Article pubs.acs.org/est
Combined Exposure to 3‑Chloro-4-dichloromethyl-5-hydroxy-2(5H)furanone and Microsytin-LR Increases Genotoxicity in Chinese Hamster Ovary Cells through Oxidative Stress Shu Wang,†,∥ Dajun Tian,†,∥ Weiwei Zheng,† Songhui Jiang,† Xia Wang,† Melvin E. Andersen,‡ Yuxin Zheng,† Gensheng He,*,§ and Weidong Qu*,† †
Department of Environmental Health and §Department of Nutrition and Food Hygiene, Key Laboratory of the Public Health Safety, Ministry of Education, School of Public Health, Fudan University, Shanghai, 200032, China ‡ Institute for Chemical Safety Sciences, The Hamner Institutes for Health Sciences, Research Triangle Park, North Carolina 27709, United States ABSTRACT: The disinfection byproducts 3-chloro-4-dichloromethyl-5-hydroxy-2(5H)-furanone (MX) and microcystins-LR (MC-LR), which are common contaminants in drinking water, often occur together in water sources in areas with high gastrointestinal tract cancer risks. While often studied alone, combination effects of these compounds are unknown. Here, we examine combined genotoxic responses to mixtures of MX and MC-LR using the Ames test, a cytokinesis-block micronuclei assay, and the comet assay with analysis for interactions by fractional analysis. We also evaluated a possible mechanism of genotoxicity by examining effects of the compounds on markers of oxidative stress. MX and MC-LR administrated jointly at noncytotoxic concentrations demonstrated significant interactions in the Ames test, the micronuclei assay, and the comet assay showing responses greater than those expected for additivity. Moreover, coexposure to MX and MC-LR significantly increased luciferase antioxidant response element activity, intracellular superoxide dismutase, catalase, glutathione, and reactive oxygen species production. In comparison with exposure to either compound alone, the mixtures of MX and MC-LR caused a less than additive effect on oxidative stress. Taken together, these results indicate that MC-LR exacerbates MX genotoxicity in low-dose combined exposure. This interaction may be enhanced by oxidative stress in the combined exposures.
■
INTRODUCTION Human health is closely related with the quality of drinking water. Commonly used purification methods, such as coagulation, sedimentation, and sand filtration, do not completely eliminate all the contaminants in water. In this manner, populations are inevitably exposed to a variety of lowlevel contaminants from drinking water. Although the concentrations of most of these chemical contaminants in drinking water are usually low,1 exposure persists throughout life, and some contaminants even at low levels of exposure may have adverse effects on humans.2 Another concern is for combination effects that may occur even if the various mixture components are present at levels below their individual no observed effect concentrations. Some investigations, assessing the toxicity of mixed exposure to drinking-water disinfection byproducts (DBPs), have provided important methodological3−6 and statistical7,8 tools for understanding the effects of mixture contaminants. However, there are few toxicological effects studies of DBPs in combination with biotoxins. 3-Chloro-4-(dichloro-methyl)-5-hydroxy-2(5H)-furanone (mutagen X, MX) and microcystins-LR (MC-LR) are common, low-concentration contaminants in drinking water. MX is an © 2013 American Chemical Society
unintended byproduct from reactions of chlorine with humic acid, fulvic acid, and other organic contaminants present in raw waters.9 Microcystins (MCs) are monocyclic heptapeptide contaminants either derived from dissolved MCs in raw water or produced from algae cell lyses during water treatment process.10 Chlorination is the most common drinking water disinfection process, and MCs are commonly found in finished drinking water. Because toxic cyanobacteria are also targets of chlorine disinfection,11 MX and MC-LR become common cocontaminants in drinking water. MX is one of the most potent mutagens found in drinking water, with responses examined in Salmonella typhimurium TA100 stains and in mammalian cell systems, such as rat liver epithelial cells,12 CK6,13 and HepG2 cells.14 MX causes DNA damage in vivo15 and is a multisite carcinogen.16 Raw MC extracts from algae are also genotoxic.17 In humans, MC exposures have been associated with gastroenteritis,18 colorectal Received: Revised: Accepted: Published: 1678
November 9, 2012 January 1, 2013 January 3, 2013 January 3, 2013 dx.doi.org/10.1021/es304541a | Environ. Sci. Technol. 2013, 47, 1678−1687
Environmental Science & Technology
Article
cancer,19 and hepatocellular carcinoma.20 MC-LR is the most potent MC21 and is found at high levels in drinking water in areas with high liver cancer incidence. MC exposure is also associated with increased serum enzyme levels and is a risk factor for liver damage in children.22 MC-LR is genotoxic in TK6, human lymphocytes, colon cancer cells (CaCo-2), astrocytoma cells (IPDDC-A2), and lymphoblastoid (NCNC) starting at 1−20 mg/L.23,24 These doses used in the in vitro tests are much higher than found in drinking water sources (MC-LR ranges from 0 to 15.6 μg/L25 while MX from no detection to 310 ng/L26). However, combined genotoxic effects of MX and MC-LR remain untested. Current knowledge on the possible toxic mechanisms of MX and MC-LR was mainly acquired from a single compound. Phosphatase inhibition,27 mitochondrial oxidative phosphorylation,28 and oxidative stress29,30 play crucial roles in hepatic damage with MCs. MX stimulates production of reactive oxygen species (ROS) and simultaneously decreases intracellular glutathione (GSH),31 increases malondialdehyde, and decreases glutathione in cellular oxidative stress.32 The primary goal of the present study was to investigate the combined effects on genotoxicity induced by MX and MC-LR in Chinese hamster ovary epithelial (CHO-K1) cells based on full factorial design. Within the course of the study, we observed more than additive interactions between the two for mutagenicity. Our results indicated that oxidative stress may underlie the mechanism of interaction between MX and MC-LR.
