Functional Characterization of Sirtuin-like Protein in Mycobacterium

Subscriber access provided by University of Sussex Library

Article

Functional Characterization of Sirtuinlike Protein in Mycobacterium smegmatis Lixiao Gu, Yuling Chen, Qing-tao Wang, Xiaojing Li, Kaixia Mi, and Haiteng Deng J. Proteome Res., Just Accepted Manuscript • DOI: 10.1021/acs.jproteome.5b00359 • Publication Date (Web): 16 Sep 2015 Downloaded from http://pubs.acs.org on September 17, 2015

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

Journal of Proteome Research is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 35

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Journal of Proteome Research

Functional Characterization of Sirtuin-like Protein in Mycobacterium smegmatis Lixiao Gu1, Yuling Chen1, Qingtao Wang2, Xiaojing Li3, Kaixia Mi3*, Haiteng Deng1* 1. MOE Key Laboratory of Bioinformatics, School of Life Sciences, Tsinghua University, Beijing, China 2. Beijing Chaoyang Hospital Affiliated to Capital Medical University, Beijing, China 3. CAS Key Laboratory of Pathogenic Microbiology and Immunology, Institute of Microbiology, CAS, Beijing 100101, China

* To whom correspondence should be addressed: Haiteng Deng, School of Life Sciences, Tsinghua University, Beijing, 100084 China, Tel: 8610-62790498; Fax: 8610-62797154; E_mail: [email protected] Kaixia Mi, Institute of Microbiology, CAS, Beijing, 100101, China Tel: 8610-64806082 Email: [email protected] Fax: 86-10-64807468

1 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ABSTRACT

Nicotinamide adenine dinucleotide (NAD)-dependent deacetylases (sirtuins) are well conserved from prokaryotes to eukaryotes. Functions and regulations of mammalian sirtuins have been extensively studied indicating that sirtuins play an important role in regulation of biological processes, whereas functions of mycobacterial sirtuins were less explored. In order to examine functions of the sirtuin-like protein in mycobacteria, a Mycobacterium smegmatis sirtuin, MSMEG_5175, was overexpressed in a M. smegmatis strain mc2155 to generate an MSMEG_5175-overexpression strain (mc2155-MS5175) in the present study. The physiological aspects of mc2155-MS5175 strain were characterized showing that they had a lower intracellular NAD level and a higher resistance to isoniazid (INH) as compared to mc2155 containing empty pMV261 plasmid (mc2155-pMV261). Quantitative proteomic analysis was carried out to determine differentially expressed proteins between mc2155-pMV261 and mc2155-MS5175. Among 3032 identified proteins, overexpression of MSMEG_5175 results in up-regulation of 34 proteins and down-regulation of 72 proteins, which involve in diverse cellular processes including metabolic activation, transcription and translation, antioxidant, and DNA repair. Down-regulation of catalase peroxidase (KatG) expression in both mRNA and protein levels were observed in mc2155-MS5175 strain, suggesting that a decrease in cellular NAD content and down-regulation of KatG expression contribute to the higher resistance to INH in mc21552 ACS Paragon Plus Environment

Page 2 of 35

Page 3 of 35

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


MS5175. Using a combination of immunoprecipitation and proteomic analysis, we found that acetylation in 27 proteins was decreased in mc2155-MS5175 as compared to those in mc2155pMV261, suggesting that these proteins including the beta prime subunit of RNA polymerase (rpoC), ribosomal proteins, and metabolic enzymes were substrates of MSMEG_5175. Acetylation changes in rpoC may affect its function and cause changes in global gene transcription. Taken together, these results suggest that MSMEG_5175 regulates diverse cellular processes resulting in an increase in INH resistance in mycobacteria, and provide a useful resource to further biological exploration into functions of protein acetylation in mycobacteria.

Keywords: NAD-dependent deacetylase; proteomics; antibiotic resistance; acetylation; glycolytic enzymes.

Introduction

Sirtuins are conserved from bacteria to humans and use NAD as a substrate to remove acetyl moiety from acetyllysine residues in proteins, resulting in generation of metabolite nicotinamide and 2-O-acetyl-ADP-ribose (1-3). In yeast, Sir2 plays an important role in transcriptional silencing, in suppressing rDNA recombination, and in controlling life span (4-6). In mammalians, sirtuin-catalyzed NAD-dependent deacetylation of chromatin and other



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

substrates plays an important role in regulation of a broad range of cellular functions (7-12). There are seven human sirtuins, sirt1-sirt7, in which sirt1, 2, 3, and 5 catalyze NAD-dependent deacetylation while sirt4 and sirt6 carry out ADP-ribosylation. Contrary to human sirtuins, the number of prokaryote sirtuins is smaller. In bacteria, CobB is the best characterized sirtuin and is present in many bacterial species (13-18). Like their mammal homologue Sirt3, CobB plays important roles in regulation of cellular metabolism. One of the best characterized substrates of CobB is acetyl coenzyme A synthetase (Acs) (19). Acetylation of Acs inhibits its activities while deacetylation of Acs by CobB reactivates it.

Mycobacterium tuberculosis (Mtb) is one of the most infectious bacteria and leads to a threat of human health. Mtb sirtuin Rv1151c was recently cloned and characterized (20), showing that Rv1151c possessed deacetylase activities and was capable of deacetylating Acs to re-activate its enzymatic activities (20-21). Due to the slow growth rate and highly infectious nature of Mtb, nonpathogenic M. smegmatis has been frequently used as the model system for studying tuberculosis (22). Studies showed that the sirtuin-like protein from M. smegmatis (MSMEG_5175) also deacetylated Acs to regulate the acetate metabolism in M. smegmatis (23). Furthermore, it was found that MSMEG_5175 participated in mycobacterial nonhomologous end-joining by forming complexes with Ku and a multifunctional DNA ligase (LigD) and


Page 4 of 35

Page 5 of 35

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


deletion of MSMEG_5175 reduced the efficiency of double strand break (DSB) repair and resistance to ionizing radiation in mutant M. smegmatis (24).

