Functionally Distinct Bacterial Cytochrome c Peroxidases Proceed

Subscriber access provided by UNIV OF NEBRASKA - LINCOLN

Article

Functionally distinct bacterial cytochrome c peroxidases proceed through a common (electro)catalytic intermediate Katherine E. Frato, Kelly A. Walsh, and Sean J. Elliott Biochemistry, Just Accepted Manuscript • DOI: 10.1021/acs.biochem.5b01162 • Publication Date (Web): 17 Nov 2015 Downloaded from http://pubs.acs.org on November 24, 2015

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

Biochemistry is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 30

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Functionally distinct bacterial cytochrome c peroxidases proceed through a common (electro)catalytic intermediate

Katherine E. Frato,1,†,‡ Kelly A. Walsh1,2,‡ and Sean J. Elliott1,2,* 1

Department of Chemistry, Boston University, 590 Commonwealth Avenue, Boston,

Massachusetts 02215, United States 2

Molecular Biology, Cell Biology, and Biochemistry Program, Boston University, 5

Cummington Mall, Boston, Massachusetts 02215, United States

ACS Paragon Plus Environment

1

Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 30

ABSTRACT

The diheme cytochrome c peroxidase from Shewanella oneidensis (So CcP) requires a single electron reduction to convert the oxidized, as-isolated enzyme to an active conformation. We employ protein film voltammetry to investigate the mechanism of hydrogen peroxide turnover by So CcP. When the enzyme is poised in the active state by incubation in sodium L-ascorbate, the graphite electrode specifically captures a highly active state that turns over peroxide in a high potential regime. This is the first example of an on-pathway catalytic intermediate observed for a bacterial diheme cytochrome c peroxidase that requires reductive activation, consistent with the observed voltammetric response from the diheme cytochrome c peroxidase from Nitrosomonas europaea (Ne), which is constitutively active and does not require the same one electron activation. Mutational analysis at the active site of So CcP confirms that the rate-limiting step involves a proton-coupled single electron reduction of a high valent iron species centered on the low-potential heme, consistent with the same mutation in Ne CcP. The pH dependence of catalysis for wild-type So CcP suggests that reduction shifts the pKas of at least two amino acids. Mutation of His81 in “loop 1”, a surface exposed loop thought to shift conformation during the reductive activation process, eliminated one of the pH dependent features, confirming that the loop 1 shifts, changing the environment of His81 during the rate-limiting step. The observed catalytic intermediate has the same electron stoichiometry and similar pH dependence to that previously reported for Ne CcP, which is constitutively active and therefore hypothesized to follow a different catalytic mechanism. The prominent similarities between the rate-limiting steps of differing mechanistic classes of bCcPs suggest unexpected structural similarities in the intermediates formed.


2

Page 3 of 30

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Bacterial diheme cytochrome c peroxidases (bCcP) constitute a family of periplasmic enzymes responsible for catalyzing the two-electron reduction of hydrogen peroxide into water, by the same chemical reaction as canonical yeast monoheme cytochrome c peroxidase.(1) Interestingly, bCcPs two c-type heme cofactors per monomer, and all known representatives of the family form dimers in solution.(2-8) The dimeric structure and additional heme may imbue bCcPs with the capacity to tune reactivity in the rapidly changing environments faced by bacteria, and especially bacterial pathogens. The bCcP family constitutes two functional classes characterized by the activity of the resting state of the enzyme. bCcPs that fall into the activatable class Psa class are exemplified by Pseudomonas aeruginosa, are isolated in an inactive conformation where both the low-potential, peroxidatic heme (L-heme or FeL) and the high-potential electron transfer heme (H-heme or FeH) are in the ferric state.(2, 5, 6, 9, 10) Inactivity is attributed to the hexacoordinate state of the L-heme, representing a “closed” conformation that physically occludes the peroxide-binding site. The single-electron reductive activation of the H-heme by a native electron donor or sodium Lascorbate initiates a conformational rearrangement of several solvent-accessible loops, resulting in the release of a histidine ligand from the L-heme and generating an “open” pentacoordinate state that rapidly turns over hydrogen peroxide.(9,

11, 12)

bCcPs that are categorized in the

constitutively active class are based on the Nitrosomonas europaea CcP that demonstrates an active, pentcoordinate L-heme upon isolation. Therefore, when both hemes are in the ferric oxidation state, this subclass of bCcPs can turnover peroxide without the requirement for reductive activation.(7, 8)


3

Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 4 of 30

As a consequence of their differences in structure and activity, the two functional classes of bCcPs are hypothesized to follow distinct catalytic mechanisms that differ in the storage of oxidizing equivalents (Scheme 1). The constitutively active class is predicted to follow a mechanism similar to yeast CcP, the first irreversible catalytic step results in formation of a “Compound I”-like intermediate where the L-heme is in the ferryl oxidation state and a cation radical is housed on either the porphyrin ring or a nearby tryptophan residue.(8, 13, 14) In contrast, enzymes from the activatable class engage in peroxide binding with the H-heme in the FeII state, suggesting that the second electron comes from oxidation of the H-heme, not from formation of a cation radical.(15) We have previously reported the purification and characterization of the bCcP from Shewanella oneidensis (So CcP) from the activatable class, which has proven to be a robust model system for enzymes of this family due to its high level of recombinant expression and ease of generating well-folded mutants.(6) The crystal structure of the activated state of So CcP shows high homology to the constitutively active state of Ne CcP (RMSD=0.455 Å) (Figure 1). Further, So CcP and Ne CcP demonstrate good alignments in the critical loop regions implicated generating the activated state (Figure 1A): loop 1 is shown in yellow (RMSD= 0.207 Å), loop 2 is shown in blue (RMSD=0.237 Å), and loop 3 is shown in orange (RMSD=0.387 Å). Examination of the active sites of So CcP and Ne CcP also show high structural homology (Figure 1B, RMSD= 0.180 Å). Further, the core structure of the hemes, ligating residues, bound calcium, and the bridging tryptophan hypothesized to be involved in electron transfer between the two hemes feature similarly homology (Figure 1C, RMSD=0.195 Å).(16) Finally, key structural differences in loop 1 bearing the histidine ligand hypothesized to be the sixth ligand for the closed state of FeL are highlighted in Figure 1D. These comparisons emphasize a key