was considered positive when the number of revertants was at least twice the revertants in the negative control number and showed a dose-dependent relationship.28 For a negative control, 100 μL/plate DMSO was tested, and the following known mutagens were tested as positive controls: for nonactivated, 5 and 1 μg of sodium azide (SA), 2,7−2 aminofluorene (AF) per plate for TA100 and TA98, respectively; for activated, 10 μg of 2-AF for both TA100 and TA98. A blank sample without the addition of salmonella were prepared and tested under the same condition for confirming without other bacteria contamination. Micronuclei Assay. The micronuclei (MNi) analysis was performed using the cytokinesis-block micronucleus (CBMN) technique.35 Lgarithmic growth phase CHO-K1 cells were incubated with F-12K media containing MC-LR (0−5 μM) and MX (0−20 μM) for 24 h. Upon washed twice with Hanks’ balanced salt solution (HBSS), 3 μg/mL cytochalasin-B (Sigma) was added for 24 h. Cells were collected and hypotonially treated with 0.075 M KCl for 3 min before being fixed with a mixture of ethanol/acetic acid (20:1) for 20 min. The slides were prepared by cytocentrifugation, air-dried, and stained by Giemsa staining (Sigma). MNi analysis was performed on coded slides by scoring 2000 binucleated (BN) cells for each subject. The numbers of (a) MNi, a biomarker of chromosome breakage and/or whole chromosome loss, (b) nucleoplasmic bridges (NPBs), a biomarker of DNA misrepair and/or telomere end-fusions, and (c) nuclear buds (NBUDs), a biomarker of elimination of amplified DNA and/or DNA repair complexes were calculated. DMSO (0.5%) was used as the solvent control while 1 μM mitomycin C was used as the positive control. Comet Assay. The comet assay, which quantitatively measures genomic DNA damage in individual nuclei of treated cells, was performed as guidelines.36 Each experiment included a solvent control (0.5% DMSO), a positive control (600 μg/ mL hydrogen peroxide), MC-LR (0−5 μM), and MX (0−20 μM) with orthogonal combination. After treatment for 24 h, the harvested cells were embedded in an agarose microgel and lysed; the DNA was denatured and electrophoresed under alkaline conditions. The slides were rinsed with distilled water, air-dried, and subsequently, stained with 0.02 mg/mL ethidium bromide. At least 100 randomly selected cells were analyzed per dose with triplicates. For quantifying DNA damage, the percent tail DNA was calculated by the CASP image analysis system. Determination of Intracellular ROS. The intracellular ROS generation in CHO-K1 cells was measured by a flow cytometer with the oxidation-sensitive fluorescent probes DCFH-DA and dihydroethidine.37 CHO-K1 cells were treated for 24 h with MC-LR (dose from 0 to 0.25 μM) and MX (dose from 0 to 20 μM) at 37 °C. When measuring the intracellular H2O2 levels, the treated cells were rinsed three times with Krebs Ringer buffer at 37 °C and then incubated in the dark with Krebs Ringer buffer containing 20.5 μM DCFH-DA for 45 min. For intracellular superoxide anion (O2·−) determination, the treated cells were incubated in the dark with Krebs Ringer buffer containing 10 μM dihydroethidine for 45 min. Fluorescence was measured by FACS Aria flow cytometry (BD, USA). For each treatment, 10 000 cells were counted, and the experiment was performed in triplicate. Activities of Antioxidant Enzymes. Cells in each treatment group (106−107 in number) were washed with icecold PBS, scraped into 0.1 M PBS/5 mM EDTA, and sonicated
■
MATERIALS AND METHODS Reagents. MX was obtained from Wako (Osaka, Japan). MC-LR, dimethylsulfoxide (DMSO), cytochalasin-B, agarose (normal/low melting point), ethidium bromide solution, hydrogen peroxide, 2′,7′-dichlorofluorescin diacetate (DCFHDA), and dihydroethidine were obtained from Sigma (St. Louis, MO). F-12K medium, fetal bovine serum (FBS), trypsin−EDTA, penicillin, and streptomycin were from Invitrogen (Carlsbad, CA). The kits for the cytotoxicity assay, superoxide dismutase (SOD), and total GSH quantification were purchased from Dojindo (Kumamoto, Japan). CHO-K1 Cells. CHO-K1 cells (ATCC: CCL-61) were grown in F-12K supplemented with 10% FBS and 100 U/mL penicillin and streptomycin at 37 °C in a humidified atmosphere of 5% CO2. Acute Cytotoxicity Assay. Cytotoxicity was evaluated as described previously.33 Briefly, a minimum of five replicates of 1 × 103 cells per well were plated in 96-well plates with fresh media containing various concentrations of MX (0−120 μM) and MC-LR (0, 0.5, 5.0 μM). Cells were incubated for an additional 