli expression vector pET28a(+), predigested with the same restriction endonucleases, for the production of a recombinant protein containing a six-histidine extension at the N terminus. The resulting plasmid was transfected into E. coli DH5α competent cells, and transformants were selected on B


Article

Biochemistry Luria-Bertani (LB) agarose plates, supplemented with 50 μg/ mL kanamycin. Candidate clones were initially selected by colony PCR and further checked for sequence fidelity and orientation by Sanger sequencing in a 3500xL Genetic Analyzer (Applied Biosystems). Expression and Purification of Recombinant Xf Uxs, Encoded by ORF Xf 0611. One plasmid containing the entire sequence of ORF Xf 0611 was selected, as described above, and used to transform E. coli BL21 competent cells. One clone was selected for recombinant protein production and cultured for 16 h at 37 °C in LB medium (5 mL), supplemented with kanamycin (50 μg/mL). A portion (3 mL) of the cultured cells was transferred into fresh LB liquid medium (300 mL), supplemented with the same antibiotic, and the cells were then grown at 37 °C and 250 rpm, until the cell density reached an OD600 of 0.5. Gene expression was then induced by addition of isopropyl β-D-1-thiogalactopyranoside (IPTG) (to 0.5 mM) for 4 h at 30 °C and 250 rpm. To check for induction efficiency, samples of induced and noninduced cells (1 mL each) were suspended in lysis buffer [20 mM sodium phosphate (pH 7.4), 500 mM NaCl, 5 mM imidazole, and 5% (v/v) glycerol], supplemented with 0.5% sodium dodecyl sulfate and 8 M urea, for 20 min at 65 °C and then centrifuged at 13000g for 20 min at 4 °C. The resulting supernatants were recovered, filtered, and evaluated via 12% sodium dodecyl sulfate−polyacrylamide gel electrophoresis (SDS−PAGE), after staining with Coomassie brilliant blue G-250. For recombinant protein purification, induced cells were collected by centrifugation (6000g for 15 min at 4 °C), suspended in 10 mL of lysis buffer, and sonicated in an ice bath (30 cycles of 10 s on and 10 s off) using a Vibra cell TM sonicator (Sonis & Materials Inc.), equipped with a microtip probe. The lysed cells were centrifuged at 13000g for 20 min at 4 °C, and the resulting supernatant containing the soluble protein fraction was recovered, filtered, and evaluated via 12% SDS−PAGE, after staining with Coomassie brilliant blue G250. To recover insoluble proteins, present in inclusion bodies, the cellular pellets obtained in the previous step were solubilized in 5 mL of lysis buffer containing 0.5% SDS, 8 M urea, and 5 mM DTT and incubated at 65 °C for 20 min. The denatured pellets were centrifuged at 13000g for 20 min at 4 °C, and the resulting supernatant was recovered, filtered, and evaluated via 12% SDS−PAGE, after staining with Coomassie brilliant blue G-250. His-tagged proteins, identified in the insoluble fraction of the lysate, were purified using a Ni-Sepharose fast-flow column [1 mL of resin (GE Healthcare Life Sciences)]. The column was pre-equilibrated with loading buffer [20 mM sodium phosphate (pH 7.4), 500 mM NaCl, 5 mM imidazole, 8 M urea, and 5% (v/v) glycerol], and the bound His-tagged protein was eluted with the same buffer, containing increasing amounts of imidazole (from 50 to 500 mM). Fractions containing the purified protein were identified by SDS−PAGE and combined into a single sample, which was placed in a 35000 Da molecular mass cutoff dialysis bag (Spectrum Laboratories). The purified protein was then renatured by consecutive dialyses against 20 mM sodium phosphate (pH 7.5), 100 mM NaCl, 5 mM DTT, and 20% (v/v) glycerol containing decreasing concentrations of urea (6, 4, 2, 1, 0.5, and 0 M). Each dialysis step involved 1 L of buffer and 16−24 h incubations at 4 °C. The final protein concentration was determined using the Bradford reagent with BSA as a standard, as recommended by ref 36. The purity of the

renatured protein was further evaluated via 12% SDS−PAGE, after staining with Coomassie brilliant blue G-250. Functional Assays for UDP-Glucuronate Decarboxylase/Uxs Activity. Standard Uxs reaction mixtures (50 μL final volume) contained 50 mM sodium phosphate (pH 7.6), 1 mM NAD+, 1 mM UDP-GlcA, and 1 μg of purified recombinant Uxs. Reaction mixtures were incubated for 1 h at 37 °C and reactions terminated by heating at 100 °C for 45 s. Chloroform (50 μL) was then added, and the mixture was vortexed for 30 s. The suspension was centrifuged at room temperature for 5 min at 14000g, and the upper aqueous phase was collected. Reaction products were submitted to highperformance liquid chromatography (HPLC) in a Propac-PA1 anion-exchange column (4 mm × 50 mm, Thermo Sientific), using an Ä KTApurifier (GE) system. Reaction products for these Uxs reactions were chromatographed using Milli-Q water as the mobile phase, with a gradient from 0 to 300 mM NaCl, for 30 min, at a flow rate of 0.5 mL/min and UV detection at 260 nm. UDP-Xyl produced in this reaction was identified by a coinjection experiment, employing a [glucuronyl-U-14C]UDPGlcA substrate, as previously described.37 Thus, standard UDP-GlcA decarboxylase reaction mixtures (50 μL final volume) were prepared, as described above, containing 1 mM NAD+ and 750 μM unlabeled UDP-glucuronate (Sigma), in the presence of 0.2 μCi of labeled [glucuronyl-U-14C]UDP-GlcA (PerkinElmer). The reaction mixtures were incubated for 1 h at 37 °C and reactions terminated by heating at 100 °C for 45 s. At this point, unlabeled UDP-Xyl (Sigma) was added to the reaction mixture at a final concentration of 0.5 mM, to serve as an internal control to monitor UDP-Xyl elution, during HPLC. Reaction products were purified in an Ä KTApurifier (GE) system, using the Propac-PA1 anion-exchange column, as described above. Fractions obtained from this chromatography were monitored by OD260 readings to detect elution of NAD+, UDP-GlcA, and UDP-Xyl. Next, 200 μL samples from each fraction were collected, placed in tubes containing 5 mL of Ultima gold scintillation reagent (PerkinElmer), and analyzed in a liquid scintillation counter to detect 14C-labeled radioactive products. Similar reaction mixtures, containing increasing concentrations of the enzyme, were prepared, incubated, and purified as described above. Fractions containing [14C]UDPXyl were collected, pooled, and also submitted to scintillation counting, to quantify the amount of product as a function of enzyme concentration. Determination of the Monosaccharide Composition of X. fastidiosa LPS. To purify LPS molecules from different X. fastidiosa strains, liquid cultures of strains 9a5c and 6c (1 L) were grown at 28 °C and 125 rpm in PW medium for 7 days. Bacterial cells were harvested by centrifugation (5 min at 8000g), washed three times with buffered saline and once with distilled water, and then lyophilized and stored at −70 °C; 4.5 g of lyophilized X. fastidiosa cells, obtained from multiple cultures, were used for LPS extraction by the hot-aqueous phenol method described in ref 38. Briefly, dried cells were suspended in 80 mL of distilled water and heated to 65 °C. Prewarmed phenol was added (80 mL), and the suspension was kept at 65 °C for 20 min while being stirred. Extraction was repeated under the same conditions after the phenol phase was recovered by centrifugation and added to 50 mL of prewarmed water. Both aqueous and phenol phases were dialyzed against 1 L of PBS buffer (three times, for 24 h each), in 3500 Da membranes. LPS samples (present exclusively in the aqueous C


Article

Biochemistry

Figure 1. Phylogenetic tree showing the evolution of different classes of short-chain reductase (SDR) enzymes from different bacteria. Sequences from several SDR genes (including ORF Xf 0611) have been aligned with the aid of ClustalW and used in a phylogenetic reconstruction using Bayesian statistics, as described in Materials and Methods. The resulting tree shows that ORF Xf 0611 clusters within a subgroup of UDPglucuronate decarboxylases, representing UDP-xylose synthases (Uxs). The scale bar indicates the number of sequence changes measured during the evolution of the protein sequences being compared (0.3 substitution for every 100 amino acids). The position of the protein encoded by ORF Xf 0611 is indicated by an arrow.