4

Page 5 of 30

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

contradiction—though the two enzyme classes share remarkably similar structures, their resting redox states require that they follow disparate mechanisms. To address this apparent contradiction, we have turned to protein film voltammetry (PFV) as a tool to directly monitor electron transfer during enzymatic catalysis.(17) In the presence of substrate, an increase in current reflects the transfer of electrons from the electrode through the enzyme active site to the substrate. The magnitude of the catalytic wave depends on the electroactive coverage as well as the enzymatic turnover rate, and potential of the half-maximum current of the catalytic wave, the catalytic midpoint, reports on the potential of the ratedetermining electron transfer step. Since the protein is directly adsorbed to the electrode surface, electron transfer between the protein and the electrode is very rapid, allowing interrogation of rate-limiting electron transfer steps within the protein. In this study, we describe the electrochemical characterization of a catalytic intermediate of So CcP hydrogen peroxide turnover by PFV. The pyrolytic graphite edge (PFE) electrode surface captures the ascorbate-reduced conformation of the enzyme, resulting in a robust catalytic wave at greater than +450 mV vs. SHE, the first demonstration of a high-potential catalytic intermediate for an activatable bCcP. We observe striking similarities between the high potential electrocatalytic intermediate of So CcP and the catalytic intermediate previously observed for the constitutively active bCcP from N. europaea, suggesting that these distinct mechanistic classes share a common catalytic intermediate.

EXPERIMENTAL PROCEDURES Recombinant Purification and Activation of So CcP. S. oneidensis CcP was purified from E. coli as a maltose binding protein (MBP) fusion as previously described.(6) MBP-tagged enzyme


5

Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 6 of 30

was cleaved with TEV,(18) passed over Ni-NTA resin, concentrated to approximately 200 µM, and stored in small aliquots at 10% glycerol and -80°C until use. Ascorbate reduced samples were prepared by incubating concentrated So CcP with 2 mM sodium L-ascorbate and 20 µM diaminodurol for either 2 hours at room temperature or overnight at 4 °C. Oxidized samples were prepared by incubation for 1 hour in 200 µM K3[Fe(CN)6]. The presence of reducing agent and mediators did not affect the turnover voltammograms.

Recombinant Purification of Ne CcP. Recombinant Nitrosomonas europaea cytochrome c peroxidase (Ne CcP) was gene synthesized by GenScript USA. The synthetic sequence included the cytochrome c peroxidase sequence, a Tobacco etch virus protease recognition sequence at the N-terminus, as well as SacI and HindIII restriction sites for subcloning into the expression vector. The synthetic sequence was inserted into the ampicillin resistant pUC57 vector (GenScript USA) between EcoRI sites to product pUC57-NeCCP. The NeCCP gene was further cloned into the pMAL-p5x vector bearing ampicillin resistance (NEB) between SacI and HindIII sites to produce pMAL-TEV-NeCCP. This construct yields NeCCP expression with an Nterminal MBP fusion, which is cleavable by TEV protease. The Factor Xa protease site present in pMAL-p5x has thus been replaced with the TEV protease recognition site (ENLYFQS). For optimal TEV cleavage, a short GSG linker was added to the N-terminus of NeCCP. This linker region was inserted using QuikChange Lightning Mutagenesis Kit with the following primers: 5’-CTGTACTTCCAATCCGGTAGTGGCAATGAA CCGATACAACC-3’ (forward) and 5’GGTTGTATCGGTTCATTGCCACTACCGGATTGGAAG TACAG-3’ (reverse).


6

Page 7 of 30

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

For optimal removal of the free MBP tag and unclipped fusion, a His6 tag was inserted at the between MBP and the TEV recognition site using QuikChange Lightning Mutagenesis Kit and the following primers: 5'-CAGACTAATTCGAGCTCGCATCATCATCATCATCATGAGAACCTGTACTTCCAA-3' (forward), and: 5'-TTGGAAGTACAGGTTCTCATGATGATGATGATGATGCGAGCTCGAATTAGTCTG-3' (reverse). Activity Assays. Electronic absorption spectra of CcPs and cytochromes c were collected using a Cary 50 spectrophotometer (Varian). Peroxidase assays were performed at 23°C, in a buffer containing 5 mM HEPES, 5mM MES, 10 mM NaCl, and 1 mM CaCl2, at pH 6.0. Horse heart cytochrome c, So c5, and Ne cyt c552 were reduced in 20 mM L-sodium ascorbate (Sigma). Excess sodium ascorbate was removed using a PD-10 column (GE Healthcare) prior to the assay. So CcP stocks were reductively activated with 1 mM L- sodium ascorbate and 10 µM diaminodurol (DAD). Ne CcP stocks were semi-reduced with 20 mM L-sodium ascorbate (Sigma) or oxidized by 5 mM potassium hexachloroiridate (Sigma), followed by removal of oxidant or reductant over PD-10 desalting column (GE Healthcare). The oxidation states of all samples were monitored using optical absorption. The continuous peroxidase assay measured the oxidation of cytochromes c by loss of α-band for Horse heart cyt c (∆ε550 = 29.5 mM-1 cm-1), So ScyA (∆ε553 = 12.5 mM-1 cm-1) and Ne cyt c552 (∆ε552 = 22.2 mM-1 cm-1), in the presence of H2O2. Potentiometric Redox Titrations. Anaerobic redox titrations of the low potential heme (FeL) of So CcP and Ne CcP followed changes in the optical spectra between 300-800 nm. The titrations were performed using 5 µM protein solutions in buffer containing 10 mM HEPES, 10 mM MES,