24 h, and cell viability was determined using the CCK-8 kit (Kumamoto, Japan). Results were expressed as a percentage of control cells. The software GraphPad Prism5 was used to draw the dose−response curve and calculate LC50. Ames Test. The Ames test was performed as described previously.34 In brief, the following concentrations for treatment were prepared: 0−0.4 nmol/plate of MX and 0−1 nmol/ plate of MC-LR. All samples were suspended in DMSO solution. Next, 1 × 107 cells/plate of an overnight bacterial culture was added, and 0.5 mL of a S9 mixture or phosphatebuffered saline (PBS) mixed with 2 mL of top agar was poured onto a glucose minimal plate. The mixture was incubated at 37 °C for 48 h before being scored for revertant colonies. Each of the tests was performed three times in duplicate plates, and mean revertants/plate were calculated for each dose. A sample 1679
dx.doi.org/10.1021/es304541a | Environ. Sci. Technol. 2013, 47, 1678−1687
Environmental Science & Technology
Article
of CHO cells (P < 0.05) (Figure 1). The cell survival of CHO cells treated with 0, 0.5, and 5 μM MC-LR alone was not
eight times (30 s each) on ice. Following centrifugation (30 min at 10 000g at 4 °C), the supernatants were used to determine the intracellular enzyme activities of SOD and catalase. Total SOD activity was measured by an assay kit according to the manufacturer’s instructions that involved the reaction with a chromogenic reagent 2-(4-lodophenyl)-3-(4-nitrophenyl)-5-(2, 4-disulfophenyl)-2H-tetrazolium, monosodium salt (WST) to form an intensely colored dye with a maximum absorption at 450 nm. The SOD activity was expressed as the inhibition rate following the manufacturer’s instructions and normalized by the cell number. Catalase activity was assayed by published methods, 38 based on the direct measurement of H 2O 2 decomposition. The reaction solution (3 mL) consisted of 100 mM phosphate buffer (pH 7.0), 0.1 μM EDTA, 0.1% H2O2, and 0.1 mL of enzyme extract. The decrease of H2O2 was monitored at 240 nm and quantified using its molar extinction coefficient (39.4 mM−1 cm−1). Determination of GSH. CHO-K1 cells were incubated with F-12K culture media containing MC-LR (doses at 0, 0.05, and 0.25 μM) and MX (0, 5, and 20 μM). After each toxin treatment for 0.5, 1, 2, 3, 4, 8, 16, and 24 h, the medium was removed for GSH determination. The total GSH in treated CHO-K1 cells was measured by the Total Glutathione Quantification kit according to the manufacturer’s instruction. The assay was designed by using Ellman’s reagent (5, 5′-dithiobis-2-nitrobenzoic acid, DTNB), which reacts with GSH to form a product with a maximum absorbance at 412 nm. Antioxidant Response Element Luciferease Reporter Assay. Cignal Lenti antioxidant response element (ARE) reporter, which expresses a luciferase gene driven by multiple ARE (TCACAGTGACTCAGCAAAATT) repeats, was obtained from SABiosciences (Frederick, MD). Lentiviral transduction of CHO cells was performed as described previously.39 Cells were grown in medium containing 3.5 μg/mL puromycin. Cells were treated with MC-LR (0−0.25 μM) and MX (0−20 μM) for 6 h. tert-Butylhydroquinone (tBHQ, 200 μM) served as a positive control. The luciferase activity was measured by the Luciferase Reporter Assay System (Promega, Madison, WI) according to the manufacturer’s protocol, and the luciferase activity was normalized to cell viability. Statistical Analysis. All data were expressed as mean ± standard error (SE). Multiple comparisons with a specific control were assessed by the use of one-way analysis of variance (ANOVA) followed by the Bonferroni t test. The differences between treatments of percent tail DNA was analyzed via oneway ANOVA (Kruskal−Wallis). Interactions between MX and MC-LR on CHO cells were examined by two-way ANOVA. A value of P < 0.05 was considered statistically significant. In order to study synergistic or antagonistic interactions, the expected and observed results were compared according to the effect−addition model, that is, E(d1, d2) = E(d1) + E(d2), where E(d1, d2) is the effect at (d1, d2) and E(di) is the effect of the compound alone at dose di (i = 1, 2).40 When the effect of the combination dose was greater than, less than, or equal to that predicted by the effect−addition model, the combination dose was characterized as synergistic, antagonistic, or additive, respectively.41
Figure 1. Dose−response curve of cytotoxicity induced by MX and MC-LR coexposure. The concentration of MX was 0−120 μM, and the concentration of MC-LR was 0, 0.5, or 5.0 μM.