These results evidently indicated that sirtuins participate in multiple cellular processes in mycobacteria. It is important to identify additional substrates of mycobacterial sirtuins and to examine sirtuin-mediated cellular processes in mycobacteria. Herein, we established an MSMEG_5175 overexpressing strain and carried out a comprehensive analysis to investigate how MSMEG_5175 overexpression affects cellular NAD levels, protein expression, and cellular responses to antibiotic treatment, and more importantly, to identify its substrates.

Materials and Methods

Chemicals and Reagents

Middlebrook 7H9 Broth Base, isoniazid (INH), iodoacetamide were purchased from Sigma(St Louis, MO). Middlebrook 7H10 Agar was purchased from Qingdao Hope BioTechnology (Qingdao, China). Mass spectrometry grade acetonitrile was purchased from Thermo (Waltham, MA). Dithiothreitol was purchased from Merck (Whitehouse Station, NJ). Sequencing grade trypsin was purchased from Promega (Fitchburg, WI). Anti-acetyllysine antibody beaded agarose was purchased from PTM Biolabs (Hangzhou, China), which contains the rabbit-derived polyclonal and mouse-derived monoclonal anti-acetyllysine antibodies cross5 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

linked to agarose beads with stable amide linkages. NAD/NADH quantification assay kit was purchased from BioAssaySystems (Hayward, CA). The RNAprep pure Cell/Bacteria Kit was purchased from TIANGEN (Beijing, China). Bicinchoninic acid protein assay kit, Kanamycin, bovine serum albumin, and D-Dextrose were purchased from Solarbio (Beijing, China).

Bacterial strains and growth conditions

Escherichia coli DH5α was used for genetic manipulation and Mycobacterium smegmatis strain mc2155 was used for protein overexpression. E. coli DH5α was grown in LB medium, while liquid cultures of M. smegmatis strains were grown in Middlebrook 7H9 medium supplemented with 0.5% glycerol, 0.05% Tween 80, and 10% ADS (8.5 g/L sodium chloride, 50 g/L bovine serum albumin, and 20 g/L D-Dextrose). For determination of the number of colony forming unit (CFU) after INH treatment, Middlebrook 7H10 agar medium supplemented with 0.5% glycerol and 10% ADS was used. Kanamycin (25 mg/L for M. smegmatis, 50 mg/L for E.coli) was added to the medium as needed.

Construction of the MSMEG_5175 Overexpression Strain


Page 6 of 35

Page 7 of 35

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


The full-length sequence of msemg_5175 amplified from M. smegmatis mc2155 genomic DNA by polymerase chain reaction with the following primer pairs: MSm5175For 5’ CGCCGCCGGATCCTGTGCAAGTTACTGTGCTCAGCG

3’

and

MSm5175Rev

5’

CCCAAGCTTTCACTTATCGTCGTCATCCTTGTAATCGGCCGAGCGGTTGAGCA 3’. The underlined sequence encodes for the flag tag. The PCR product was cloned into pMV261, a nonintegrating, multi-copy plasmid. The FLAG-tag peptide was introduced into C-terminal of MSMEG_5175. The constructed clones were confirmed by DNA sequencing (BGI, Beijing, China). The constructed plasmids were electroporated into M. smegmatis mc2155 competent cells and incubated 3 days at 37 °C on 7H10 medium supplemented with 25 mg/L Kanamycin. The transformants were screened by PCR using the above primer pairs. The confirmed strain harboring with pMV261-5175 was designed as mc2155-MS5175. The empty pMV261 vector were also electroporated into mc2155, generating a strain of mc2155 harboring with pMV261 (denoted as mc2155-pMV261) and used as a negative control.

Bacterial Growth Curves

Recombinant strains mc2155-pMV261 and MSMEG_5175-overexpressing strain (mc2155-MS5175) were cultured in 7H9 medium containing0.5% glycerol, 0.05% Tween 80, and 10% ADS until A600 reached 0.8~1.0. Then the cultures were re-inoculated in fresh 7H9



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

medium (with or without 23.4 mg/L INH) at the ratio of 1:1000dilution. Cultures were incubated at 37℃ with shaking through the entire growth phase. Samples were collected at the same growth stage, and the A600 values were measured every 3 hours after growth initiation. Experiments were performed in triplicates, and the average values were used to generate growth curves.

Colony Forming Units determination

Four groups were set up: mc2155-pMV261, mc2155-pMV261 with 3 mg/L INH, mc2155MS5175, mc2155-MS5175 with 3 mg/L INH. As to the INH treatment groups, mc2155-pMV261 and mc2155-MS5175 were both cultured in 7H9 medium until A600 reached 0.2. Then INH was added into cultures at a final concentration of 3 mg/L and cultures were incubated with INH for 5 h. After the 1:10000 dilution, cultures were plated onto solid medium (Middlebrook 7H10 agar medium supplemented with 10% ADS). CFUs of all groups were counted after 48 hours growth at 37 ℃ . The survival rates were calculated by CFUmc2155-MS5175+INH/CFUmc2155-MS5175 and CFUmc2155-pMV261+INH/CFUmc2155-pMV261. The experiment was repeated three times.

NAD and NADH Concentration Assay

NAD and NADH concentrations were measured using a NAD+/NADH Assay Kit following the manufacturer’s instructions (http://www.bioassaysys.com/file_dir/E2ND.pdf). 8 ACS Paragon Plus Environment

Page 8 of 35

Page 9 of 35

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Briefly, 20ml cultures were collected when A600 reached 1.0 and then washed twice with cold phosphate buffer saline. The cells were centrifuged at 12000 rpm for 5 min at 4°C and the pellets were re-suspended in a 1.5 mL Eppendorf tube with 100µl NAD extraction buffer for NAD measurement. Then extracts were ultrasonicated for 5 min, and heated at 60°C for 5 min. Then 20µl assay buffer and 100µl opposite extraction buffer were added to neutralize the extracts. Extracts and NAD standards reacted with reaction reagent, and the absorbance at 565nm (A565) was measured to quantify NAD and NADH concentrations. The experiment was repeated three times.