7

Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 8 of 30

and 2 mM CaCl2 at pH 6.0 with the temperature maintained at 23°C. Potentials were monitored using Ag/AgCl Micro Redox electrode (MI-411, Microelectrodes, Inc.), and recorded upon small volume additions of 25 mM sodium dithionite (Sigma). Mediators used include janus green (E°’= -220 mV), safranine T (E°’= -290 mV), and benzyl viologen (E°’= -350 mV), at a final concentration of 1 µM. Titrations followed the change in absorbance at 553 nm for both So CCP and Ne CCP. Construction of So and Ne CcP site-directed mutants. H81G and F102W variants were constructed using the Quik-Change Lightning kit (Stratagene) using the following primers: F102W forward 5’-CTT TAT GCT GGC GCA ATG GTG GGA TGG TCG C-3’; F102W reverse 5’-GCG ACC ATC CCA CCA TTG CGC CAG CAT AAA G-3’; H81G forward 5’ACG TCA ATT GGT CAT GGA TGG CAA GAA GGC-3’; H81G reverse 5’-GCC TTC TTG CCA TCC ATG ACC AAT TGA CGT-3’. Variants were expressed and purified as MBP-tagged fusions, cleaved with TEV and purified in their tag-free form, precisely as with wild-type. The phenylalanine residue at position 81 in Ne CcP was mutated to a tryptophan using the QuikChange Lightning Mutagenesis Kit with the following primers: F81W forward: 5'CATGAATCTGGCGCAATGGTGGGATGGCAGAGC-3' GCTCTGCCATCCCACCATTGCGCCAGATTCATG-3'

and (reverse).

F81W Sequencing

reverse:5'analysis

(Genewiz) determined that the mutation was inserted in the correct position. Protein expression and purification followed the same protocol as wild-type So CcP.(6)

Catalytic Electrochemistry. All electrochemical experiments used a three-electrode electrochemical setup consisting of pyrolytic graphite edge (PGE) working electrode (0.083 in diameter), platinum wire counterelectrode, and saturated Calomel (Accumet) reference electrode.


8

Page 9 of 30

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Temperature of the working electrode and sample solution was maintained by a water jacket system. For catalytic experiments the working electrode was rotated using an EG&G electrode rotor. Cyclic voltammetry was conducted using a PGSTAT 12 Autolab (Ecochemie) fitted with an ECD module. Experiments monitoring low-potential (< 0 vs. SHE) were completed in MBraun Labmaster glovebox to maintain nearly anaerobic conditions. All other experiments were completed under normal atmosphere, with buffers thoroughly degassed in argon. Data were collected using GPES software (Ecochemie) and analyzed using SOAS.(19) Prior to each experiment, graphite working electrodes were briefly sanded and polished with 1 µm alumina (Buehler), then extensively sonicated in water. Under anaerobic conditions, protein films were generated by depositing 4 µL of concentrated protein onto the dried electrode surface, waiting 3 minutes, then rinsing with buffer. On the benchtop, protein films were generated by cycling the clean graphite electrode from +191 mV to +641 mV vs. SHE at a scan rate of 10 mV/s in a solution containing approximately 1 µM ascorbate-reduced enzyme while rotating the electrode at 200 rpm and. The solution was maintained at 4 °C and cycled for 8-10 scans, approximately 15 minutes. The cell was then flushed with cold, enzyme free buffer prior to addition of hydrogen peroxide.

RESULTS Hydrogen peroxide turnover of So CcP enzymes. So CcP enzymes were adsorbed to graphite electrode surfaces using both direct deposit and spin deposit techniques. Both methods generated highly active enzyme films. Catalytic PFV of all bCcPs generated catalytic waves upon rotation in the presence of substrate, however in varying potential regimes. So CcP adsorbed in the oxidized, “closed” state generates catalytic features in the low potential regime centered at -


9

Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 10 of 30

100mV vs. SHE (Figure S1), consistent with reports for other activatable enzymes.(20, 21) There is no evidence of a catalytic feature in the higher potential window (+100 mV to +600 mV vs. SHE) when So CcP is adsorbed in the fully oxidized state. In contrast, So CcP adsorbed in the ascorbate-reduced, “open” state generates a robust catalytic wave in the high potential regime, centered upon +450 mV vs. SHE (Figure 2A). Conducting experiments at low temperature (4°C) stabilizes the protein on the electrode and favors the high potential catalytic feature. So CcP monolayers were sufficiently stable at low temperature to allow complete hydrogen peroxide titrations of a single film, although high concentrations of hydrogen peroxide (> 100 µM) caused enzyme films to irreversibly lose activity due to oxidative damage or desorption. We generated a number of single amino acid variants on the distal face of the L-heme to investigate the role of these residues in catalysis (Figure 1) in So CcP and Ne CcP. Residues F102, Q113, and E123 are highly conserved in diheme cytochrome c peroxidases including those of Nitrosomonas europaea, Psuedomonas aeruginosa, and Geobacter sulfurreducens. Of the distal heme pocket mutants we generated, So CcP Q113N, E123Q, and E123D all produced enzyme with no detectable electrocatalytic turnover of substrate in the high-potential regime. (The same mutations in Ne CcP also demonstrated a lack of electrocatalytic turnover.) However, F102W retained peroxidase activity and demonstrated high-potential catalytic turnover of hydrogen peroxide, albeit with currents ten times less than those detected for wild-type (Figure 2A, inset). F102W also retains the same spectral properties associated with wild-type So CcP, demonstrating that heme properties in the F102W mutant were not altered (Figure 2B-C). Further, F102W So CcP retained peroxidase activity, with kinetic parameters only slightly diminished from that of wild-type So CcP (kcat=5.5 s-1, KM= 4 ± 2 µM). Titrations demonstrate


10

Page 11 of 30

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

that the potential of FeL increases by 50 mV upon insertion of the F102W mutation (-277 mV vs SHE). In vitro peroxidase assays were completed using ScyA, the primary monoheme cytochrome c from Shewanella oneidensis and native electron donor (6, 16).