changed significantly from the control (P > 0.05). The cytotoxicity of 20−40 μM MX alone is not obvious; when the concentration of MX exceeded to 50 μM, the cytotoxicity increased significantly. There were statistically significant interactions between MX and MC-LR on cytotoxicity in CHO cells (P < 0.05). The average cell survival rate induced by the combination of the two chemicals was less than the sum of the cell survival rate induced by the single compounds, indicating that the mixture of MX and MC-LR induced an antagonistic effect. The LC50 of MX with 0, 0.5, and 5 μM MCLR was 64.61, 67.84, and 75.44 μM, respectively, so in the following experiments, we use the lower concentrations to avoid confounding of genotoxicity by cytotoxic responses. Mutagenicity of MX Combined with MC-LR. Mutagenicity for MX combined with MC-LR was evaluated in the Salmonella typhimurium plate-incorporation assay using the frame shift strain TA98 and a base-pair-change strain TA100 that were histidine-requiring strains. The number of revertants in MX-treated plates was concentration-dependent in TA98 and TA100 strains in the absence of the S9 mix. MC-LR alone did not increase revertants, as previously reported.42 In the presence of the S9 mix, MX and MC-LR either independently or in combination did not increase revertant colony formation in strains TA98 and TA100. MC-LR treated at concentrations of 0.1−1 nmol/plate combined with MX (0.1−0.4 nmol/plate) significantly increased the number of revertants in TA98 and TA100 strains in the absence of S9 (Figure 2A). For the combinations, mean revertants/plate were significantly higher than values predicted from the effect−addition model in tested combinations. Therefore, the exposure of CHO cells to MC-LR in combination with MX resulted in a significant interaction on revertant colony formation. Micronuclei Induced by MX and MC-LR. The CBMN assay is effective in confirming chromosome damage and in determining the intrinsic sensitivity of cells to genotoxicants. Interaction of MX and MC-LR in induction of MNi was examined in CHO-K1 cells by fractional analysis. Cell exposure to MC-LR alone did not significantly increase the rate of MNi, NBUDs, and NPBs, as noted previoulsy.43 MX alone (5−20 μM) significantly increased the rate of MNi in a concentrationdependent manner. Although the observed MNi rates in tested combinations were significantly lower than values predicted from the effect−addition model (27.3‰ for binary mixture: 10 μM MX with 5 μM MC-LR; 41.1‰ for binary mixture: 20 μM
■
RESULTS Cytotoxicity of MX and MC-LR. MX alone or in combination with MC-LR markedly reduced the cell survival 1680
dx.doi.org/10.1021/es304541a | Environ. Sci. Technol. 2013, 47, 1678−1687
Environmental Science & Technology
Article
Figure 2. (A) Effect of single and combined treatment of MX and MC-LR on the revertants in two strains of Salmonella typhimurium in the absence of S9 (Revertants/plate ± SE). The concentrations of MX were 0, 0.1, 0.2, 0.3, and 0.4 nmol/plate and of MC-LR were 0, 0.1, and 1.0 nmol/plate. Data are mean ± SE of independent experiments. Solid red lines express predicted effects calculated according to effect−addition model. *Indicates values significantly different from the effect−addition model (Student’s t test, P < 0.05). #Samples with values above black dashed line were considered positive. (B) Micronucleus assay of CHO-K1 cells after 24 h exposure to binary mixtures: MX (0, 5, 10, 20 μM) with MC-LR (0, 5 μM). Upper, middle, and bottom subfigures represent micronucleus rate, nucleoplasmic bridges rate, and nuclear buds rate, respectively. Data are mean ± SE of independent experiments. Solid red lines express predicted effects calculated according to effect−addition model. #Values above the black dashed line were significantly different from negative control (ANOVA followed by Bonferroni t test, P < 0.05). *Indicates values significantly different from the effect−addition model (Student’s t test, P < 0.05). (C) Comet assay of MX and MC-LR treated CHO cells. The cells were exposed to MX (0, 5, 10, 20 μM) and MC-LR (0, 0.5, 5 μM) for 24 h. The levels of DNA strand breaks are expressed as the percentage of tail DNA. Fifty cells were analyzed per experimental point in each of two independent experiments. Data are presented as quintile box plots. The edges of the box represent the 25th and 75th percentiles, the median is a solid line through the box, and the error bars represent the 95% confidence intervals. Solid red lines express predicted effects calculated according to effect−addition model. *Indicates values significantly different from the effect− addition model (Kruskal−Wallis test, P < 0.05).