Quantitative Real-Time PCR

The mc2155-pMV261 and mc2155-MS5175 strains were cultured in 7H9 medium and collected when A600 reached 1.0. Total RNA was extracted using RNAprep pure Cell / Bacteria Kit. cDNA was synthesized from 3 µg total RNA with the Reverse transcription kit. Quantitative real-time PCR was performed with the Roche LightCycler 480Ⅱ Detection System using SYBR green SuperRealPremixs. RNA polymerase sigma factor rpoD was used as an internal control. Relative expression levels for each reference gene were calculated. The relative expression ratio of a target gene was calculated based on the threshold cycle (Ct) deviation of mc2155-MS5175



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 10 of 35

versus mc2155-pMV261:Ratio=(2-ΔCt mc2155-MS5175) / (2-ΔCt mc2155-pMV261)(ΔCt = Ct target- Ct control;). The primers are listed in Supplementary Table 1.

Proteome and Acetylome Analysis

Proteomic analysis was carried out on three biological replicates. Briefly, the mc2155pMV261 and mc2155-MS5175 cultures were collected, lysed on ice with 8 mol/L urea, and ultrasonicated for 20 minutes. Lysate was centrifuged at 12000rpm for 30 minutes at 4℃. Then supernatants were collected for following experiments. Bicinchoninic acid protein assay kit was used to measure protein concentrations. For proteomic analysis, 100 µg proteins from mc2155pMV261 or mc2155-MS5175 cultures were reduced with 10mM dithiothreitol and alkylated with 20mM iodoacetamide. The concentration of urea was adjusted to 1M with phosphate buffered saline. In solution digestion was then carried out with sequencing grade trypsin at 37℃ overnight. Then desalting was conducted with a 1 ml Oasis®HLB extraction cartridge (Waters corporation, MA). Eluted peptides were then centrifuged in a speedvac until dry. Peptides were suspended with 100µl of 200mM triethyl ammonium bicarbonate. Then TMT Label Reagent was added into the solution and the reaction was incubated for 1 hour at room temperature. Peptides from mc2155-pMV261 strain were labeled by TMT6-128 and peptides from mc2155-MS5175 cultures were labeled by TMT6-130. Then 5% hydroxylamine was added into the reaction and incubated


Page 11 of 35

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


for 15 min to quench the reaction. The two samples were mixed and fractionated by reverse phase (RP) chromatography. The fractionation was performed on an Ultimate 3000 System (Thermo) by using a Xbridge C18 RP column (5µm,150 Å, 250 mm × 4.6 mm i.d., (Waters, MA)). Mobile phases A (2% acetonitrile, adjusted pH to 10.0 using ammonia) and B (98% acetonitrile, adjusted pH to 10.0 using ammonia) were used to develop a gradient. The solvent gradient was set as follows: 5%-8% B, 5 min; 8%-18% B, 25 min; 18%-32% B, 32 min; 32%-95% B, 2 min; 95% B, 6 min; 95%-5% B,5 min. The peptides were monitored at 214 nm and collected every minute. The fractions were pooled, dried and reconstituted in 20 µL of 0.1% (v/v) formic acid in water and were subjected to nano-LC-MS/MS analysis. For acetylome analysis, equal amount of proteins were reduced with dithiothreitol at a final concentration of 1 mM, and alkylated with iodoacetamide at a final concentration of 5.5 mM. Then five-fold dilution was conducted with 25 mM Tris-HCl (pH=8.2). Proteins were digested by trypsin at 37℃ for 16 hours. After in solution digestion, trifluoroacetic acid was used to adjust the solution pH to 2. Then desalting was conducted with a 3 ml Oasis®HLB extraction cartridge (Waters, MA). Peptides eluted from the cartridge were dried in a speedvac and then suspended with 1 ml PBS. Anti-acetyllysine antibody beaded agarose was added into the solution and incubated overnight at 4℃with a rotator. Then beads were collected by centrifugation at 5000g for 30s and washed



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 12 of 35

twice with phosphate buffer saline. Ammonium acetate buffer (pH=3.4) was used for acetylpeptides elution. Then acetyl-peptides were dried and re-dissolved with 0.1% formic acid.

LC-MS/MS analysis

For LC-MS/MS analysis, the extracts were separated by a 120 min gradient elution at a flow rate 0.250 µl/min with a nano-HPLC system (Proxeon, Denmark) which was directly interfaced with a mass spectrometer. A Thermo Q Exactive mass spectrometer was used for proteome analysis and a Thermo LTQ-Orbitrap mass spectrometer was used for acetylome analysis. The analytical column was a fused silica capillary column(75µm ID, 150 mm length; Upchurch, Oak Harbor, WA) packed with C-18 resin (300 Å, 5 µm, Varian, Lexington, MA). Mobile phase A consisted of 0.1% formic acid, and mobile phase B consisted of 100% acetonitrile and 0.1% formic acid. The Q Exactive mass spectrometer was operated in the datadependent acquisition mode using Xcalibur 2.0.7 software and there was a single full-scan mass spectrum in the Orbitrap (400−1800 m/z, 75000 resolution) followed by 10 data-dependent MS/MS scans in the ion trap at 30% normalized collision energy (HCD). And the LTQ-orbitrap mass spectrometer was operated in the data-dependent acquisition mode using Xcalibur 2.0.7 software and there was a single full-scan mass spectrum in the Orbitrap (400−1800 m/z, 75000 resolution) followed by 20 data-dependent MS/MS scans in the ion trap at 35% normalized


Page 13 of 35

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


collision energy (CID). The mass window for precursor ion selection was set to 3.0 Da for Q Exactive mass spectrometer, and 2.0 Da for LTQ-orbitrap Velos mass spectrometer. Dynamic exclusion duration was for 15s for Q Exactive mass spectrometer and 30s for LTQ-orbitrap Velos mass spectrometer. Resolution for HCD spectra was set at 17,500 for Q Exactive MS.