column (30 m × 0.25 mm). For the determination of the monosaccharide composition, the following temperature ramp was used: 50 °C for 1 min, increased to 230 °C at a rate of 40 °C min−1, and then held for 12.5 min. The monosaccharides were identified from the m/z values of their positive ions, by comparison with standards.41 The results were expressed as a relative percentage of each component. In Silico Reconstructions and Comparative Analyses of LPS Biosynthetic Pathways between X. fastidiosa Strains. The annotated genomes of strains 9a5c (GCF_000006725.1) and 6c (AXBS00000000.2) were obtained from NCBI and uploaded into the online genomic analysis software package known as Patric (Pathosystems Resource Integration Center), available at https://www. patricbrc.org/portal/portal/patric/Home. In silico metabolic reconstructions and comparative analyses were conducted with these two genomes, using Patric’s Comparative Pathway Tool, to highlight all similarities and differences regarding

fraction) were visualized after electrophoresis in a 16% SDS− PAGE gel and silver staining, as previously described.39 The carbohydrate composition of purified LPS samples was then evaluated by heteronuclear single-quantum coherence (HSQC) nuclear magnetic resonance (NMR) analysis, as described previously.40 For additional carbohydrate characterization, LPS samples (1 mg) were submitted to derivatization by treatment with 2 M trifluoroacetic acid (TFA) for 8 h at 100 °C. After being dried, the samples were reduced with 1 mg of NaBH4 overnight and the acetate derivatives were extracted with CHCl3. The acetylation was performed with an Ac2O/piridine mixture [1:1 (v/v)], and tubes were held at 100 °C for 30 min. After complete removal of pyridine, the CHCl3 was evaporated and acetylated derivatives were analyzed by gas−liquid chromatography, coupled to mass spectrometry (GC−MS), in a VarianSaturn 2000R-3800 gas chromatograph, coupled to a Varian Ion-Trap 2000R mass spectrometer, equipped with a DB-225 D


Article

Biochemistry

Figure 2. Cloning and expression of the recombinant protein produced by ORF Xf 0611. The entire sequence of ORF Xf 0611 was amplified via PCR and cloned in pET28a(+), as described in Materials and Methods. Panel A shows the sequence of the ∼39.8 kDa recombinant protein, carrying an N-terminal six-His tag produced by such a clone. Methionine residues (M) that indicate the translational start sites of the recombinant and native proteins are highlighted at amino acid positions 1 and 41, respectively. The recombinant plasmid was transformed into E. coli BL21 competent cells, and protein expression was induced with IPTG. As observed in panel B, although the recombinant protein derived from ORF Xf 0611 can be efficiently expressed in these bacteria, it is not present in the soluble fraction obtained from cellular lysates, probably because of intermolecular disulfide bond formation and consequent protein precipitation, mediated by the presence of seven cysteine (C) residues in its primary sequence (also highlighted in panel A): lane 1, molecular weight marker; lane 2, whole cellular lysate (obtained under denaturing conditions) of control, noninduced cultures; lane 3, whole cellular lysate (obtained under denaturing conditions) of IPTG-induced cultures; lane 4, proteins rescued from the insoluble fraction of IPTG-induced cells (see Materials and Methods for details); lane 5, reconstituted recombinant protein isolated after affinity chromatography in a Ni-Sepharose fast-flow column (GE Healthcare Life Sciences).

eight different CLS-related X. fastidiosa strains was verified by PCR, using a pair of primers specifically designed to amplify a 458 bp region of this gene, encompassing the region where the mutation was originally found in strain 6c (5′TATGGAGTGCCCATGTCTG3′ and 5′TCATAGCAACTACGGATGCC3′).15 The amplicons were analyzed by electrophoresis in a 1.5% agarose gel, cloned into the pGEM-T vector, and

genome content between strains 9a5c and 6c, pertaining to the metabolic pathways associated with sugar-nucleotide synthesis and/or interconversions, transglycosylase reactions, and LPS biosynthesis. Amplification of the uxs Gene and Comparative Analyses among Coffee-Related X. fastidiosa Strains. The presence of the frameshift mutation in the uxs gene of E


Article

Biochemistry

Figure 3. Functional characterization of Uxs activity in the purified, recombinant enzyme encoded by ORF Xf 0611. High-performance anionexchange chromatography was performed to confirm the conversion of UDP-GlcA to UDP-Xyl by the recombinant enzyme encoded by ORF Xf 0611, in the presence of NAD+, as a cofactor (see Materials and Methods for details). Panel A shows the chromatographic profile obtained from a reaction mixture in which the recombinant enzyme (1 μg) was incubated with UDP-GlcA for 1 h, in the presence of NAD+. The results show that ∼40% of the UDP-GlcA present in the reaction was converted to UDP-Xyl. Panel B shows the elution profile of a reaction similar to that shown in panel A, but conducted with [glucuronyl-U-14C]UDP-GlcA as a substrate. After incubation, unlabeled UDP-Xyl (Sigma-Aldrich) was added to the reaction mixture to serve as an internal control, which co-eluted with the 14C radioactive signal, represented by the [glucuronyl-U-14C]UDP-Xyl produced in the reaction. Panel C shows the elution profile of a reaction similar to that shown in panel A, but conducted with Ni-Sepharose-purified E. coli extract, derived from a control BL21 strain that does not carry the recombinant plasmid, demonstrating that the enzymatic activity observed in panels A and B does not result from contaminating Uxs from E. coli host cells. A linear NaCl gradient (from 0 to 0.3 M) was used to elute the bound material (shown at the right axis of each graph). The linear NaCl gradient (B%) was obtained by mixing different proportions of solvent A (H2O) with solvent B (2 M NaCl). Panel D shows the amount of radiolabeled product formed, [glucuronyl-U-14C]UDP-Xyl, as a function of the concentration of recombinant Uxs enzyme present in the reaction mixtures. Enzyme activity was estimated, in counts per minute (cpm), by measuring the amount of the radiolabeled product formed, [glucuronyl-U-14C]UDP-Xyl, derived from [glucuronyl-U-14C]UDP-GlcA as a substrate (see Materials and Methods for details).

called UDP-xylose synthases (Uxs), which catalyze the conversion of UDP-glucuronate (UDP-GlcA) into UDP-xylose (UDP-Xyl) as an end product.22,42 Direct Biochemical Assays Performed with the Purified Recombinant Protein Encoded by ORF Xf 0611 Confirm Its Nature as a UDP-Glucuronate Decarboxylase/UDP-Xylose Synthase. To confirm that ORF Xf 0611 corresponds to X. fastidiosa Uxs (Xf Uxs), the complete sequence from this ORF was amplified via PCR, cloned in pET28a(+), and transferred to E. coli BL21 competent cells. Expression of the recombinant protein was induced by IPTG, and its presence in crude bacterial extracts was verified by SDS−PAGE (Figure 2). Surprisingly, the results indicated that the recombinant protein had a tendency to accumulate in bacterial inclusion bodies, probably because of the presence of seven cysteine residues in its primary sequence, which could favor inclusion body formation, due to the establishment of intermolecular disulfide bonds (Figure 2). Accordingly, the Histagged recombinant protein could be purified only from cellular extracts obtained under denaturing conditions, in the presence of 8 M urea, 0.5% SDS, and 5 mM DTT, as described in Materials and Methods. The purified protein obtained through this approach was then renatured by successive dialyses, in the presence of 5 mM DTT (to prevent intermolecular disulfide

sequenced (in both strands) in a 3500xL genetic analyzer (Applied Biossystems). The amplification reactions were performed as described above.