MX with 5 μM MC-LR), the NPBs rates and NBUDs rates (except for binary mixture: 20 μM MX with 5 μM MC-LR) were significantly higher than values predicted from the effect− addition model (for NPBs rates: 0.52‰, 1.64‰, and 3.36‰ in binary mixtures of 5, 10, and 20 μM MX with 5 μM MC-LR; for NBUDs rates: 3.16‰ and 5.62‰ in binary mixtures of 5 and 10 μM MX with 5 μM MC-LR); that is, the exposure of CHO cells to MC-LR in mixture with MX resulted in a greater than additive effect on NBUDs and NPBs formation (Figure 2B). Comet Assay. The comet assay evaluated the DNA damage of CHO cells induced by MX and MC-LR independently or combined. There were significant differences of the percentages of tail DNA for MX, depending on the coexposures with MCLR (Figure 2C). Increases in percent tail DNA were observed in the 600 μmol/L H2O2 group (data not shown) that served as a positive control. The average of percent tail DNA induced by the two chemicals together was higher than the sum of the
average of percent tail DNA induced by either one alone. Concurrent exposure to both MX and MC-LR likely produces a more than additive effect on DNA damage measured in the comet assay. MX and MC-LR Induced ROS Formation in CHO-K1 Cells. To explore the mechanism of enhanced genotoxicity by the combination of MX and MC-LR, we examined the level of ROS in CHO cells. Intracellular H2O2 was detected by a flow cytometer using the fluorescent probe DCFH-DA, with DCF fluorescence intensity proportional to the amount of intracellular ROS. Coexposure to MX and MC-LR statistically significantly increased fluorescence intensity compared with exposure to either compound alone (Figure 3A1), suggesting a stimulatory effect of combined exposure of MX and MC-LR on free radical production. Intracellular superoxide anion is the main source of cellular oxidative stress and considered to play a role in various pathologies in animal and humans. Compared with the negative 1681
dx.doi.org/10.1021/es304541a | Environ. Sci. Technol. 2013, 47, 1678−1687
Environmental Science & Technology
Article
Figure 3. (A1) In situ labeling of ROS. CHO cells exposed to different treatments for 24 h were smeared on a slide. ROS production was evaluated by staining the cells with DCFH-DA. Images were acquired by laser confocal microscope (FluoView 1000) at an excitation of 488 nm and an emission of 525 nm representative micrograph. (A) control; (B) 0.05 μM MC-LR; (C) 20 μM MX; (D) 0.05 μM MC-LR + 20 μM MX; magnification 400×. (A2) Intracellular H2O2 levels in CHO cells were stained with DCFH-DA and analyzed by flow cytometry. The DCF mean fluorescent intensity in MX treated cells was substantially increased. Coculture with MX-LR effectively promoted MX-induced increase of H2O2 in CHO cells. *Significant difference between MC-LR treated groups and MC-LR nontreated group with the same concentration of MX (one-way ANOVA, Bonferroni, P < 0.05). Coexposure to MX and MC-LR had more of an effect on intracellular H2O2 than exposure to each compound alone, but there were no statistic interactions between MX and MC-LR on H2O2 in CHO cells examined (two-way ANOVA, P = 0.64). (A3) Intracellular superoxide anion (O2·−) levels in CHO cells were stained with DHE and analyzed by flow cytometry. Bars show the mean values and standard errors (M ± SE) of three independent experiments in duplicate. *Significant difference between MC-LR treated groups and MC-LR nontreated group with the same concentration of MX (one-way ANOVA, Bonferroni, P < 0.05). Co-exposure to MX and MC-LR (0.25 μM) had more of an effect on intracellular superoxide anion than exposure to each compound alone, but there were no statistic interactions between MX and MC-LR on superoxide anion in CHO cells examined (two-way ANOVA, P = 0.095). (B1) Intracellular SOD activity of CHO-K1 cells treated with different doses of MX and MC-LR. The concentrations of MX were 0, 5, and 20 μM and of MC-LR were 0, 0.001, 0.0025, 0.005, 0.01, 0.025, 0.05, 0.1, 0.25, and 0.5 μM. SOD activity was expressed as the inhibition rate percent per 20 μg of protein. The SOD levels in CHO-K1 cells were normalized by the cell number. Coexposure to MX and MC-LR had more of an effect on intracellular SOD than exposure to each compound alone, but there were no statistic interactions between MX and MC-LR on SOD in CHO cells examined (two-way ANOVA, P = 0.37). (B2) Intracellular catalase levels. MX and MC-LR were loaded at concentrations of 0, 5, and 20 μM and 0, 0.005, 0.05, and 0.25 μM, respectively, prior to cell harvest. *Significant difference between MC-LR treated groups and MC-LR nontreated group with the same concentration of MX (one-way ANOVA, Bonferroni, P < 0.05). Coexposure to MX and MC-LR had more of an effect on intracellular catalase than exposure to each compound alone, and there were statistic