The MS/MS spectra from each LC-MS/MS run were searched against the M. smegmatis fasta database downloaded from Uniprot (release date of December 24, 2014; 6647 entries) using an in-house Sequest HT Algorithm in Proteome Discoverer software (version 1.4). Common contaminants were included in the database. The search criteria were the followings: full tryptic specificity was required; one missed cleavage was allowed; carbamidomethylation (C) and TMT sixplex (K and N-terminal) were set as the fixed modifications; the oxidation (M) was set as the variable modification; precursor ion mass tolerances were set at 10 ppm for all MS acquired in an orbitrap mass analyzer; and the fragment ion mass tolerance was set at 20 mmu for all MS2 spectra acquired in Q Exactive mass spectrometer. Peptide spectral matches (PSM) were validated using the Percolator provided by Proteome Discoverer software based on q-values at a 1% false discovery rate (FDR). A peptide whose sequence is only assigned to a given protein group was considered as unique. The false discovery rate was also set to 0.01 for protein identifications. Relative protein quantification was performed using Proteome Discoverer software (Version 1.4) according to manufacturer’s instructions on the reporter ion intensities per 13 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 14 of 35

peptide. Proteins with at least two unique peptides were regarded as confident identifications and were further quantified. Protein ratios were calculated as the median of all peptide hits belonging to a protein. Quantitative precision was expressed as protein ratio variability. Multiple testing with the Benjamini-Hochberg correction was used to adjust the p values (25). The mass spectrometry proteomics data have been deposited to the ProteomeXchange Consortium via the PRIDE partner repository with the data set identifier PXD002102.

Statistical Method

Statistical analysis was carried out with GraphPad Prism 5.0 software on data related to cell growth and colony formation. Significant differences in the data were determined by Student’s t test. P values of 1.3 or 10), 113 proteins were found to be differentially expressed between mc2155-pMV261 and mc2155-MS5175, in which 72 proteins were down-regulated and 34 were up-regulated (Supplementary Table 2 and 3). In order to understand the biological relevance of the identified proteins, GO analysis was used to cluster the differentially expressed proteins according to their molecular functions and biological processes. The annotations of gene lists are summarized via a pie plot based on the functional classification from Uniprot as shown in Figure 4. One hundred and thirteen proteins participated in a variety of cellular processes including energy and carbohydrate metabolism, RNA processing, protein synthesis, DNA repair, chaperoning, and oxidation-reduction process. Among the up-regulated proteins, 32% of them are associated with metabolic processes, and 15% with oxidation-reduction processes, indicating overexpression of MSMEG_5175 has significant impact on cellular metabolism and oxidation-reduction processes. 17 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 18 of 35

On the other hand, 17% of down-regulated proteins are transporter associated proteins. KatG2 plays an important role in INH resistance. Quantitative proteomics showed that KatG2 was down-regulated in mc2155-MS5175 (Figure 5(a) and (Supplementary Table 3)) and its mRNA level was also down-regulated by qPCR analysis (Figure 5(b)).

Identification of MSMEG_5175 mediated changes in protein acetylation

Furthermore, we compared the difference in protein acetylation between mc2155MS5175 and mc2155-pMV261. The acetylated peptides from mc2155-MS5175 and mc2155pMV261 were enriched by anti-acetyllysine antibodies, followed by nano-LC-MS/MS analysis. The resulting MS/MS spectra were searched against M. smegmatis protein database with Proteome Discoverer (v1.4), in which an overall false discovery rate for peptides identification was set as less than 1%. We identified 65 acetylated peptides from 57 proteins in mc2155pMV261, and 54 acetylated peptides from 46 proteins in mc2155-MS5175. Figure 6(a) shows a MS/MS spectrum of a peptide ion that matches to fragments of an acetylated peptide SGEEIVLk(Ac)PEVK from isocitrate dehydrogenase (IDH) and the insert displays the intensities of this peptide ion from mc2155-MS5175 (dotted line) and mc2155-pMV261 (solid line), showing that the intensity of the acetylated peptides decreases in mc2155-MS5175 strain. On the other hand, overexpression of MSMEG_5175 does not change the expression level of


Page 19 of 35

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


IDH as shown in Figure 6(b), in which a MS/MS spectrum of a tryptic peptide THVATMK from IDH is displayed and the inserted figure shows that intensities of the TMT-reporter ions from two strains are equal. These results suggest that overexpression of MSMEG_5175 does not change the expression level of IDH, but it causes deacetylation of IDH. Similar results were observed for rpoC and superoxide dismutase (Supplementary Figure 1). In the present work, we identified 30 acetylated peptides from 27 proteins that were only present or had the higher intensities in mc2155-pMV261 than those in mc2155-MS5175 (Table 1), which were potential substrates of MSMEG_5175. Gene Ontology analysis was used to cluster the changed acetylated proteins between mc2155-MS5175 and mc2155-pMV261 (Figure 6(c)), showing that acetylation in metabolic proteins was the major target of MSMEG_5175. Further analysis showed that these proteins were mainly associated with metabolisms of lipids and carbohydrates.