■

RESULTS Evolutionary Analysis of SDR Genes Supports the Functional Annotation of Xf 0611 as a UDP-Glucuronate Decarboxylase/UDP-Xylose Synthase. Because the results obtained from different annotations (all based on in silico comparisons against nucleotide and protein databases) have resulted in conflicting conclusions regarding the actual function of ORF Xf 0611, a thorough comparative analysis was initially performed, involving a large number of genes, representing different subfamilies of SDR enzymes, responsible for a variety of sugar-nucleotide interconversions.20 Thus, the sequences of 45 enzymes, representing different sugar-nucleotide epimerases, dehydratases, and decarboxylases, have been obtained from GenBank and aligned with the aid of ClustalW. The resulting alignment was then used to construct a comparative dendrogram, which clustered the different types of SDR enzymes according to their respective specificities. The results from such an analysis are displayed in Figure 1, showing that ORF Xf 0611 branches within the subfamily of UDP-glucuronate decarboxylases, more precisely, in a subgroup of decarboxylase enzymes F


Article

Biochemistry

Figure 4. Characterization of the carbohydrate composition of LPS samples obtained from X. fastidiosa 9a5c and X. fastidiosa 6c by nuclear magnetic ressonance (NMR) analyses. Panel A displays the results of silver-stained 16% SDS-PAGE, used to show samples of the LPS molecules isolated from X. fastidiosa strains 9a5c (left lane) and 6c (right lane). Panels B and C show the 1H−13C heteronuclear single-quantum coherence (HSQC) spectra obtained for the LPS molecules isolated from strains 9a5c (panel B) and 6c (panel C). The 1H spectra are insets in both. Cross-peaks observed at δ 5.24/98.9, 5.14/98.3, and 5.11/98.6 correspond to the anomeric positions of α-rhamnopyranose, α-xylopyranose, and α-mannopyranose, respectively. β-Xylopyranosyl units were observed at δ 4.41/101.8 and 4.35/101.8. This figure highlights the most prominent structural differences observed between the LPS molecules derived from the two X. fastidiosa strains, the lack of xylopyranose in the polysaccharide region of strain 6c (vertical dashed lines), which is consistent with the presence of a mutated uxs gene in the genome of this strain.

bond formation, which could lead to protein precipitation), and then used in direct biochemical assays to detect Uxs activity (see Materials and Methods). Thus, the renatured protein was used in enzymatic assays containing UDP-GlcA, to check for its capacity to convert this sugar-nucleotide into UDP-Xyl, as described in Materials and

Methods. As observed in Figure 3A, incubation of UDP-GlcA with the purified recombinant protein resulted in its direct conversion to UDP-Xyl, characterized by a peak that elutes at ∼12 min, during HPLC analysis. To confirm that this peak represents UDP-Xyl, a similar reaction was performed using [glucuronyl-U-14C]UDP-GlcA, and this reaction mixture was G


Article

Biochemistry

Figure 5. Characterization of the monosaccharide composition of LPS samples obtained from X. fastidiosa 9a5c and X. fastidiosa 6c by gas chromatography coupled to mass spectrometry (GC−MS). This figure shows the characterization and quantification of individual monosaccharides present in each LPS, by GC−MS, as described in Materials and Methods. Identification of individual monosaccharides present in each LPS sample was performed by the retention time and mass profile of fragments. Monosaccharide compositions (shown in detail in Table 1) were expressed as a percentage of the total detected carbohydrate represented by each of the sugar moieties, calculated from their respective peak area values.

described in Materials and Methods. The 1H−13C HSQC NMR spectra obtained for the LPS molecules isolated from X. fastidiosa strains 9a5c and 6c are depicted in panels B and C of Figure 4, respectively. Several anomeric signals are observed from 1H δ 5.24 to 4.35 and from 13C δ 98 to 103. The crosspeak at δ 5.14/98 (1H/13C) corresponds to the α-xylopyranose residues,47,48 while the cross-peaks at δ 4.41 and 4.35/102 (1H/13C) point to the presence of β-xylopyranosyl units that were further confirmed by the 3JH1−H2 values of 6.8 and 7.8 Hz, respectively. On the other hand, the HSQC NMR spectrum of the LPS obtained from strain 6c did not show the anomeric proton/carbon signals attributed to xylopyranose units, which is consistent with the presence of a mutated uxs gene in the genome of this strain (see dashed vertical lines in Figure 4). To confirm this finding and obtain a more precise characterization of LPS monosaccharide composition of these bacteria, LPS samples from each strain were treated with trifluoroacetic acid (TFA) and the resulting monosaccharides were identified and quantified by GC−MS, as described in Materials and Methods. As observed in Figure 5 and Table 1,

spiked with unlabeled UDP-Xyl, to serve as an internal control during the elution process (see Materials and Methods for details). As observed in Figure 3B, a single peak representing UDP-Xyl is observed after elution for ∼12 min and the 14C radioactive signal associated with [14C]UDP-Xyl co-elutes with this peak. These results indicate that the renaturation process employed during purification was sufficient to rescue, at least in part, the original enzymatic activity of the recombinant protein and confirm its nature as Xf Uxs. Moreover, as observed in Figure 3C, the conversion of UDP-GlcA to UDP-Xyl is directly dependent on the presence of Xf Uxs, because it cannot be observed when the reaction is performed with Ni-Sepharosepurified E. coli extracts, derived from a control BL21 strain that does not carry the recombinant plasmid, demonstrating that the enzymatic activity observed in these experiments does not result from contaminating Uxs from E. coli host cells. Finally, precise quantitative measurements of XfUxs activity were obtained by evaluating the amount of formed product, [glucuronyl-U-14C]UDP-Xyl, as a function of enzyme concentration, using [glucuronyl-U-14C]UDP-GlcA as a substrate (see Materials and Methods). As observed in Figure 3D, this assay clearly indicates that increasing concentrations of the enzyme resulted in enhanced turnover ratios. The Frameshift Mutation in the uxs Gene Prevents Incorporation of Xylose Residues into Bacterial LPS, Altering the Monosaccharide Composition of This Glycoconjugate among X. fastidiosa Strains. Xylose has been rarely found as a component of bacterial glycans and/or glycoconjugates. In spite of a few cases, in which this monosaccharide has been described in association with glycoproteins and exopolysaccharides (EPS), most cases involving the presence of xylose in bacterial structures relate to its presence in lipopolysaccharide (LPS), as in the cases of Ralstonia solanacearum, Pseudomonas aeruginosa, Sinorhizobium meliloti, Bradyrhizobium japonicum, and Leptospira spp.43−46 In X. fastidiosa, LPS has been shown to play important roles in both host recognition and disease development,31,32 and the frameshift observed in X. fastidiosa uxs may influence the monosaccharide composition of LPS molecules in bacterial strains carrying such a mutation. To test this hypothesis, LPS was purified from two X. fastidiosa isolates: CVC-associated isolate 9a5c (which bears a functional uxs gene) and CLSrelated isolate 6c (in which uxs is inactivated by the frameshift) (Figure 4). Samples from these two LPS preparations were initially characterized by nuclear magnetic resonance, as

Table 1. Monosaccharide Composition Analysis of LPS in X. fastidiosa Strains 9a5c and 6c monosaccharidea

tRb

Xf 9a5c

Xf6c

rhamnose arabinose xylose mannose galactose glucose glucosamine

7.79 8.48 9.12 12.19 12.78 13.25 31.71

35.2 10.1 13.1 25.4 4.5 6.9 4.7

35.8 13.8 not detected 18.1 11.2 6.5 14.5

a

GC−MS analysis of alditol acetates. bRetention time in minutes on a DB-225 column, from 50 to 230 °C (40 °C min−1, then held for 12.5 min).