Hydrogen peroxide reduction by Ne CcP. Ne CcP films were generated through spin deposit techniques. In the same high potential regime, recombinant and native wild-type Ne CcP display nearly identical waves in the presence of peroxide, centered at ~500 mV vs. SHE (Figure 3). Using the same rationale as above, we constructed the same distal pocket mutations in Ne CcP including the F81W mutant (Figure 3A, inset). Similarly to the So CcP enzymes, the Ne F81W demonstrates an upward shift in potential of electrocalysis, as well as an approximate ten-fold decrease in current when compared to the wild type enzyme (Figure 3A, inset). F81W also retains the same spectral properties associated with the wild-type Ne CcP (Figure 3 B-C). Further, F81W demonstrates modest changes in in vitro peroxidase assays (kcat= 1.7 ± 0.4 s-1, KM= 0.4 ± 0.1 µM) when compared to the recombinant, wild-type parameters (kcat= 4.3 ± 0.2 s-1, KM= 0.13 ± 0.05 µM), using a native electron donor from Nitrosomonas europaea, cyt c552. Potentiometric titrations of heme midpoint potentials demonstrates that the F81W mutation causes modest shifts in heme potentials (FeHIII/II = 410 ± 2 mV, FeLIII/II = -245 ± 5 mV) when compared to wild-type (FeHIII/II = 450 mV and FeLIII/II = -258 mV (8)).

Substrate dependence of CcPs. Of the single amino acid variants on the distal face of the Lheme, only F102W So CcP and Ne CcP F81W retained peroxidase activity and showed highpotential catalytic turnover of hydrogen peroxide, albeit with currents ten times less than those detected for wild-type (Figures 2-3, insets). These mutants show a linear dependence of Ecat over


11

Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 12 of 30

hydrogen peroxide concentration, with a slope of 60 ± 6 mV consistent with a one electron: one substrate stoichiometry predicted by the Nernst equation for a process with a 1:1 stoichiometry of H2O2: electrons at 4°C. These linear dependencies are shifted slightly higher than the corresponding wild type enzyme, indicating that the mutation directly affects a rate-limiting catalytic step, reflecting differences in the environment at the L-heme. The increase in catalytic midpoint potentials for Ne CcP F81W with respect to wild-type Ne CcP mirrors that demonstrated for So CcP, demonstrating the effects of perturbing the L-heme distal pocket, as well as an unforeseen commonality between two bCcPs from disparate functional classes.

pH dependence of wild-type and H81G So CcP. If the observed rate-limiting step involves coupled reduction and protonation, the catalytic midpoint should shift with the pH of the solution. Analysis of the catalytic midpoint of wild-type So CcP over a wide range of pH conditions demonstrates a complicated proton dependence (Figure 5A). Catalytic potential varies steeply with pH at the extremes of pH, but is almost invariant at pH values near neutral. The data are best fit by a model described by Eq 1, where there are are a total of six distinct ionizations values, four of which can be fit here in the manner of Zu and co-workers,(22) and the two at acidic and basic extrema are not fit, but set to limiting values of 10-2 and 10-14 for the additional Kox and Kred terms, respectively:

2 3   H +   H +   H +    1+ + +   K a,ox1 K a,ox1K a,ox 2 K a,ox1K a,ox 2 (1×10 −2 ) 2.303RT Eobs = Ealk − log   2 3 + + + F  H   H   H    + +  1+ −14 −14 −14   (1×10 ) K a,red1 (1×10 ) K a,red1K a,red 2 (1×10 ) 

(1)


12

Page 13 of 30

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Fits according to this model gave values of pKox,1 = 9.5 ± 0.2, pKox, 2 = 6.5 ± 0.6, pKred, 1 = 7.3 ± 0.4, and pKred,

2

= 5.6 ± 0.2. These data indicate there are two different functional groups

whose protonation state is coupled to the reduction at the rate-limiting step of catalysis. The near-neutral pKa values determined in the above analysis suggest a role for His residues during the rate-determining step. The crystal structure of the open state of So CcP shows two consecutive histidine residues, H80 and H81, in the “L-loop”, also termed loop 1 (Figure 1D). Based on sequence alignments, H80 likely serves as the 6th ligand for the L-heme in the fullyoxidized, “closed” state. The role of H81, which is not conserved in the bCcP family, is not known, and the lack of conservation suggests that a potential contribution to proton transfer is incidental. To test possible changes in protonation state of H80 and H81 during the ratedetermining step of catalysis, we individually mutated each histidine to glycine and tested the effect on electrocatalysis. While mutation of the conserved position (H80G So CcP), lead to enzyme that was not sufficiently active to analyze by catalytic voltammetry, the H81G was highly active. Catalytic voltammetry as a function of pH revealed that a single set of Ka values were lost in removal of H81, such fitting of the resulting Pourbaix diagram could be achieved using a simple model with a single pair of Kox and Kred values, as achieved previously for the wild-type Ne enzyme (Eqn. 2)(13) :