interactions between MX and MC-LR on catalase in CHO cells examined (two-way ANOVA, P < 0.01). (B3) Intracellular GSH levels. MX and MCLR were loaded at concentrations of 0, 5, and 20 μM and 0, 0.005, 0.05, and 0.25 μM for 24 h, respectively, prior to cell harvest. *Significant difference between MC-LR treated groups and MC-LR nontreated group with the same concentration of MX (one-way ANOVA, Bonferroni, P < 0.05). Coexposure to MX and MC-LR had more of an effect on intracellular GSH than exposure to each compound alone, but there were no statistic interactions between MX and MC-LR on GSH in CHO cells examined (two-way ANOVA, P = 0.90). (B4) Observation of the time course for GSH in cells treated with MC-LR and MX. CHO-K1 cells were incubated with F-12K culture media containing MC-LR (doses from 0 to 0.25 μM) and MX (dose from 0 to 20 μM). After each toxin treatment for 0.5, 1, 2, 3, 4, 8, 16, and 24 h, the medium was removed and intracellular GSH was determined. (C) Effects of MX and MC-LR coexposure on the Luc activity of CHO cells. The concentrations of MX were 0, 5, and 20 μM and of MC-LR were 0, 0.005, 0.05, and 0.25 μM. Luc activity was normalized by MTT assay, and results were expressed relative to the control. Data are shown as mean ± SE (n = 3 per treatment group). Solid red lines express predicted effects calculated according to the effect−addition model. *Indicates values significantly different from the effect−addition model (Student’s t test, P < 0.05). #Samples with values above the black dashed line were considered positive.
control, a significant increase of average fluorescence intensity was observed in cells treated with single 20 μM MX and 0.05
μM MC-LR (by 24.3% and 34.3%, respectively, P < 0.05), while the coexposure of MX and MC-LR sharpened this increase to 1682
dx.doi.org/10.1021/es304541a | Environ. Sci. Technol. 2013, 47, 1678−1687
Environmental Science & Technology
■
54.2%, but there were no significant interaction between MX and MC-LR on H2O2 in CHO cells examined (P = 0.64) (Figure 3A2). Furthermore, coexposure of MC-LR at 0.005− 0.05 μM did not alter MX induced intracellular superoxide anion levels, while MC-LR at 0.25 μM sharpened MX induced superoxide anion. However, high concentrations of MX and MC-LR administered jointly reduced the superoxide anion levels (Figure 3A3). Antioxidant Enzymes and GSH Level in CHO Cells Induced by MX and MC-LR. To determine whether oxidative stress was involved in the cytoprotection afforded by MC-LR with MX exposures, we determined levels of antioxidant enzymes (SOD, catalase) and GSH levels in CHO-K1 cells. After pretreatment with different concentrations of MX and MC-LR for 24 h, intracellular SOD levels demonstrated that coexposure to MX and MC-LR had more effect on intracellular SOD than exposure to either compound alone (Figure 3B1). Significant increases of SOD levels were observed in cells treated with single 20 μM MX or 0.05 μM MC-LR (by 2.03and 1.85-fold, respectively, P < 0.05), while the coexposure of MX and MC-LR raised this increase to 3.89-fold. There were no statistic interactions between MX and MC-LR on SOD in CHO cells (P = 0.37). As for catalase, after treated cells with MX and MC-LR together, the intracellular level of catalase was further increased, compared with either compound alone (Figure 3B2). There was statistically significant interaction between MX and MC-LR on catalase in CHO cells examined (P < 0.01). The average of catalase induced by the combination of the two chemicals was less than the sum of catalase induced by the single compounds, suggesting that the concurrent presence of MX and MC-LR induces a less than additive effect. Both MX and MC-LR singly treated cells significantly increased the GSH levels compared with controls, while the increasing of GSH activities were more pronounced in coexposure of MX and MC-LR (Figure 3B3). Cells exposed to 0.25 μM MC-LR significantly increased the GSH levels compared to the MC-LR nontreated group with the same concentration of MX (P < 0.05), but there was no significant interaction between MX and MC-LR on GSH in CHO cells (P = 0.90). We also examined the time course for GSH in cells treated with the different concentrations of MX and MC-LR. Both MX and MC-LR alone or in combination caused initial depletion at the first 0−2 h with subsequent increases, likely due to activation of GSH synthesis (Figure 3B4). Luc Activity of CHO Cells Exposed to MX and MC-LR. The activity of the luciferase ARE reporter is an effective tool for screening potential antioxidants. To determine the activity of the antioxidant response signal transduction pathway in treated cells, we assessed the activity of the luciferase ARE reporter. CHO cells stably transfected with the ARE reporter showed a dose-dependent induction of activity after MX and MC-LR treatment, showing that the cells activate ARE after exposure to either of these two water contaminants (Figure 3C). Notably, the ARE activities of cells treated with 20 μM MX and 0.05−0.25 μM MC-LR were significantly higher than values predicted from the effect−addition model; that is, the exposure of CHO cells to MC-LR in mixture with MX resulted in a greater than additive effect on antioxidant response signal transduction pathway.