LPS molecules obtained from both X. fastidiosa strains share a series of common monosaccharides, varying their relative ratios between the studied strains. As expected, however, these data confirm that no xylose residues could be found in the LPS from strain 6c, whereas strain 9a5c can incorporate this monosaccharide into its LPS molecules, because of the presence of an intact uxs gene. In Silico Comparative Analyses of LPS Biosynthetic Genes between X. fastidiosa Strains 9a5c and 6c. To H


Article

Biochemistry

Figure 6. Detection of the frameshift mutation in the sequence of the uxs gene from other CLS-related X. fastidiosa strains. The region encompassing the frameshift mutation found in the uxs gene from X. fastidiosa 6c was amplified via PCR from eight different CLS-related X. fastidiosa strains and sequenced, as described in Materials and Methods. All strains identified as members of a phylogenetically distinct clade (group II CLS strains) carry the same mutation, which inactivates their uxs gene. This mutation is not present in group I CLS-related strains, which are phylogenetically closer to citrus-infecting X. fastidiosa strain 9a5c.

one subgroup), identified the mutated uxs gene only in isolate 6c, while isolate 32 (phylogenetically closer to citrus-infecting strains, such as 9a5c) bears an intact uxs gene. Thus, a broader investigation was conducted, to verify if the mutation in uxs is fortuitously present only in isolate 6c or if it represents an evolutionarily significant mutation, spread through other CLS strains of the same group. Thus, the region encompassing the uxs gene from all these coffee-infecting X. fastidiosa isolates has been amplified via PCR, cloned, and sequenced, showing that this mutation is present in all isolates originally classified as group II CLS strains, but absent in those belonging to group I (Figure 6). These results suggest that the loss of Uxs activity may represent an evolutionary hallmark among the group II CLS-related X. fastidiosa strains, because these bacteria cannot incorporate xylose moieties into their LPS, or in any other glycan, which may impact their outer membrane ultrastructure and, perhaps, their capacity to interact with different host surfaces (see below).

verify if other genomic differences between strains 9a5c and 6c could explain the lack of xylose in the LPS of 6c, we submitted both genomes to functional in silico comparative analyses, using the Comparative Pathway Tool, available at the Pathosystems Resource Integration Center (Patric), as described in Materials and Methods. Detailed analyses of the major metabolic pathways were performed between the two bacteria, with special emphasis on mechanisms directly related to LPS carbohydrate composition. Thus, as observed in Supplementary Table 1, all genes associated with sugar-nucleotide synthesis and/or interconversions (responsible for producing the sugar donors to LPS), transglycosylase reactions (responsible for transferring monosaccharide moieties from sugar-nucleotide donors and producing the polysaccharide portion of LPS), and LPS biosynthesis (including the genes involved in Lipid A production, attachment of a polysaccharide to the lipid portion of LPS, and O-antigen attachment and/or polymerization) are conserved in the two strains, with the exception of the putative uxs gene, represented by ORF Xf 0611, which is inactivated by the frameshift mutation in 6c. Moreover, as observed in Supplementary Figure 1, Uxs is responsible for the only reaction that leads to the synthesis of UDP-Xyl and no alternative pathways can lead to the production of this metabolite. Because UDP-Xyl is the xylose donor in the transglycosylation reaction that incorporates this monosaccharide into bacterial glycans (including LPS), the lack of xylose in the LPS of 6c is in full accord with the in silico metabolic reconstructions made by Patric. These analyses provide a direct correlation between two specific genotypes (active or inactive putative uxs gene) and their predicted phenotypic traits (presence or absence of xylose in LPS), because the two bacteria display the same genetic background, concerning the remaining genes involved in the mechanisms that determine LPS carbohydrate composition. X. fastidiosa uxs Is Inactivated by the Same Frameshift Mutation in a Phylogenetically Distinct Group of CLS-Related Strains. The frameshift mutation that inactivates the uxs gene in strain 6c was originally identified in a study that evaluated the evolutionary history of eight CLS-related strains of X. fastidiosa subsp. pauca.15 A microarray-based phylogenomic analysis conducted in this study showed that these coffee-related strains split into two major groups, mostly characterized by differences that map into putative mobile elements, previously identified in the genome of strain 9a5c.49,50 The first subgroup (group I) is composed of strains 9c, 32, iso32, and 33, and the second subgroup (group II) is composed of strains 08, 6c 48, and 23.15 Draft genomes, assembled for two of these strains, 6c and 32 (each representing

■

DISCUSSION A limited amount of information concerning the general biology of X. fastidiosa had been gathered prior to the late 1990s, when this bacterium became notorious, because of the surge of CVC as a major crop disease in Brazil. This situation started to change dramatically in the year 2000, when X. fastidiosa (strain 9a5c) became the first phytopathogen to have its complete genome sequenced and annotated, allowing in silico reconstruction of the major biochemical processes that occur in this microorganism.18 Over the following years, genomic comparisons conducted with alternative strains and functional analyses, obtained by the evaluation of differential gene expression, or by the generation of gene-knockout mutants, helped to confirm many predicted features regarding the general biology of X. fastidiosa strains and the relationships they can establish with their respective hosts during colonization and disease development.51,52 However, annotations involving X. fastidiosa genomes have been essentially performed through homology searches against public databases, and in spite of the great deal of information gathered from such genomic data, a large number of genes described in these bacteria remain associated with the production of conserved hypothetical proteins, whose functions (if any) are still unknown.18 Moreover, comparative analyses involving multiple strains may have contributed to propagate wrongfully assigned gene functions among the group,27 a problem often verified in genomic studies, which can only be solved through direct functional analyses, performed with geneknockout mutants and/or specific biochemical tests.53−55 The SDR gene described in this work is a good example of such a I


Article

Biochemistry

unstable and spontaneously decarboxylates, forming the more stable intermediate UDP-α-D-4-keto-xylose (UX4O). In a second step, the NADH cofactor produced in the first step is used to reduce UX4O, converting it to UDP-Xyl and regenerating NAD+.22 Enzymes from the ArnA subfamily, on the other hand, are bifunctional enzymes, whose C-terminal domains display the same UDP-GlcA decarboxylase activity observed in Uxs; however, their N-terminal region displays a formyl transferase activity that directs UDP-GclA to an alternative pathway, ultimately leading to the synthesis of UDP-4-amino-4-deoxy-L-arabinose (UDP-L-Ara4N), a sugarnucleotide derivative involved in LPS modifications that confer increased bacterial resistance to cationic antimicrobial peptides (CAMPs), such as cecropin A and polymyxin B.69−71 The functional characterization of the enzyme encoded by ORF Xf 0611 as a legitimate Uxs is, therefore, direct biochemical evidence that this bacterium can effectively incorporate xylose into glycan structures. This possibility was further confirmed by identifying this monosaccharide as a component of the LPS produced by a X. fastidiosa strain that carries a functional copy of the uxs gene (9a5c), as opposed to a strain carrying the mutated copy of uxs (6c), which could not incorporate xylose into LPS. Although xylose is commonly found in polysaccharide components of both plant and fungal cell walls,72,73 as well as in glycosaminoglycans of higher eukaryotes,74 few bacterial glycans have been shown to contain xylose in their structure,75,76 as is the case of the S-layer glycoproteins found in Parabacteroides distasonis and Tannerella forsythia,72,73 the O-antigen from P. aeruginosa serotype O7,44,45 and the core oligosaccharide of LPS molecules found in Leptospira spp.,77,78 S. meliloti,79 and R. solanacearum.42 As widely documented in the literature, LPS is a tripartite glycolipid composed of a conserved lipid A, an oligosaccharide core, and a variable O-antigen polysaccharide.80 Approximately 75% of the outer membrane of Gram-negative bacteria is composed of LPS, making it the most prominently displayed macromolecule on the cell surface.81 As a result, several interactions between these bacteria and their surrounding environments have been shown to be mediated by such molecules.80 For example, LPS may contribute to the initial adhesion of bacterial cells to different surfaces, trigger recognition mechanisms by their hosts, and protect bacteria from several antimicrobial compounds.82−84 LPS may also play an important role as a virulence factor in pathogenic bacteria, because the lipid A portion of these molecules may act as an endotoxin, triggering inflammatory reactions in different animal models, and its oligosaccharide portion is known to elicit antibody production, especially against the highly variable Oantigen side chains, which help to determine the different serotypes among Gram-negative bacteria.85,86 In plants, LPS may serve as pathogen-associated molecular patterns (PAMPs), which activate the PAMP-triggered immune (PTI) response87,88 and have also been implicated in mediating compatibility between some symbiotic bacteria and their plant hosts, as in the case of nitrogen-fixing bacteria.25,89 In fact, LPS is a major mediator in the cross-talk between phytobacteria and their plant hosts, and the presence or absence of specific carbohydrate moieties in the composition of LPS structure may directly affect the outcome of such interactions. For example, mutations in the rf bB gene (responsible for the production of dTDP-rhamnose) have been shown to affect the capacity of Herbaspirillum seropedicae cells to attach to maize root surface plantlets, as rf bB mutants display an ∼100-fold lower