Discussion

Mammalian sirtuins play important roles in many biological processes from development to diseases. Only two distinct protein deacetylases have been identified in prokaryotes, including CobB in S. enterica and AcuC in Bacillus subtilis (13, 26). In M. smegmatis, MSMEG_4620 and MSMEG_5175 were identified as sirtuin-like proteins, in which only MSMEG_5175 has a strong deacetylase activity and plays an role in metabolism and DNA repair (22-24). Purposes of



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 20 of 35

the present study were to further characterize functions of mycobacterial MSMEG_5175 by comparing the proteome profile between MSMEG_5175-overexpressing strain and empty vector transformed mc2155 and to identify substrates of MSMEG_5175. The expression level of MSMEG_5175 in mc2155-MS5175 was 3 times higher than that in mc2155-pMV261 by quantitative mass spectrometry (Figure 1). Overexpression of MSMEG_5175 in mc2155 led to several physiological changes including a decrease in cellular NAD level, and acquiring the higher resistance to INH (Figure 2 and 3) in mc2155-MS5175. The cellular NAD level was decreased by 20% in mc2155-MS5175 while its NADH level was similar to that in mc2155-pMV261 (Figure 2). Ratios of NAD/NADH were calculated to be 11 and 14 for mc2155-MS5175 and mc2155-pMV261 strains, respectively. The ratio of NAD/NADH represents the cellular reduction potential and reflects the metabolic activities of cells (27-28). For example, the NAD/NADH ratio controls the activity of several key enzymes, including glyceraldehyde 3-phosphate dehydrogenase and pyruvate dehydrogenase (28). These results suggest that MSMEG_5175 plays a role in regulation of cellular NAD level and redox stasis. .

Additionally, it is known that the ratio of NAD/NADH affects the bacterial resistance to INH (29). Indeed, our results showed that mc2155-MS5175 acquired the higher resistance to INH than mc2155-pMV261 strain as determined by bacterial growth rates and survival rates in the presence of 3 mg/L INH (Figure 3). INH is the first-line medication in prevention and treatment 20 ACS Paragon Plus Environment

Page 21 of 35

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


of tuberculosis (30). As a prodrug, INH needs to be activated by KatG to execute its antibiotic function. KatG is a bifunctional enzyme with both catalase and peroxidase activity and catalyzes the coupling of INH with NAD+ to form the isonicotinic acyl-NAD complex, which binds to the enoyl-acyl carrier protein reductase to inhibit the synthesis of mycolic acid required for the mycobacterial cell wall. Previous study suggested that down-regualtion of KatG led to INH resistance (31). In the present study, quantitative proteomic analysis showed that the expression level of KatG was down-regulated in mc2155-MS5175 as compared to mc2155-pMV261 (Supplementary Table 3 and Figure 5). We propose that down-regulation of KatG expression as well as a decrease in cellular NAD level results in the higher resistance to INH in mc2155MS5175.

Acetylome analysis showed that acetylation in 27 proteins was decreased in MSMEG_5175-overexpression strain which included ribosomal proteins, metabolic proteins, and transcriptional regulators. Acetylation and deacetylation of ribosomal proteins have been reported before (32-33). The present study showed that overexpression of MSMEG_5175 decreased acetylation in 6 ribosomal proteins, suggesting MSMEG_5175 mediated protein synthesis in mycobacteria. Out of 27 proteins, 8 proteins are metabolic enzymes involved in the carbohydrate and lipid metabolism, indicating that MSMEG_5175 plays a crucial role in cellular metabolism in consistent with earlier reports (19, 23). Acetylation of the beta prime subunit of 21 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 22 of 35

RNA polymerase (rpoC) was also decreased in MSMEG5175-overexpressing strain (Supplementary Figure 1), indicating that rpoC is a substrate of MSMEG5175. Studies identified that rpoC was a DNA-dependent RNA polymerase catalyzing the transcription of DNA into RNA, and played a role in rifampin resistance (34). The acetylation site is on Lys43 residue and may affect its binding to DNA. Although the molecular events leading to differential expressions of 113 proteins in MSMEG_5175-overexpressiong strain are still not clear, it is expected that rpoC may regulate global gene transcription in mycobacteria. Further studies to explore acetylation of rpoC in regulation of gene transcription are under the way.

Conclusions

Taken together, we show that overexpression of MSMEG_5175 in mc2155 strain decreases the cellular NAD level and alters the protein expression patterns. Down-regulations of KatG proteins and a decrease of NAD level in MSMEG_5175 overexpressing strain contribute to the high resistance to INH. On the other hand, 27 proteins were identified as the potential substrates of MSMEG_5175. Deacetylation of proteins such as rpoC may change its activities in transcription regulation and alter expressions of multiple genes. Results presented herein are useful resources to further our understanding of the multifactorial mechanisms of NAD-regulated cellular processes.


Page 23 of 35

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Supporting Information Available: This material is available free of charge via the Internet at http://pubs.acs.org

Supplementary Figure 1. The MS/MS spectra of acetylated peptides from rpoC and superoxide dismutase.

Supplementary Table 1. Primers used for PCR and RT-PCR analysis in this work. Supplementary Table 2. Up-regulated proteins in mc2155-MS5175 as compared to mc2155pMV261.

Supplementary Table 3. Down-regulated proteins in mc2155-MS5175 as compared to mc2155pMV261.

Acknowledgments

We thank the Protein Chemistry Facility at the Center for Biomedical Analysis of Tsinghua University for sample analysis. We thank W. R Jacobs (Albert Einstein College of Medicine) for the strain Mycobacterium smegmatis mc2155. This work was supported by NSFC 31270871 (H.T.D), MOEC 2012Z02293 (H.T.D) and NSFC 31270178 (K.M). We thank the support from the Global Science Alliance Program of Thermo-Fisher Scientific.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Disclosure Statement

The authors declare no conflict of interest.

References 1.

Blander, G.; Guarente, L. The Sir2 family of protein deacetylases. Annu Rev Biochem 2004, 73, 417-35.

2.

Moazed, D. Enzymatic activities of Sir2 and chromatin silencing. Curr Opin Cell Biol 2001, 13 (2), 232-8.

3.

Sauve, A. A.; Celic, I.; Avalos, J.; Deng, H.; Boeke, J. D.; Schramm, V. L. Chemistry of gene silencing: the

mechanism of NAD+-dependent deacetylation reactions. Biochemistry 2001, 40 (51), 15456-63. 4.

Bryk, M.; Banerjee, M.; Murphy, M.; Knudsen, K. E.; Garfinkel, D. J.; Curcio, M. J. Transcriptional silencing

of Ty1 elements in the RDN1 locus of yeast. Genes Dev 1997, 11 (2), 255-69. 5.