  H + 2 + K  H +   2.303RT a,red     E1/2 = Em + log  +    nF H + K a,ox    

(2)

For H81G, the data are best fit by pKred =6.4 ± 0.06 and pKox = 8.8 ± 0.2 (Figure 5B), which we interpret in terms of a single set of pKox and pKred values coming from the protonation of H81. The importance of this proton delivery is revealed in comparison with constitutively active


13

Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 14 of 30

enzymes; as shown in Figure 5B, the pH dependence for So CcP H81G (filled diamonds) has the same shape as that previously reported for Ne CcP (open diamonds), with corresponding values of pKred = 6.5 ± 0.5 and pKox = 8.4 ± 0.2 .(13)

DISCUSSION In this study, we demonstrate that electrochemical signals observed for So CcP in the turnover mode depend on the conformation of the enzyme in solution during the adsorption process. Turnover experiments in the presence of hydrogen peroxide show a catalytic wave in the high potential regime only when the enzyme is prepared in the “open” state: in the case of the constitutively active enzyme, this is the enzyme as-isolated, but in the case of activatable bCcPs, the enzyme must first be chemically prepared. Films generated using oxidized (“closed”) enzyme could not be converted to the open state by poising at highly oxidizing potentials (>700 mV vs. SHE). Previous observations have suggested that the highly polar graphite surface can select for certain conformations of enzymes or promote unfolding of His/Met cytochromes.(23-26) In the case of So CcP, the “closed” to “open” conformational shift presumably results in the motion of surface loops rich in both positively and negatively charged amino acid side chains. It is likely that these differing charge distributions account for different affinities to the graphite surface. In the absence of slow intraprotein relay steps, catalytic voltammetry reports a catalytic midpoint that is related to a redox couple associated with the rate-limiting step of catalysis. And here, we have found that electrocatalytic midpoint potentials for active bCcP enzymes are nearly the sample, and not centered on values associated with either the active-site FeLIII/II redox couple (-277 and –258 mV for So and Ne(8) respectively), nor the FeHIII/II couple (+246 mV and +450 mV for So(6) and Ne(8)

respectively). Catalytic voltammetry of mutants beyond the first


14

Page 15 of 30

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

coordination shell of the iron active site, such as So F102W and Ne F81W, again reveals commonality in electrocatalytic potentials that are shifted more positive by ~ +50 mV strongly implicating a L-heme based redox couple in the rate-determining step. Based on these data, we suggest that the midpoint potential of electrocatalysis reflects a high valent iron redox couple at the L-heme, such as the (FeLIV=O)/(FeLIII-OH) predicted in the catalytic cycle (Scheme 1). In the case of the Shewanella enzyme, catalytic intermediates poised at >450 mV vs. SHE would be thermodynamically favored to receive electrons from both FeH and the in vivo electron donor ScyA16, whose midpoint potential is ~ +300 mV.(26)

A similar argument holds for the

Nitrosomonas system, where Ne cyt c552 possesses a potential of +260 mV.(27) Electrochemistry on graphite has been previously reported for a number of bCcP family members, yet all previous studies used enzyme adsorbed in the as-isolated state. Direct electrochemistry of activatable bCcPs from Pseudomonas aeruginosa(20) and Geobacter sulfurreducens(21, 28) adsorbed with both hemes in the ferric oxidation state resulted in hydrogen peroxide turnover only in a low potential regime (~ -100 mV vs. SHE) that monitored an offpathway FeII/FeIII couple. In contrast, the constitutively active bCcP from Nitrosomonas europaea gave a single catalytic feature at high potential (Ecat > 500 mV) consistent with an onpathway catalytic intermediate.(13) These observations lead to the hypothesis that peroxide turnover at either high or low potential catalytic regimes was diagnostic of the differences in proposed catalytic mechanism.(20) In our investigation of So CcP we find the first counterexample, showing that converting an activatable bCcP to its “open” conformation leads to electrochemical behavior similar to that of Ne CcP. In addition to sharing the high-potential regime of catalysis, electrocatalytic results shows that the electron stoichiometry and proton-dependence are the same in Ne CcP and ascorbate-poised


15

Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 16 of 30

So CcP, again indicating a similar electrocatalytic intermediate is at work. Both enzymes have a slope of 60 mV per decade of hydrogen peroxide concentration, indicating a 1 H2O2: 1estoichiometry. This contrasts the monoheme yeast cytochrome CcP, which was shown by catalytic voltammetry to have a 1 H2O2: 2e- stoichiometry for the rate-limiting step (25). Furthermore, the pH dependence curves of H81G So CcP and wild-type Ne CcP are very similar, suggesting a shared structure during the rate-limiting step (Fig 5). This is consistent with the observation that in Ne CcP, the position analogous to H81 is substituted by lysine (Figure 1C), which should have a pKa > 10, outside the measureable range of our pH dependence experiments. The evidence presented here suggests that these two divergent classes of bCcPs share a ratedetermining step of catalysis. In both cases we interpret these data as implicating a rate-limiting step involving the proton-dependent reduction of a Fe(IV)=O species, a “compound II”-like intermediate. Based on the hypothesized reaction mechanism in Scheme 1, the rate-limiting step for activated So CcP is consistent with the first single-electron reduction, while in constitutivelyactive Ne CcP case, the rate-limiting step is consistent with the second hypothesized singleelectron reduction. The similar pH dependence data, especially between H81G So CcP and wildtype Ne CcP, demonstrates that the redox-coupled structural changes involved in the ratedetermining step are shared between So and Ne CcP. Our electrochemical results suggest that further analysis of catalytic intermediate species formed by So and Ne CcPs by EPR or stoppedflow kinetics will show greater similarity between the catalytic intermediates of these two classes of bCcP than previously suggested. These interpretations lead to the critical question: why are the catalytic potentials of So CcP, and Ne CcP so low, when compared to other Fe(IV)=O/Fe(III) potentials of other peroxidases?