Article
DISCUSSION
Combined Effects. Industrialization, intensive agriculture, and global warming have increased water eutrophication and the frequency of cyanobacterial blooms. General procedures for water treatment to control pathogens simultaneously have increased exposures to disinfection byproducts.44 We are unaware of studies to assess the possible effects of MX and MCs in combination. We selected MC-LR, which is the strongest MC toxin and a liver tumor promoter, and MX as a representative DBP to take the first step to evaluate combined genotoxic actions in CHO cells, using several standard assays, and we examined possible mechanisms by which these classes of compounds may interact. Toxicants may interact to produce additive, synergistic, or antagonistic responses. The treatment of CHO cells with increasing concentrations of MC-LR actually caused a slight shift in the MX dose−response curve to the right with an increase in cell viability. While this shift indicates some antagonistic (protective) effect, the magnitude was small. From our other results, it is possible that the antagonism may be related to the ability of MC-LR to activate antioxidant responses and provide some level of protection from the cytotoxicity of MX. In fact, our results on the short-term cytotoxicity of MX do differ from those in a previous study.45 Because oxidative stress plays an important role in the mechanism of MX’s cytotoxicity and genotoxicity,25,26 the repair of damage induced by oxidative stress may not be completed in these short exposures that led to increased cytotoxic effect. It was reported that pretreating RAW cells with Nrf2 activators tBHQ or HOCl for 6 h prior to 24 h of HOCl exposure resulted in a remarkable increase of LC50.46 In contrast to the cytotoxicity results, the combination effect of MX and MC-LR significantly increased the mutagenicity in Salmonella thyphimurium, NUBDs and NPBs rates, and DNA damage in CHO cells. Many of the observed interactions were significantly greater than those predicted from the effect− additivity model. This result provides the first evidence of possible genotoxic interaction between MX and MC-LR. The CBMN assay is a well-established method, measuring several chromosomal alterations. MNi serve as a biomarker of chromosome breakage and/or whole chromosome loss. The NPBs indicate DNA misrepair, chromosome rearrangement, or telomere end-fusions. Because the nuclear budding process is the mechanism by which cells remove amplified and/or excess DNA, this end point serves as a marker of gene amplification and/or altered gene dosage.47 Compared to MNi, the NPBs originate from dicentric chromosomes and centric ring chromosomes, with low background level, and could provide a valuable measure of chromosome breakage/rearrangement.48 In terms of clinical significance in human disease, bridging of telomere-deficient chromosomes appears to be a major mutational mechanism in colorectal cancer.49 When using the CBMN assay result to predict cancer risk, probabilities of being a cancer patient were 96%, 98%, and 100% based on the 95th percentiles of spontaneous and NNK-induced MNi, NPBs, and NBUDs, respectively. Thus, NPBs and NBUDs rate may be more sensitive biomarkers than MNi during chemical carcinogenesis.50 Our result with CBMN showed that the observed MNi rates were significantly lower for the combination than values predicted from the effect−addition model, while the NPBs and NBUDs rate were significantly higher than values predicted from the effect-addition model. Once again, the 1683
dx.doi.org/10.1021/es304541a | Environ. Sci. Technol. 2013, 47, 1678−1687
Environmental Science & Technology
Article
increase after exposure to MX and MC-LR for 24 h either alone or in combination. Coexposure to MX and MC-LR demonstrated a larger effect on intracellular GSH than treatment with either compound by itself; however, the GSH level induced by the combination was less than expected due to additivity. In order to see whether GSH level changes as the exposure time goes by and whether the time courses for GSH are similar for both contaminants, we examined the time courses for GSH in cells treated with various concentrations of MX and MC-LR. Both MX and MC-LR alone or in combination caused initial depletion at the first 0−2 h with subsequent increases due to activation of synthesis. There was no statistical difference between