scenario, because, as described above, successive annotations have not clearly determined its precise enzymatic function, because it has been identified as a dehydratase, an epimerase, or a decarboxylase, involved in several unrelated processes, such as the Leloir pathway and/or with the biosynthesis of sugarnucleotide donors of different carbohydrate moieties (glucose, rhamnose, and xylose), which could be potentially incorporated into bacterial glycans.18,27 A limited number of analyses have been conducted so far, to confirm the specific functions assigned to X. fastidiosa gene products, partly because most X. fastidiosa strains are not amenable to genetic transfection protocols, which has limited gene-knockout studies to a few strains, such as the PDassociated isolate Temecula 1.56−58 This phenotypic trait seems to be particularly prevalent among members of X. fastidiosa subsp. pauca, such as 9a5c and 6c. In fact, attempts have been made to transform a series of coffee-related X. fastidiosa subsp. pauca strains in our laboratory (including 6c), but transformants could not be obtained from any of them (data not shown). The genes and mechanisms that determine such intolerance to genetic manipulation in X. fastidiosa subsp. pauca are only beginning to be unraveled, as recently described in a study showing the first genomic sequencing of a transformable X. fastidiosa subsp. pauca strain, obtained from citrus.59 While additional experiments are still necessary to clarify this issue, current evidence points to the possible involvement of a series of genes that encode DNA modification/restriction enzymes, which, incidentally, are also present in 6c and other related coffee-associated strains.15,59 Functional assays performed with recombinant X. fastidiosa proteins have also been employed to gather information regarding the structure and enzymatic properties of a few elements, potentially involved in bacterial resistance, adaptation, and virulence, such as heat/cold shock proteins, oxidative stress resistance factors, and the polygalacturonase gene (believed to contribute to bacterial dissemination within xylem vessels), among others.60−64 Moreover, because the occlusion of xylem by bacterial aggregates is considered one of the main factors associated with X. fastidiosa-related diseases, functional analyses have also attempted to characterize outer membrane adhesins and enzymes involved in the production of glycans, such as EPS and LPS, which have been shown to participate in biofilm formation and bacterial adherence.65−68 Glycan structure has long been acknowledged as an important mediator of cell adherence in both eukaryotic and prokaryotic cells. However, the incorporation of different monosaccharides into growing glycan chains depends on their activation into sugar-nucleotide derivatives and further interconversion reactions, mostly mediated by specific SDRmodifying enzymes.19 For example, the incorporation of xylose residues into glycans requires its addition from the nucleotideactivated precursor UDP-Xyl, which is synthesized from UDPGlcA by a UDP-GlcA decarboxylase. In bacteria, however, two different types of UDP-GlcA decarboxylases have been characterized: UDP-xylose synthases (Uxs) and UDP-4amino-4-deoxy-L-arabinose formyltransferases (ArnA). Both enzymes are significantly similar (particularly in their Cterminal regions, where a UDP-GlcA-specific binding site is located) but catalyze very distinct reactions.22,42 Enzymes from the Uxs subfamily catalyze the conversion of UDP-GlcA to UDP-Xyl in a two-step reaction. First, the enzyme uses a bound NAD+ cofactor to oxidize the C4′ atom of the glucuronate moiety, present in UDP-GlcA. The resulting β-keto acid is J


Article

Biochemistry attachment capacity, when compared to that of wild-type cells.25 In a similar study,26 an EZ-Tn5 transposon mutation in the rf bC gene (also involved in dTDP-rhamnose production) of Xanthomonas citri subsp. citri affected both LPS biosynthesis and biofilm formation in this phytopathogen, because the mutant was not capable of forming a structured biofilm on glass slides or on the surface of plant leaves. This mutant also showed reduced virulence and a decreased level of growth when spray-inoculated on the leaves of susceptible plants. Preliminary characterization of the LPS molecules produced by these mutants has been performed, and as expected, it was confirmed that, while the wild-type LPS oligosaccharide chains showed rhamnose, glucose, and N-acetylglucosamine as the predominant monosaccharides, rhamnose and N-acetylglucosamine were not found in the rf bB and rf bC mutant strains.25,26 LPS has also been characterized as an important virulence factor in X. fastidiosa, because deletion of a key O-antigen biosynthetic gene resulted in the production of defective LPS molecules, affecting cell surface attachment, cell−cell aggregation, and biofilm maturation, compromising the bacterium’s ability to colonize its plant host.31 Finally, the results presented in this work clearly indicate that the frameshift mutation found in the X. fastidiosa uxs gene is not fortuitously present only in isolate 6c but represents a genetic condition widespread throughout an entire subgroup of phylogenetically related coffee-infecting X. fastidiosa strains. This suggests that CLS-related bacteria display structural differences in their respective LPS, characterizing a morphological hallmark of their outer membrane ultrastructure that differentiates these two subgroups of coffee-infecting X. fastidiosa strains. At this point, however, there is no evidence that the presence or absence of xylose residues may affect their capacity to interact with different host surfaces and/or act as a major determinant for virulence and/or plant host specificity in X. fastidiosa strains, because CLS-related bacteria seem to be equally capable of infecting and inducing symptoms in coffee plants. Nonetheless, a recent study32 has demonstrated that LPS also plays a key role in determining colonization of insect hosts, because X. fastidiosa cells producing a truncated form of LPS display a decreased level of attachment to blue-green sharpshooter foreguts, impairing pathogen acquisition and transmission by insect vectors. Thus, it will be interesting to verify if the different LPS structures, determined by the presence or absence of a functional uxs gene, may contribute to vector range specificity between these two subgroups of CLSrelated bacteria, because factors that may contribute to determining efficient interactions between insect vectors and X. fastidiosa strains are a matter of growing concern, given the importance of vectors in the process of pathogen dissemination in affected areas.

■

■

Uxs, whose gene is present in the genome of X. fastidiosa 9a5c but is inactivated by a frameshift mutation in the genome of X. fastidiosa 6c (Supplementary Figure 1) (PDF) Comparative analysis of gene composition between strains 9a5c and 6c, concerning genes involved in nucleotide-sugar synthesis and/or interconversions, lipopolysaccharide biosynthesis, and glycosyltransferase reactions. Genomic information for both X. fastidiosa 9a5c and 6c has been obtained through GenBank, under accession numbers GCF_000006725.1 and AXBS00000000.2, respectively. Comparisons were made with the aid of the Comparative Pathway Tool, available in Patric, as described in Materials and Methods. Lines labeled in green indicate ORFs present in both genomes, while the line labeled in red highlights the ORF that encodes Uxs, which is present in the genome of X. fastidiosa 9a5c but is inactivated by a frameshift mutation in the genome of X. fastidiosa 6c (Supplementary Table 1) (XLSX)

AUTHOR INFORMATION

Corresponding Author

*Centro de Ciências Naturais e Humanas, Universidade Federal do ABC, Rua Santa Adélia, 166, Santo André, SP CEP 09210-170, Brazil. E-mail: [email protected]. Phone: +55 (11) 4996-8371. Fax: +55 (11) 4996-3166. Funding

This work was supported by grants from Conselho Nacional de ́ Desenvolvimento Cientifico e Tecnológico (CNPq) and Fundaçaõ de Amparo ao Ensino e à Pesquisa-FAEP. V.C.A. is the recipient of a scholarship grant from the Brazilian Federal Agency CAPES. Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS The authors thank Dr. Lauro M. de Souza and Dr. Arquimedes P. Santana-Filho for their kind contribution to mass spectral analysis.