16

Page 17 of 30

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

There is no straightforward answer to this question, in part due to the challenged imposed by measuring the midpoint potentials of catalytic intermediates for peroxidase reactions, which possess fleeting lifetimes typically. The (FeLIV=O)/(FeLIII-OH) midpoint potential we report here, and the midpoint potential previously reported for Ne CcP (~515 mV vs. SHE) (13) are both much lower in potential than catalytic intermediates for peroxidases outside the bCcP family. Compound I/compound II couples have been estimated to be 1.06 V (horseradish peroxidase(29)) 0.915 V (Arthromyces ramosus peroxidase(30)) and 1.14 V (Lactoperoxidase(31)). In these systems, compound II/ferric resting state potentials have been found to be similarly high in potential. There is no evidence that bCcPs use the high-valent iron species to act as oxidizing agents for exogenous substrates as is the case in horseradish peroxidase and lactoperoxidase, therefore lower potential catalytic intermediates may be advantageous to preferentially oxidize the correct electron transfer protein substrates (cytochromes c or blue copper proteins), versus small molecules (i.e., horse radish peroxidase substrates) or protein-based Trp residues, as in the case of the bCcP ortholog, MauG which is responsible for the oxidative maturation of the tryptophanyl-tryptophylloquinone cofactor in methylamine dehydrogenase(32)f. In such a naïve view – bCcP enzymes do not need to have high catalytic potentials, as they are only oxidizing an electron-transfer protein. Yet that rationalization is not satisfying. From a molecular point of view, our observations do underscore an emerging lesson from studies of MauG, which show that the two hemes found within in the bCcP family act as a singular unit. For example, the recent work of Abu Tarboush and Shin and co-workers

(33, 34)

indicates how mutations in the

immediate distal pocket of the peroxidatic heme (the Gln(33) and Glu(34) positions shown in Figure 1B), impact the redox properties of both heme centers. Collectively, these data suggest an as-yet unexplored role for the protein and heme environments to interact, such that emergent


17

Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 18 of 30

properties arise, where the two hemes operate together. We believe that the same phenomena may be at work in the canonical bCcPs studied here, as observed in the tuning of the redox properties of electrocatalytic intermediates. In applying such a view to future studies, it is clear that we should not consider just the peroxidatic heme environment, but the collection of conserved residues that allows the FeL active site, to interact with the second heme center. Further, with PFV methods in hand, we will be able to bring electrochemical methods to bear on rationalizing the aspects of protein structure that modify both heme environments, tuning the reactivity of bCcP enzymes.

ACKNOWLEDGMENT The authors would like to thank Dr. Katie E. Winkler for the production of So mutant H80G; and Dr. Gökçe Su Pulcu for the construction of H81G, and the initial electrochemical analysis of the as-isolated So enzyme. Dr. Benjamin D. Levin is thanked for the initial synthesis of the recombinant Ne enzyme.

Corresponding Author * To whom correspondence should be addressed: Sean J Elliott, Department of Chemistry. Boston University, 590 Commonwealth Avenue, Boston, MA, 02215, USA. Tel: (617) 3582816,  Fax: (617) 353-6466, email: [email protected] Present Addresses


18

Page 19 of 30

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

† present address: Department of Chemistry, Seattle University, Seattle, WA 98112. Author Contributions The manuscript was written through contributions of all authors. All authors have given approval to the final version of the manuscript. ‡These authors contributed equally. Funding Sources This work was supported by the National Science Foundation (CHE 1310012). SUPPORTING INFORMATION Electrocatalytic characterization of the as-isolated, un-activated So enzyme. This material is available via the internet at http://pubs.acs.org

ABBREVIATIONS So, Shewanella oneidensis; Ne, Nitrosmonas europaea; Psa, Pseudmonas aeruginosa; bCcP, bacterial cytochrome c peroxidase; RMSD, root mean squared deviation; FeL, low-potential heme iron; FeH, high-potential heme iron; PFV, protein film voltammetry; PGE, pyrolytic graphite edge