Gottlieb, S.; Esposito, R. E. A new role for a yeast transcriptional silencer gene, SIR2, in regulation of

recombination in ribosomal DNA. Cell 1989, 56 (5), 771-6. 6.

Kaeberlein, M.; McVey, M.; Guarente, L. The SIR2/3/4 complex and SIR2 alone promote longevity in

Saccharomyces cerevisiae by two different mechanisms. Genes Dev 1999, 13 (19), 2570-80. 7.

Qin, W.; Yang, T.; Ho, L.; Zhao, Z.; Wang, J.; Chen, L.; Zhao, W.; Thiyagarajan, M.; MacGrogan, D.; Rodgers, J.

T.; Puigserver, P.; Sadoshima, J.; Deng, H.; Pedrini, S.; Gandy, S.; Sauve, A. A.; Pasinetti, G. M. Neuronal SIRT1 activation as a novel mechanism underlying the prevention of Alzheimer disease amyloid neuropathology by calorie restriction. J Biol Chem 2006, 281 (31), 21745-54. 8.

Uhl, M.; Csernok, A.; Aydin, S.; Kreienberg, R.; Wiesmuller, L.; Gatz, S. A. Role of SIRT1 in homologous

recombination. DNA Repair (Amst) 2010, 9 (4), 383-93. 9.

Kim, H. S.; Vassilopoulos, A.; Wang, R. H.; Lahusen, T.; Xiao, Z.; Xu, X.; Li, C.; Veenstra, T. D.; Li, B.; Yu, H.; Ji,

J.; Wang, X. W.; Park, S. H.; Cha, Y. I.; Gius, D.; Deng, C. X. SIRT2 maintains genome integrity and suppresses tumorigenesis through regulating APC/C activity. Cancer Cell 2011, 20 (4), 487-99. 10.

Leiser, S. F.; Kaeberlein, M. A role for SIRT1 in the hypoxic response. Mol Cell 2010, 38 (6), 779-80.

11.

Yang, H.; Yang, T.; Baur, J. A.; Perez, E.; Matsui, T.; Carmona, J. J.; Lamming, D. W.; Souza-Pinto, N. C.; Bohr,

V. A.; Rosenzweig, A.; de Cabo, R.; Sauve, A. A.; Sinclair, D. A. Nutrient-sensitive mitochondrial NAD+ levels dictate cell survival. Cell 2007, 130 (6), 1095-107. 12.

Chang, H. C.; Guarente, L. SIRT1 mediates central circadian control in the SCN by a mechanism that decays

with aging. Cell 2013, 153 (7), 1448-60. 13.

Starai, V. J.; Celic, I.; Cole, R. N.; Boeke, J. D.; Escalante-Semerena, J. C. Sir2-dependent activation of acetyl-

CoA synthetase by deacetylation of active lysine. Science 2002, 298 (5602), 2390-2. 14.

Starai, V. J.; Takahashi, H.; Boeke, J. D.; Escalante-Semerena, J. C. Short-chain fatty acid activation by acyl-


Page 24 of 35

Page 25 of 35

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


coenzyme A synthetases requires SIR2 protein function in Salmonella enterica and Saccharomyces cerevisiae. Genetics 2003, 163 (2), 545-55. 15.

Zhao, K.; Chai, X.; Marmorstein, R. Structure and substrate binding properties of cobB, a Sir2 homolog

protein deacetylase from Escherichia coli. J Mol Biol 2004, 337 (3), 731-41. 16.

Gardner, J. G.; Escalante-Semerena, J. C. In Bacillus subtilis, the sirtuin protein deacetylase, encoded by the

srtN gene (formerly yhdZ), and functions encoded by the acuABC genes control the activity of acetyl coenzyme A synthetase. J Bacteriol 2009, 191 (6), 1749-55. 17.

Mikulik, K.; Felsberg, J.; Kudrnacova, E.; Bezouskova, S.; Setinova, D.; Stodulkova, E.; Zidkova, J.; Zidek, V.

CobB1 deacetylase activity in Streptomyces coelicolor. Biochem Cell Biol 2012, 90 (2), 179-87. 18.

Tucker, A. C.; Escalante-Semerena, J. C. Biologically active isoforms of CobB sirtuin deacetylase in

Salmonella enterica and Erwinia amylovora. J Bacteriol 2010, 192 (23), 6200-8. 19.

Starai, V. J.; Takahashi, H.; Boeke, J. D.; Escalante-Semerena, J. C. A link between transcription and

intermediary metabolism: a role for Sir2 in the control of acetyl-coenzyme A synthetase. Curr Opin Microbiol 2004, 7 (2), 115-9. 20.

Gu, J.; Deng, J. Y.; Li, R.; Wei, H.; Zhang, Z.; Zhou, Y.; Zhang, Y.; Zhang, X. E. Cloning and characterization of

NAD-dependent protein deacetylase (Rv1151c) from Mycobacterium tuberculosis. Biochemistry (Mosc) 2009, 74 (7), 743-8. 21.

Xu, H.; Hegde, S. S.; Blanchard, J. S. The reversible acetylation and inactivation of Mycobacterium

tuberculosis acetyl-CoA synthetase is dependent on cAMP. Biochemistry 2011, 50 (26), 5883-92. 22.

Tyagi, J. S.; Sharma, D. Mycobacterium smegmatis and tuberculosis. TRENDS in Microbiology 2002, 10 (2),

68-69. 23.

Hayden, J. D.; Brown, L. R.; Gunawardena, H. P.; Perkowski, E. F.; Chen, X.; Braunstein, M. Reversible

acetylation regulates acetate and propionate metabolism in Mycobacterium smegmatis. Microbiology 2013, 159 (Pt 9), 1986-99. 24.