■

REFERENCES

(1) Hopkins, D. L., and Purcell, A. H. (2002) Xylella fastidiosa: Cause of Pierce’s disease of grapevine and other emergent diseases. Plant Dis. 86, 1056−1066. (2) Chatterjee, S., Almeida, R. P., and Lindow, S. (2008) Living in two worlds: the plant and insect lifestyles of Xylella fastidiosa. Annu. Rev. Phytopathol. 46, 243−271. (3) Tumber, K. P., Alston, J. M., and Fuller, K. (2014) Pierce’s disease costs California $104 million per year. Calif. Agric. 68, 20−29. (4) EFSA PLH Panel (EFSA Panel on Plant Health) (2015) Scientific Opinion on the risk to plant health posed by Xylella fastidiosa in the EU territory, with the identification and evaluation of risk reduction options. EFSA J. 13 (3989), 262. (5) Su, C.-C., Chang, J. C., Chang, C.-M., Shih, H.-T., Tzeng, K.-C., Jan, F.-J., Kao, C.-W., and Deng, W.-L. (2013) Pierce’s disease of grapevines in Taiwan: isolation, cultivation and pathogenicity of Xylella fastidiosa. J. Phytopathol. 161, 389−396. (6) Saponari, M., Boscia, D., Nigro, F., and Martelli, G. P. (2013) Identification of DNA sequences related to Xylella fastidiosa in oleander, almond and olive trees exhibiting leaf scorch symptoms in Apulia (Southern Italy). J. Plant Pathol. 95, 668. (7) Martelli, G. P. (2014) The olive quick decline syndrome: State of the art. Proceedings of the International Symposium on the European

ASSOCIATED CONTENT

S Supporting Information *

The Supporting Information is available free of charge on the ACS Publications website at DOI: 10.1021/acs.biochem.6b00886. Matabolic map of the major pathways associated with sugar-nucleotide biosynthesis and/or interconversions in bacteria. Boxes labeled in green indicate reactions that are performed by genes present in the genomes of both X. fastidiosa strains studied herein (9a5c and 6c). The box labeled in red indicates the reaction mediated by K


Article

Biochemistry Outbreak of Xylella fastidiosa in Olive; Gallipoli-Locorotondo, Italy, October 21−24, 2014; pp 27−28. (8) EPPO (European and Mediterranean Plant Protection Organization) (2015) First reports of Xylella fastidiosa in the EPPO region. http://www.eppo.int/QUARANTINE/special_topics/ Xylella_fastidiosa/Xylella_fastidiosa.htm. Accessed on 07/30th/2016. (9) EPPO (European and Mediterranean Plant Protection Organization) (2012) EPPO Reporting Service no. 8, Paris, 201208-01. 2012/165-Xylella fastidiosa detected in a containment facility in France. http://archives.eppo.int/EPPOReporting/2012/Rse-1208.pdf. Accessed on 07/30th/2016. (10) Jacques, M. A., Denancé, N., Legendre, B., Morel, E., Briand, M., Mississipi, S., Durand, K., Olivier, V., Portier, P., Poliakoff, F., and Crouzillat, D. (2016) New Coffee Plant-Infecting Xylella fastidiosa Variants Derived via Homologous Recombination. Appl. Environ. Microbiol. 82, 1556−1568. (11) Beretta, M. J. G., Harakava, R., and Chagas, C. M. (1996) First report of Xylella fastidiosa in coffee. Plant Dis. 80, 821. (12) Paradela-Filho, O., Sugimori, M. H., Ribeiro, I. J. A., Garcia-Jr, A., Beretta, M. J. G., Harakawa, R., Machado, M. A., Laranjeira, F. F., Rodrigues Neto, J., and Beriam, L. O. S. (1997) Occurrence of Xylella fastidiosa in coffee plants in Brazil. Summa Phytopathol. 23, 46−49. (13) Rodríguez, C. M., Obando, J. J., Villalobos, W., Moreira, L., and Rivera, C. (2001) First report of Xylella fastidiosa infecting coffee in Costa Rica. Plant Dis. 85, 1027. (14) de Lima, J. E. O., Miranda, V. S., Hartung, J. S., Brlansky, R. H., Coutinho, A., Roberto, S. R., and Carlos, E. F. (1998) Coffee leaf scorch bacterium: Axenic culture, pathogenicity, and comparison with Xylella fastidiosa of citrus. Plant Dis. 82, 94−97. (15) Barbosa, D., Alencar, V. C., Santos, D. S., de Freitas Oliveira, A.C., de Souza, A. A., Coletta-Filho, H. D., Costa de Oliveira, R., and Nunes, L. R. (2015) Comparative genomic analysis of coffee-infecting Xylella fastidiosa strains isolated from Brazil. Microbiology 161, 1018− 1033. (16) Marcelletti, S., and Scortichini, M. (2016) Genome-wide comparison and taxonomic relatedness of multiple Xylella fastidiosa strains reveal the occurrence of three subspecies and a new Xylella species. Arch. Microbiol. 198, 803−812. (17) Alencar, V. C., Barbosa, D., Santos, D. S., Oliveira, A. C., de Oliveira, R. C., and Nunes, L. R. (2014) Genomic Sequencing of Two Coffee-Infecting Strains of Xylella fastidiosa Isolated from Brazil. Genome Announcements 2, e01190-13. (18) Simpson, A. J. G., Reinach, F. C., Arruda, P., Abreu, F. A., Acencio, M., Alvarenga, R., Alves, L. M. C., et al. (2000) The genome sequence of the plant pathogen Xylella fastidiosa. Nature 406, 151− 159. (19) Kavanagh, K. L., Jörnvall, H., Persson, B., and Oppermann, U. (2008) Medium- and short-chain dehydrogenase/reductase gene and protein families: the SDR superfamily: functional and structural diversity within a family of metabolic and regulatory enzymes. Cell. Mol. Life Sci. 65, 3895−3906. (20) Bray, J. E., Marsden, B. D., and Oppermann, U. (2009) The human short-chain dehydrogenase/reductase (SDR) superfamily: a bioinformatics summary. Chem.-Biol. Interact. 178, 99−109. (21) Jiang, S. S., Lin, T. Y., Wang, W. B., Liu, M. C., Hsueh, P. R., and Liaw, S. J. (2010) Characterization of UDP-glucose dehydrogenase and UDP-glucose pyrophosphorylase mutants of Proteus mirabilis: defectiveness in polymyxin B resistance, swarming, and virulence. Antimicrob. Agents Chemother. 54, 2000−2009. (22) Coyne, M. J., Fletcher, C. M., Reinap, B., and Comstock, L. E. (2011) UDP-glucuronic acid decarboxylases of Bacteroides f ragilis and their prevalence in bacteria. J. Bacteriol. 193, 5252−5259. (23) Zou, Y., Feng, S., Xu, C., Zhang, B., Zhou, S., Zhang, L., He, X., Li, J., Yang, Z., and Liao, M. (2013) The role of galU and galE of Haemophilus parasuis SC096 in serum resistance and biofilm formation. Vet. Microbiol. 162, 278−284. (24) Köplin, R., Wang, G., Hötte, B., Priefer, U. B., and Pühler, A. A. (1993) 3.9-kb DNA region of Xanthomonas campestris pv. campestris that is necessary for lipopolysaccharide production encodes a set of