19

Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 20 of 30

REFERENCES 1. Pettigrew, G. W., Echalier, A., and Pauleta, S. R. (2006) Structure and mechanism in the bacterial dihaem cytochrome c peroxidases, Journal of inorganic biochemistry 100, 551567. 2. Alves, T., Besson, S., Duarte, L. C., Pettigrew, G. W., Girio, F. M., Devreese, B., Vandenberghe, I., Van Beeumen, J., Fauque, G., and Moura, I. (1999) A cytochrome c peroxidase from pseudomonas nautica 617 active at high ionic strength: Expression, purification and characterization, Biochimica et biophysica acta 1434, 248-259. 3. De Smet, L., Pettigrew, G. W., and Van Beeumen, J. J. (2001) Cloning, overproduction and characterization of cytochrome c peroxidase from the purple phototrophic bacterium rhodobacter capsulatus, European journal of biochemistry / FEBS 268, 6559-6568. 4. Fulop, V., Ridout, C. J., Greenwood, C., and Hajdu, J. (1995) Crystal structure of the dihaem cytochrome c peroxidase from pseudomonas aeruginosa, Structure 3, 1225-1233. 5. Hoffmann, M., Seidel, J., and Einsle, O. (2009) Ccpa from geobacter sulfurreducens is a basic di-heme cytochrome c peroxidase, Journal of molecular biology 393, 951-965. 6. Pulcu, G. S., Frato, K. E., Gupta, R., Hsu, H. R., Levine, G. A., Hendrich, M. P., and Elliott, S. J. (2012) The diheme cytochrome c peroxidase from shewanella oneidensis requires reductive activation, Biochemistry 51, 974-985. 7. Zahn, J. A., Arciero, D. M., Hooper, A. B., Coats, J. R., and DiSpirito, A. A. (1997) Cytochrome c peroxidase from methylococcus capsulatus bath, Archives of microbiology 168, 362-372. 8. Arciero, D., and Hooper, A. (1994) A di-heme cytochrome c peroxidase from nitrosomonas europaea catalytically active in both the oxidized and half-reduced states., The Journal of biological chemistry 269, 11878-11886. 9. Echalier, A., Goodhew, C. F., Pettigrew, G. W., and Fulop, V. (2006) Activation and catalysis of the di-heme cytochrome c peroxidase from paracoccus pantotrophus, Structure 14, 107-117. 10. Gilmour, R., Goodhew, C. F., Pettigrew, G., Prazeres, S., Moura, I., and Moura, J. (1993) Spectroscopic characterization of cytochrome c peroxidase from paracoccus denitrificans, Biochemical J 294, 745-752. 11. Echalier, A., Brittain, T., Wright, J., Boycheva, S., Mortuza, G. B., Fulop, V., and Watmough, N. J. (2008) Redox-linked structural changes associated with the formation of a catalytically competent form of the diheme cytochrome c peroxidase from pseudomonas aeruginosa, Biochemistry 47, 1947-1956. 12. Dias, J., Alves, T., Bonifacio, C., Pereira, A., Trincao, J., Bourgeois, D., Moura, I., and Romao, M. (2004) Structural basis for the mechanism of ca(2+) activation of the di-heme cytochrome c peroxidase from pseudomonas nautica 617., Structure 12, 961-973. 13. Bradley, A. L., Chobot, S. E., Arciero, D. M., Hooper, A. B., and Elliott, S. J. (2004) A distinctive electrocatalytic response from the cytochrome c peroxidase of nitrosomonas europaea, The Journal of biological chemistry 279, 13297-13300. 14. Shimizu, H., Schuller, D. J., Lanzilotta, W. N., Sundaramoorthy, M., Arciero, D. M., Hooper, A. B., and Poulos, T. L. (2001) Crystal structure of nitrosomonas europaea cytochrome c peroxidase and the structural basis for ligand switching in bacterial di-heme peroxidases, Biochemistry 40, 13483-13490.


20

Page 21 of 30

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

15.

16.

17. 18. 19.

20.

21.

22.

23.

24.

25.

26. 27.

28.

29.

Ronnberg, M., Lambeir, A., Ellfolk, N., and Dunford, H. B. (1985) A rapid-scan spectrometric and stopped-flow study of compound i and compound ii of pseudomonas cytochrome c peroxidase, Archives of biochemistry and biophysics 236, 714-719. Schutz, B., Seidel, J., Sturm, G., Einsle, O., and Gescher, J. (2011) Investigation of the electron transport chain to and the catalytic activity of the diheme cytochrome c peroxidase ccpa of shewanella oneidensis, Applied and environmental microbiology 77, 6172-6180. Léger, C., and Bertrand, P. (2008) Direct electrochemistry of redox enzymes as a tool for mechanistic studies, Chemical Reviews 108, 2379-2438. van den Berg, S., Löfdahl, P. A., Härd, T., and Berglund, H. (2006) Improved solubility of tev protease by directed evolution, Journal of biotechnology 121, 291-298. Fourmond, V., Hoke, K., Heering, H. A., Baffert, C., Leroux, F., Bertrand, P., and Leger, C. (2009) Soas: A free program to analyze electrochemical data and other onedimensional signals., Bioelectrochemistry 76, 141-147. Becker, C. F., Watmough, N. J., and Elliott, S. J. (2009) Electrochemical evidence for multiple peroxidatic heme states of the diheme cytochrome c peroxidase of pseudomonas aeruginosa, Biochemistry 48, 87-95. Ellis, K. E., Seidel, J., Einsle, O., and Elliott, S. J. (2011) Geobacter sulfurreducens cytochrome c peroxidases: Electrochemical classification of catalytic mechanisms, Biochemistry 50, 4513-4520. Zu, Y. C., M. M-J., Kolling, D.R.J.; Crofts, A.R.; Eltis, L.D. Fee, J.A.; Hirst, J. . (2003) Reduction potentials of rieske clusters: Importance of the coupling between oxidation state and histidine protonation state, Biochemistry 42, 12400-12408. Paes de Sousa, P. M., Rodrigues, D., Timoteo, C. G., Simoes Goncalves, M. L., Pettigrew, G. W., Moura, I., Moura, J. J., and Correia dos Santos, M. M. (2011) Analysis of the activation mechanism of pseudomonas stutzeri cytochrome c peroxidase through an electron transfer chain, Journal of biological inorganic chemistry : JBIC : a publication of the Society of Biological Inorganic Chemistry 16, 881-888. Ye, T., Kaur, R., Senguen, F., Michel, L., Bren, K., and Elliott, S. (2008) Methionine ligand lability of type i cytochromes c: Detection of ligand loss using protein film voltammetry., Journal of the American Chemical Society 130, 6682-6683. Levin, B., Can, M., Bowman, S., Bren, K., and Elliott, S. (2011) Methionine ligand lability in bacterial monoheme cytochromes c: An electrochemical study., The journal of physical chemistry. B 115, 11718-11726. Levin, B., Walsh, K., Sullivan, K., Bren, K., and Elliott, S. J. (2015) Methionine ligand lability of homologous monoheme cytochromes c, Inorg Chem 54, 38-46. Ye, T., Kaur, R., Wen, X., Bren, K., and Elliott, S. (2005) Redox properties of wild-type and heme-binding loop mutants of bacterial cytochromes c measured by direct electrochemistry., Inorg Chem 44, 8999-9006. Seidel, J., Hoffmann, M., Ellis, K. E., Seidel, A., Spatzal, T., Gerhardt, S., Elliott, S. J., and Einsle, O. (2012) Maca is a second cytochrome c peroxidase of geobacter sulfurreducens, Biochemistry 51, 2747-2756. Hayashi, Y., and Yamazaki, I. (1979) The oxidation-reduction potentials of compound i/compound ii and compound ii/ferric couples of horseradish peroxidases a2 and c, Journal of Biological Chemistry 254, 9101-9106.