Li, Z.; Wen, J.; Lin, Y.; Wang, S.; Xue, P.; Zhang, Z.; Zhou, Y.; Wang, X.; Sui, L.; Bi, L. J.; Zhang, X. E. A Sir2-like

protein participates in mycobacterial NHEJ. PLoS One 2011, 6 (5), e20045. 25.

Benjamini, Y;; Hochberg, Y. Controlling the false discovery rate: a practical and powerful approach to

multiple testing. Journal of the Royal Statistical Society, Series B 1995, 57(1), 289–300. 26.

Gardner, J. G.; Grundy, F. J.; Henkin, T. M.; Escalante-Semerena, J. C. Control of acetyl-coenzyme A

synthetase (AcsA) activity by acetylation/deacetylation without NAD(+) involvement in Bacillus subtilis. J Bacteriol 2006, 188 (15), 5460-8. 27.

Sun, F.; Dai, C.; Xie, J.; Hu, X. Biochemical issues in estimation of cytosolic free NAD/NADH ratio. PLoS One

2012, 7 (5), e34525. 28.

Lin, S. J.; Guarente, L. Nicotinamide adenine dinucleotide, a metabolic regulator of transcription, longevity

and disease. Curr Opin Cell Biol 2003, 15 (2), 241-6. 29.

Vilcheze, C.; Weisbrod, T. R.; Chen, B.; Kremer, L.; Hazbon, M. H.; Wang, F.; Alland, D.; Sacchettini, J. C.;



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 26 of 35

Jacobs, W. R., Jr. Altered NADH/NAD+ ratio mediates coresistance to isoniazid and ethionamide in mycobacteria. Antimicrob Agents Chemother 2005, 49 (2), 708-20. 30.

Timmins, G. S.; Deretic, V. Mechanisms of action of isoniazid. Mol Microbiol 2006, 62 (5), 1220-7.

31.

Ando, H,; Kitao, T,; Miyoshi-Akiyama, T,; Kato, S,; Mori, T,; Kirikae, T. Downregulation of katG expression is

associated with isoniazid resistance in Mycobacterium tuberculosis. Mol Microbiol. 2011, 79(6), 1615-28. 32.

Nesterchuk, M. V.; Sergiev, P. V.; Dontsova, O. A. Posttranslational Modifications of Ribosomal Proteins in

Escherichia coli. Acta Naturae 2011, 3 (2), 22-33. 33.

Liew, C. C.; Yip, C. C. Acetylation of reticulocyte ribosomal proteins at time of protein biosynthesis. Proc

Natl Acad Sci USA 1974, 71 (8), 2988-91. 34. Vos, M. de.; Müller, B.; Borrell, S.; Black, P. A.; van Helden, P. D.; Warren, R. M.; Gagneux, S.; Victor, T. C. Putative Compensatory Mutations in the rpoC Gene of Rifampin-Resistant Mycobacterium tuberculosis Are Associated with Ongoing Transmission. Antimicrobial Agents and Chemotherapy 2013, 57(2), 827–832.

Figure Legends: Figure 1. Overexpression of MSMEG_5175 in mc2155. (a) Semi-quantitative RT-PCR analysis of mRNA levels of MSMEG_5175 in mc2155-pMV261 and mc2155-MS5175. RNA polymerase sigma factor (rpoD) was used as a loading control; (b) The gray scale analysis of the mRNA ratio of MSMEG_5175 between mc2155-MS5175 and mc2155-pMV261. (c) The MS/MS spectrum of the TMT-labeled peptide TVAAWEDHLDVR from the protein MSMEG_5175. The insert displays the low mass range of the MS/MS spectrum showing intensities of the reporter ions of TMT-labeled peptides from mc2155-pMV-261 (m/z 128) and mc2155-MS5175 (m/z 130).

Figure 2. Comparison of NAD and NADH levels and NAD / NADH ratios in mc2155-pMV261 and mc2155-MS5175. (a) Graphical representation of mean values and standard deviation of NAD and NADH levels in mc2155-pMV261 and mc2155-MS5175; and (b) the ratio of NAD/NADH. **p< 0.001 26 ACS Paragon Plus Environment

Page 27 of 35

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 3. Growth curves and survival rates of bacteria. (a) Growth curves of mc2155-pMV261 and mc2155-MS5175 with or without INH. (b) Survival rates of mc2155-pMV261 and mc2155MS5175 treated with INH (3 mg/L) for 5 hours. **p< 0.01

Figure 4. Functional classification of differentially expressed proteins between mc2155-pMV261 and mc2155-MS5175. (a) Up-regulated proteins in mc2155-MS5175. (b) Down-regulated proteins in mc2155-MS5175.

Figure 5. Confirmation of differentially expression of katG2 in mc2155-pMV261 and mc2155MS5175 by quantitative proteomics and qPCR analysis of mRNA expression. (a) the MS/MS spectrum of a tryptic peptide from katG2 and the insert shows the low mass range of the MS/MS spectrum with the intensities of the reporter ions of TMT- (b) mRNA levels of katG2. **p< 0.01

Figure 6. Quantitation of acetylated peptides of IDH. (a) The MS/MS spectrum of the acetylpeptide SGEEIVLk(Ac)PEVK from IDH. The insert shows the ion intensity of the same peptide from mc2155-pMV261 (solid line) and mc2155-MS5175 (dotted line). (b) The MS/MS spectrum of the TMT-labeled peptide tHVATMK from IDH. The insert shows intensities of the reported ions at m/z 128 (mc2155-pMV261) and m/z 130 (mc2155-MS5175); (c) Functional classification of proteins with decrease of acetylation in mc2155-MS5175 as compared to mc2155-pMV261.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 28 of 35

Table 1. Potential substrates of MSMEG_5175 in M. smegmatis

Accession

Protein Description

acetyl-peptide

A0QR00

2,3-bisphosphoglycerate-dependent phosphoglycerate mutase 30S ribosomal protein S4 30S ribosomal protein S7 3-ketoacyl-CoA thiolase 50S ribosomal protein L7/L12