enzymes involved in the synthesis of dTDP-rhamnose. J. Bacteriol. 175, 7786−7792. (25) Balsanelli, E., Serrato, R. V., de Baura, V. A., Sassaki, G., Yates, M. G., Rigo, L. U., Pedrosa, F. O., de Souza, E. M., and Monteiro, R. A. (2010) Herbaspirillum seropedicae rf bB and rf bC genes are required for maize colonization. Environ. Microbiol. 12, 2233−2244. (26) Li, J., and Wang, N. (2011) The wxacO gene of Xanthomonas citri ssp. citri encodes a protein with a role in lipopolysaccharide biosynthesis, biofilm formation, stress tolerance and virulence. Mol. Plant Pathol. 12, 381−396. (27) Varani, A. M., Monteiro-Vitorello, C. B., de Almeida, L. G. P., Souza, R. C., Cunha, O. L., Lima, W. C., Civerolo, E., Van Sluys, M.-A., and Vasconcelos, A. T. (2012) Xylella fastidiosa comparative genomic database is an information resource to explore the annotation, genomic features, and biology of different strains. Genet. Mol. Biol. 35 (1), 149− 152. (28) Beerens, K., Soetaert, W., and Desmet, T. (2015) UDP-hexose 4-epimerases: a view on structure, mechanism and substrate specificity. Carbohydr. Res. 414, 8−14. (29) Coyne, M. J., Fletcher, C. M., Reinap, B., and Comstock, L. E. (2011) UDP-glucuronic acid decarboxylases of Bacteroides f ragilis and their prevalence in bacteria. J. Bacteriol. 193 (19), 5252−9. (30) Gu, X., Lee, S. G., and Bar-Peled, M. (2011) Biosynthesis of UDP-xylose and UDP-arabinose in Sinorhizobium meliloti 1021: first characterization of a bacterial UDP-xylose synthase, and UDP-xylose 4-epimerase. Microbiology 157, 260−269. (31) Clifford, J. C., Rapicavoli, J. N., and Roper, M. C. (2013) A rhamnose-rich O-antigen mediates adhesion, virulence, and host colonization for the xylem-limited phytopathogen Xylella fastidiosa. Mol. Plant-Microbe Interact. 26, 676−685. (32) Rapicavoli, J. N., Kinsinger, N., Perring, T. M., Backus, E. A., Shugart, H. J., Walker, S., and Roper, M. C. (2015) O antigen modulates insect vector acquisition of the bacterial plant pathogen Xylella fastidiosa. Appl. Environ. Microbiol. 81, 8145−8154. (33) da Silva, V.S., Shida, C. S., Rodrigues, F. B., Ribeiro, D. C., de Souza, A. A., Coletta-Filho, H. D., Machado, M. A., Nunes, L. R., and de Oliveira, R. C. (2007) Comparative genomic characterization of citrus-associated Xylella fastidiosa strains. BMC Genomics 8, 474. (34) Ronquist, F., and Huelsenbeck, J. P. (2003) Mr. Bayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 19, 1572−1574. (35) Letunic, I., and Bork, P. (2007) Interactive Tree Of Life (iTOL): an online tool for phylogenetic tree display and annotation. Bioinformatics 23, 127−128. (36) Bradford, M. (1976) A Rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72, 248−254. (37) Moriarity, J. L., Hurt, K. J., Resnick, A. C., Storm, P. B., Laroy, W., Schnaar, R. L., and Snyder, S. H. (2002) UDP-glucuronate decarboxylase, a key enzyme in proteoglycan synthesis: cloning, characterization, and localization. J. Biol. Chem. 277, 16968−16975. (38) Westphal, O., and Jann, K. (1996) Bacterial lipopolusaccharides: extraction with phenol water and further applications of the procedure, Methods Carbohydr. Chemistry 5, 83−91. (39) Rezania, S., Amirmozaffari, N., Tabarraei, B., Jeddi-Tehrani, M., Zarei, O., Alizadeh, R., Masjedian, F., and Zarnani, A. H. (2011) Extraction, Purification and Characterization of Lipopolysaccharide from Escherichia coli and Salmonella typhi. Avicenna J. Med. Biotechnol. 3, 3−9. (40) Sassaki, G. L., Riter, D. S., Santana Filho, A. P., Guerrini, M., Lima, M. A., Cosentino, C., Souza, L.M., Cipriani, T. R., Rudd, T. R., Nader, H. B., Yates, E. A., Gorin, P. A., Torri, G., and Iacomini, M. (2011) A robust method to quantify low molecular weight contaminants in heparin: detection of tris (2-n-butoxyethyl) phosphate. Analyst 136, 2330−2338. (41) Sassaki, G. L., Souza, L. M., Serrato, R. V., Cipriani, T. R., Gorin, P. A. J., and Iacomini, M. (2008) Application of acetate derivatives for gas chromatography-mass spectrometry: novel approaches on L


Article

Biochemistry carbohydrates, lipids and amino acids analysis. J. Chromatogr. 1208, 215−222. (42) Gu, X., Glushka, J., Yin, Y., Xu, Y., Denny, T., Smith, J., Jiang, Y., and Bar-Peled, M. (2010) Identification of a bifunctional UDP-4-ketopentose/ UDP-xylose synthase in the plant pathogenic bacterium Ralstonia solanacearum strain GMI1000, a distinct member of the 4,6dehydratase and decarboxylase family. J. Biol. Chem. 285, 9030−9040. (43) Puvanesarajah, V., Schell, F. M., Gerhold, D., and Stacey, G. (1987) Cell surface polysaccharides from Bradyrhizobium japonicum and a nonnodulating mutant. J. Bacteriol. 169, 137−141. (44) Knirel, Y. A. (1990) Polysaccharide antigens of Pseudomonas aeruginosa. Crit. Rev. Microbiol. 17, 273−304. (45) Bystrova, O. V., Knirel, Y. A., Lindner, B., Kocharova, N. A., Kondakova, A. N., Zähringer, U., and Pier, G. B. (2006) Structures of the core oligosaccharide and O-units in the R- and SR-type lipopolysaccharides of reference strains of Pseudomonas aeruginosa Oserogroups. FEMS Immunol. Med. Microbiol. 46, 85−99. (46) Gu, X., Lee, S. G., and Bar-Peled, M. (2011) Biosynthesis of UDP-xylose and UDP-arabinose in Sinorhizobium meliloti 1021: first characterization of a bacterial UDP-xylose synthase, and UDP-xylose 4-epimerase. Microbiology 157 (1), 260−9. (47) Liu, H., Fan, Y., Wang, W., Liu, N., Zhang, H., Zhu, Z., and Liu, A. (2012) Polysaccharides f rom Lycium barbarum leaves: isolation, characterization and splenocyte proliferation activity. Int. J. Biol. Macromol. 51, 417−422. (48) Zhu, J., Liu, W., Yu, J., Zou, S., Wang, J., Yao, W., and Gao, X. (2013) Characterization and hypoglycemic effect of a polysaccharide extracted from the fruit of Lycium barbarum L. Carbohydr. Polym. 98, 8−16. (49) Nunes, L. R., Rosato, Y. B., Muto, N. H., Yanai, G. M., da Silva, V. S., Leite, D. B., Goncalves, E. R., de Souza, A. A., Coletta-Filho, H. D., Machado, M. A., Lopes, S. A., and de Oliveira, R. C. (2003) Microarray analyses of Xylella fastidiosa provide evidence of coordinated transcription control of laterally transferred elements. Genome Res. 13, 570−578. (50) de Mello Varani, A., Souza, R. C., Nakaya, H. I., de Lima, W. C., Paula de Almeida, L. G., Kitajima, E. W., Chen, J., Civerolo, E., Vasconcelos, A. T., and Van Sluys, M. A. (2008) Origins of the Xylella fastidiosa prophage-like regions and their impact in genome differentiation. PLoS One 3, e4059. (51) de Souza, A. A., Takita, M. A., Coletta-Filho, H. D., Caldana, C., Goldman, G. H., Yanai, G. M., Muto, N. H., de Oliveira, R. C., Nunes, L. R., and Machado, M. A. (2003) Analysis of gene expression in two growth states of Xylella fastidiosa and its relationship with pathogenicity. Mol. Plant-Microbe Interact. 16, 867−875. (52) Reddy, J. D., Reddy, S. L., Hopkins, D. L., and Gabriel, D. W. (2007) TolC is required for pathogenicity of Xylella fastidiosa in Vitis vinifera grapevines. Mol. Plant-Microbe Interact. 20, 403−410. (53) Karp, P. (1998) What we do not know about sequence analysis and sequence databases. Bioinformatics 14, 753−754. (54) Brenner, S. E. (1999) Errors in genome annotation. Trends Genet. 15, 132−133. (55) Joshi, T., and Xu, D. (2007) Quantitative assessment of relationship between sequence similarity and function similarity. BMC Genomics 8, 222. (56) Monteiro, P. B., Teixeira, D. C., Palma, R. R., Garnier, M., Bové, J. M., and Renaudin, J. (2001) Stable transformation of the Xylella fastidiosa citrus variegated chlorosis strain with oriC plasmids. Appl. Environ. Microbiol. 67, 2263−2269. (57) Kung, S. H., Retchless, A. C., Kwan, J. Y., and Almeida, R. P. (2013) Effects of DNA size on transformation and recombination efficiencies in Xylella fastidious. Appl. Environ. Microbiol. 79, 1712− 1717. (58) Johnson, K. L., Cursino, L., Athinuwat, D., Burr, T. J., and Mowery, P. (2015) Potential complications when developing gene deletion clones in Xylella fastidiosa, BMC Res. BMC Res. Notes 8, 155. (59) Niza, B., Merfa, M. V., Alencar, V. C., Menegidio, F. B., Nunes, L. R., Machado, M. A., Takita, M. A., and de Souza, A. A. (2016) Draft