21

Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

30.

31.

32.

33.

34.

Page 22 of 30

Farhangrazi, Z. S., Copeland, B. R., Nakayama, T., Amachi, T., Yamazaki, I., and Powers, L. S. (1994) Oxidation-reduction properties of compounds i and ii of arthromyces ramosus peroxidase, Biochemistry 33, 5647-5652. Furtmüller, P. G., Arnhold, J., Jantschko, W., Zederbauer, M., Jakopitsch, C., and Obinger, C. (2005) Standard reduction potentials of all couples of the peroxidase cycle of lactoperoxidase., Journal of inorganic biochemistry 99, 1220-1209. Davidson, V. L., and Wilmot, C. M. (2013) Posttranslational biosynthesis of the proteinderived cofactor tryptophan tryptophylquinone, Annual review of biochemistry 82, 531550. Abu Tarboush, N., Yukl, E. T., Shin, S., Feng, M., Wilmot, C. M., and Davidson, V. L. (2013) Carboxyl group of glu113 is required for stabilization of the diferrous and bisfe(iv) states of maug, Biochemistry 52, 6358-6367. Shin, S., Yukl, E. T., Sehanobish, E., Wilmot, C. M., and Davidson, V. L. (2014) Sitedirected mutagenesis of gln103 reveals the influence of this residue on the redox properties and stability of maug, Biochemistry 53, 1342-1349.


22

Page 23 of 30

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

SCHEMES Scheme 1: Proposed reaction schemes for a) constitutively active CcPs and b) activatable CcPs. Modified from 13.


23

Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 24 of 30

FIGURE LEGENDS

Figure 1: Structural comparisons of So CcP in the open conformation (3O5C.pdb) and asisolated Ne CcP (1IQC.pdb), where bold numbering is in terms of the So CcP and italics for Ne CcP positions. (A) The overlaid CcP protomers, highlighting flexible loops implicated in reductive activation. Loop 1, yellow. Loop 2, blue. Loop 3, orange. (B) The distal face of the Lheme, the site of peroxide binding. (C) Heme and calcium centers, bridging tryptophan. (D) Zoom in on the location of H80 and H81, on loop 1 at the dimer interface. Figure 2. (A) Electrocatalytic responses of reductively activated So CcP, in the presence of increasing H2O2 from 4.5 to 288 µM. (Inset: the So F102W mutant, where activity is severely diminished (solid line, 288 µM) compared to enzyme-free electrochemical response (dotted line)). Buffer: 5 mM MES, 5 mM HEPES, 10 mM NaCl, 1 mM CaCl2, pH 6.0, 4°C. Scan rate: 20 mV/s, rotation rate: 1500. Spectral data of (B) wild-type and (C) F102W So CcP samples shown in the oxidized state (red) and semi-reduced state (black). Figure 3. (A) Electrocatalytic responses for the fully oxidized Ne CcP, in the presence of increasing H2O2 from 4.5 to 288 µM. Inset: The F81W mutant of Ne CcP (solid line). The activity is slightly diminished compared to the substrate-free baseline (dashed line). Buffer: 5 mM MES, 5 mM HEPES, 10 mM NaCl, 1 mM CaCl2, Scan rate: 20 mV/s (wild-type) 10 mV/s (F81W), rotation rate: 2000 rpm. Spectral data of (B) wild-type and (C) F81W Ne CcP samples shown in the oxidized state (red) and semi-reduced state (black). Figure 4. Electrocatalytic potentials of bacterial CcP enzymes as a function of substrate concentration, as depicted as in (15). The recombinant Ne enzyme (solid squares) is compared to Ne F81W (open squares), activated So enzyme (solid triangles), So F102W (open triangles), as


24

Page 25 of 30

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

well as Geobacter CcP (circles, taken from (23)), and un-activated Pseudomonas enzyme (diamonds, taken from (22)).

Figure 5. The midpoint potential of the catalytic wave depends on pH for both wild-type and

H81G So CcP. (A) Catalytic potential of wild-type So CcP (solid circles, 90 µM H2O2), and fit to equation 2 (B) Catalytic potential of H81G So CcP (filled diamonds, 90 µM H2O2) compared to the catalytic midpoint potential of Ne CcP (open diamonds) fit to equation 1. Buffer: 5 mM MES, 5 mM HEPES, 5 mM TAPS, 5 mM CHES, 10 mM NaCl, 1 mM CaCl2, pH 6.0, 4°C. Scan rate: 20 mV/s, rotation rate: 1500 rpm.


25

Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 26 of 30

FIGURES

A.

B.

F102 F81 Q113 Q92 E123 E102

H80 H59

D.

H81 K60

C.

FeH W103

FeL

W82

W82 W61

Ca2+

Figure 1.


26

Page 27 of 30

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Figure 2.

Figure 3.


27

Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 28 of 30

Figure 4.


28

Page 29 of 30

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Figure 5.


29

Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 30 of 30

Insert Table of Contents Graphic and Synopsis Here.


30

Functionally Distinct Bacterial Cytochrome c Peroxidases Proceed

Recommend Documents