GSk(Ac)YSQDADPR

A0QSL7 A0QS97 A0QPE8 A0QS63 A0R6Q9 A0QQU5 A0QSS4 A0R2Z9 A0R067 A0R574 A0QQC8 A0R417 A0QS66 A0QVB9 A0QS98 A0QR89 A0QWW2

5-methyltetrahydropteroyltriglutamate-homocysteine methyltransferase 60 kDa chaperonin 1 60 kDa chaperonin 2 Acyl-CoA synthase Aminomethyltransferase ATP-dependent Clp protease ATPbinding subunit ClpC1 Chaperone protein DnaK Citrate synthase DNA-directed RNA polymerase subunit beta' Elongation factor Ts Elongation factor Tu

A0R4K9 A0R597 A0QSZ3 A0R1Y8

Geranylgeranyl reductase Glyceraldehyde-3-phosphate dehydrogenase HIT family protein Inorganic pyrophosphatase Isocitrate dehydrogenase (NADP) Icd2 Methylmalonyl CoA epimerase

O85501

Nucleoside diphphate kinase

A0R6Q7 A0QWX9 A0QW71

Superoxide dismutase Transaldolase Transcriptional accessory protein Uncharacterized oxidoreductase MSMEG_1603/MSMEI_1564

A0QSU4

mc2155pMV261/mc2155MS5175 #

Ik(Ac)ESEYR TGTDPVVTLk(Ac)R ADSSVEk(Ac)LAK DLVDSAPk(Ac)PLLEK IGVIk(Ac)VVR AVEk(Ac)YWAGNLDR

# # # 1.4 # 1.8

AGAATEVELk(Ac)ER VGAATETDLk(Ac)K TSVGk(Ac)YDKK AVEcEVVk(Ac)PPFVTPSTR VLk(Ac)EINTR

1.5 1.4 # 1.6 #

GSSGIDLTk(Ac)DK IQEGSGLSk(Ac)EEIDR VYk(Ac)NYDPR TLKPEk(Ac)DGLFCEK

# 1.2 # #

ANDIETLk(Ac)AAK ALEGDPk(Ac)WVK VLHDk(Ac)FPDLNESR VVVLDk(Ac)AEFPR AIGLVLPELk(Ac)GK

# 1.7 1.6 1.4 #

AVCk(Ac)AFDTER Nk(Ac)YEVDHETGR SGEEIVLk(Ac)PEVK LLYDAPk(Ac)R QIAGGTDPVEk(Ac)AVPGTI R GVNDAIAk(Ac)LEEAR VLEDEGVEk(Ac)FEK SPAAQk(Ac)FR AGYcDLk(Ac)EFQK

# # 1.7 1.4


1.4 1.3 1.5 # 2.0

Page 29 of 35

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


# presented that acetyl-peptides were only found in mc2155-pMV261.

Graphic Abstract



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 30 of 35

Figure 1. Overexpression of MSMEG_5175 in mc2155. (a) Semi-quantitative RT-PCR analysis of mRNA levels of MSMEG_5175 in mc2155-pMV261 and mc2155-MS5175. RNA polymerase sigma factor (rpoD) was used as a loading control; (b) The gray scale analysis of the mRNA ratio of MSMEG_5175 between mc2155-MS5175 and mc2155-pMV261. (c) The MS/MS spectrum of the TMT-labeled peptide TVAAWEDHLDVR from the protein MSMEG_5175. The insert displays the low mass range of the MS/MS spectrum showing intensities of the reporter ions of TMT-labeled peptides from mc2155-pMV261 (m/z 128) and mc2155-MS5175 (m/z 130). 1367x671mm (96 x 96 DPI)

ACS Paragon Plus Environment

Page 31 of 35

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 2. Comparison of NAD and NADH levels and NAD / NADH ratios in mc2155-pMV261 and mc2155MS5175. (a) Graphical representation of mean values and standard deviation of NAD and NADH levels in mc2155-pMV261 and mc2155-MS5175; and (b) the ratio of NAD/NADH. **p< 0.001 1496x927mm (96 x 96 DPI)



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Figure 3. Growth curves and survival rates of bacteria. (a) Growth curves of mc2155-pMV261 and mc2155MS5175 with or without INH. (b) Survival rates of mc2155-pMV261 and mc2155-MS5175 treated with INH (3 mg/L) for 5 hours. **p< 0.01 2004x863mm (96 x 96 DPI)


Page 32 of 35

Page 33 of 35

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 4. Functional classification of differentially expressed proteins between mc2155-pMV261 and mc2155MS5175. (a) Up-regulated proteins in mc2155-MS5175. (b) Down-regulated proteins in mc2155-MS5175. 855x1010mm (96 x 96 DPI)



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Figure 5. Confirmation of differentially expression of katG2 in mc2155-pMV261 and mc2155-MS5175 by quantitative proteomics and qPCR analysis of mRNA expression. (a) the MS/MS spectrum of a tryptic peptide from katG2 and the insert shows the low mass range of the MS/MS spectrum with the intensities of the reporter ions of TMT- (b) mRNA levels of katG2. **p< 0.01 1814x868mm (96 x 96 DPI)


Page 34 of 35

Page 35 of 35

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 6. Quantitation of acetylated peptides of IDH. (a) The MS/MS spectrum of the acetyl-peptide SGEEIVLk(Ac)PEVK from IDH. The insert shows the ion intensity of the same peptide from mc2155-pMV261 (solid line) and mc2155-MS5175 (dotted line). (b) The MS/MS spectrum of the TMT-labeled peptide rHVATMK from IDH. The insert shows intensities of the reported ions at m/z 128 (mc2155-pMV261) and m/z 130 (mc2155-MS5175); (c) Functional classification of proteins with decrease of acetylation in mc2155MS5175 as compared to mc2155-pMV261. 1035x1666mm (96 x 96 DPI)


Functional Characterization of Sirtuin-like Protein in Mycobacterium

Recommend Documents