Genome Sequence of 11399, a Transformable Citrus-Pathogenic Strain of Xylella fastidiosa. Genome Announcements 4, e01124-16. (60) Santos, C. A., Toledo, M. A., Trivella, D. B., Beloti, L. L., Schneider, D. R., Saraiva, A. M., Crucello, A., Azzoni, A. R., Souza, A. A., Aparicio, R., and Souza, A. P. (2012) Functional and structural studies of the disulfide isomerase DsbC from the plant pathogen Xylella fastidiosa reveals a redoxdependent oligomeric modulation in vitro. FEBS J. 279, 3828−3843. (61) Tada, S. F., Saraiva, A. M., Lorite, G. S., RosselliMurai, L. K., Pelloso, A. C., dos Santos, M. L., Trivella, D. B., Cotta, M. A., de Souza, A. P., and Aparicio, R. (2012) Initial crystallographic studies of a small heatshock protein from Xylella fastidiosa. Acta Crystallogr., Sect. F: Struct. Biol. Cryst. Commun. 68, 535−559. (62) Mendes, J. S., Santiago, A. d. S., Toledo, M. A., Rosselli Murai, L. K., Favaro, M. T., Santos, C. A., Horta, M. A., Crucello, A., Beloti, L. L., Romero, F., Tasic, L., de Souza, A. A., and de Souza, A. P. (2015) VapD in Xylella fastidiosa Is a Thermostable Protein with Ribonuclease Activity. PLoS One 10, e0145765. (63) Warren, J. G., Lincoln, J. E., and Kirkpatrick, B. C. (2015) Insights into the Activity and Substrate Binding of Xylella fastidiosa Polygalacturonase by Modification of a Unique QMK Amino Acid Motif Using Protein Chimeras. PLoS One 10, e0142694. (64) Burbank, L. P., and Stenger, D. C. (2016) A TemperatureIndependent Cold Shock Protein Homolog Acts as a Virulence Factor in Xylella fastidiosa. Mol. Plant-Microbe Interact. 29, 335−44. (65) Matsumoto, A., Huston, S. L., Killiny, N., and Igo, M. M. (2012) XatA, an AT1 autotransporter important for the virulence of Xylella fastidiosa Temecula1. MicrobiologyOpen 1, 33−45. (66) Cruz, L. F., Parker, J. K., Cobine, P. A., and De La Fuente, L. (2014) Calcium-Enhanced Twitching Motility in Xylella fastidiosa Is Linked to a Single PilY1 Homolog, L. Appl. Environ. Microbiol. 80, 7176−7185. (67) Santiago, A. S., Santos, C. A., Mendes, J. S., Toledo, M. A., Beloti, L. L., Souza, A. A., and Souza, A. P. (2015) Characterization of the LysR-type transcriptional regulator YcjZ-like from Xylella fastidiosa overexpressed in Escherichia coli. Protein Expression Purif. 113, 72−78. (68) Santos, C. A., Janissen, R., Toledo, M. A., Beloti, L. L., Azzoni, A., Cotta, M., and Souza, A. P. (2015) Characterization of the TolB/ Pal transenvelope complex from Xylella fastidiosa reveals a dynamic and coordinated protein expression profile during the biofilm development process. Biochim. Biophys. Acta, Proteins Proteomics 1854, 1372−1381. (69) Gatzeva-Topalova, P. Z., May, A. P., and Sousa, M. C. (2004) Crystal structure of Escherichia coli ArnA (PmrI) decarboxylase domain. A key enzyme for lipid A modification with 4-amino-4deoxy-L-arabinose and polymyxin resistance. Biochemistry 43, 13370− 13379. (70) Williams, G. J., Breazeale, S. D., Raetz, C. R., and Naismith, J. H. (2005) Structure and function of both domains of ArnA, a dual function decarboxylase and a formyltransferase, involved in 4-amino-4deoxy-L-arabinose biosynthesis. J. Biol. Chem. 280, 23000−23008. (71) Aoyagi, K. L., Brooks, B. D., Bearden, S. W., Montenieri, J. A., Gage, K. L., and Fisher, M. A. (2015) LPS modification promotes maintenance of Yersinia pestis in fleas. Microbiology 161, 628−638. (72) Reiss, E., Huppert, M., and Cherniak, R. (1985) Characterization of protein and mannan polysaccharide antigens of yeasts, moulds, and actinomycetes. Curr. Top. Med. Mycol. 1, 172−207. (73) York, W. S., and O’Neill, M. A. (2008) Biochemical control of xylan biosynthesiswhich end is up? Curr. Opin. Plant Biol. 11, 258− 265. (74) Theocharis, A. D., Skandalis, S. S., Gialeli, C., and Karamanos, N. K. (2016) Extracellular matrix structure. Adv. Drug Delivery Rev. 97, 4−27. (75) Fletcher, C. M., Coyne, M. J., Bentley, D. L., Villa, O. F., and Comstock, L. E. (2007) Phase-variable expression of a family of glycoproteins imparts a dynamic surface to a symbiont in its human intestinal ecosystem. Proc. Natl. Acad. Sci. U. S. A. 104, 2413−2418. M


Article

Biochemistry (76) Posch, G., Pabst, M., Brecker, L., Altmann, F., Messner, P., and Schäffer, C. (2011) Characterization and scope of S-layer protein Oglycosylation in Tannerella forsythia. J. Biol. Chem. 286, 38714−38724. (77) Isogai, E., Isogai, H., Kurebayashi, Y., and Ito, N. (1986) Biological activities of leptospiral lipopolysaccharide. Zentralbl. Bakteriol., Mikrobiol. Hyg., Ser. A 261, 53−64. (78) Shimizu, T., Matsusaka, E., Nagakura, N., Takayanagi, K., Masuzawa, T., Iwamoto, Y., Morita, T., Mifuchi, I., and Yanagihara, Y. (1987) Chemical properties of lipopolysaccharide-like substance (LLS) extracted from Leptospira interrogans serovar canicola strain Moulton. Microbiol. Immunol. 31, 717−725. (79) Harper, A. D., and Bar-Peled, M. (2002) Biosynthesis of UDPxylose. Cloning and characterization of a novel Arabidopsis gene family, UXS, encoding soluble and putative membrane-bound UDPglucuronic acid decarboxylase isoforms. Plant Physiol. 130, 2188−2198. (80) Gnauck, A., Lentle, R. G., and Kruger, M. C. (2016) The characteristics and function of bacterial lipopolysaccharides and their endotoxic potential in humans. Int. Rev. Immunol. 35, 189−218. (81) Caroff, M., and Karibian, D. (2003) Structure of bacterial lipopolysaccharides. Carbohydr. Res. 338, 2431−2447. (82) Walker, S. L., Redman, J. A., and Elimelech, M. (2004) Role of cell surface lipopolysaccharides in Escherichia coli K12 adhesion and transport. Langmuir 20 (18), 7736−46. (83) Munford, R. S., and Varley, A. W. (2006) Shield as signal: lipopolysaccharides and the evolution of immunity to gram-negative bacteria. PLoS Pathog. 2, e67. (84) Raetz, C. R., Reynolds, C. M., Trent, M. S., and Bishop, R. E. (2007) Lipid A modification systems in gram-negative bacteria. Annu. Rev. Biochem. 76, 295−329. (85) Tran, A. X., and Whitfield, C. (2009) Lipopolysaccharides (Endotoxins). Encyclopedia of Microbiology, 3rd ed., pp 513−528, Academic Press, Oxford, U.K. (86) Trent, M. S., Stead, C. M., Tran, A. X., and Hankins, J. V. (2006) Diversity of endotoxin and its impact on pathogenesis. J. Endotoxin Res. 12, 205−223. (87) Desaki, Y., Miya, A., Venkatesh, B., Tsuyumu, S., Yamane, H., Kaku, H., Minami, E., and Shibuya, N. (2006) Bacterial lipopolysaccharides induce defense responses associated with programmed cell death in rice cells. Plant Cell Physiol. 47, 1530−1540. (88) Mohamed, K. H., Daniel, T., Aurélien, D., El-Maarouf-Bouteau, H., Rafik, E., Arbelet-Bonnin, D., Biligui, B., Florence, V., Mustapha, E. M., and François, B. (2015) Deciphering the dual effect of lipopolysaccharides from plant pathogenic Pectobacterium. Plant Signaling Behav. 10, e1000160. (89) Carlson, R. W., Forsberg, L. S., and Kannenberg, E. L. (2010) Lipopolysaccharides in Rhizobium-legume symbioses. Subcell. Biochem. 53, 339−386.

N


Functional and Evolutionary Characterization of a UDP-Xylose

Recommend Documents