MX/MC-LR treated alone and in combination as the exposure time was below 4 h, but for longer treatment time, coexposure to MX and MC-LR demonstrated a higher intracellular GSH level than either compound alone. Antioxidant genes responsible for encoding antioxidant/ detoxification enzymes are coordinately regulated through consensus cis-acting elements called antioxidant response elements (AREs) in their 5′-flanking promoter regions.62 Luciferase ARE activities of CHO cells treated with 20 μM MX and 0.05−0.25 μM MC-LR were significantly higher than values predicted from the effect−addition model, indicating that the exposure of CHO cells to MC-LR in mixture with MX resulted in a greater than additive effect on antioxidant response signal transduction pathway and on the intracellular ROS/prooxidant levels. This result was consistence with the combined effect of MX and MC-LR on genotoxicity; the luciferase ARE reporter assay might serve as a more sensitive sentinel in the assessment of early oxidative stress than antioxidant enzymes. Under normal physiological conditions, intracellular ROS are major signaling molecules that are regulated through various cellular antioxidants.63 Under stress conditions, these antioxidant (GSH, SOD, and catalase) defense mechanisms play major roles in converting the ROS into nonreactive molecules.64 However, it now appears that overexpression of ROS can result in reduced antioxidant protection, breakdown of functional biomolecules into unusable byproducts, and a cascade of events causing oxidative stress, genomic instability and apoptosis, or unregulated cellular growth stimulation (cancer).65 In our study, MX and MC-LR administrated jointly at noncytotoxic concentrations showed responses greater than those expected from an effects−addition model for the Ames test, the MNi assay, and the comet assay. We did not find greater than additive effects for ROS at the higher treatment levels where mixtures of MX and MC-LR caused a less than additive effect on oxidative stress. The regulation of oxidative stress and ROS may produce factors that themselves have adverse consequences for DNA integrity at the higher MX/ MC-LR concentrations. Our studies of oxidative stress responses provide a possible explanation for the interactions of MX and MC-LR on genotoxicity. Treatment of the cells with either MX23,26 or MC-LR22,66 increases certain measures of oxidative stress. The modes of action of the two compounds in affecting markers of oxidative stress may well differ. MC-LR caused increases in catalase, SOD, and GSH levels but did enhance ARE-mediated luciferase upregulation. In contrast, the responses to MX are more consistent with canonical oxidative stress: catalase, SOD, GSH, and ARE-driven luciferase were all increased. The MCLR may enhance oxidative stress during coexposure through
NPBs and NBUDs rate may be more sensitive markers for assessing the genotoxicity of MX and MC-LR than the MNi formation rate. The comet assay is generally considered a sensitive method for assessing DNA damage by genotoxic agents with evidence showing that it is more specific than other in vitro genotoxicity tests and less prone to false positives.51 The comet assay is based on electrophoresis of cells embedded and lysed in agarose on a microscope slide. The increased comet tail with DNA-damaging agents occurs because the DNA usually present in large supercoiled structures becomes disrupted by strand breaks.52 Our study showed that concurrent exposure to both MX and MC-LR produced a more than additive effect on DNA damage measured in the comet assay. Combined with our other results of measures of ROS, it is likely that enhanced oxidative stress might be the mechanism for altered electrophoretic mobility in the comet assay induced by MX and MC-LR coexposure. Oxidative Stress. Oxidative stress occurs when the production of cellular ROS exceeds the antioxidant capability of the target cell. The intracellular ROS of CHO cells treated with 0 and 0.005 μM MC-LR alone was not changed significantly from the control but increased significantly after exposure to 0.05−0.5 μM MC-LR alone, an observation noted previously53,54 In this study, coexposure to low doses of MX and MC-LR significantly increased the fluorescence intensity compared with exposure to either compound alone, suggesting a stimulatory effect of combined exposure of MX and MC-LR on free radical production. With coexposure to higher doses of MX and MC-LR, the fluorescence intensity decreased compared with exposure to either compound alone, suggesting that the dose−response curve of ROS with these mixtures was nonlinear, likely related to more complex dose-dependent interactions between oxidant and antioxidant enzymes. Biphasic dose−response curves are known for ROS from other studies. For instance, the action of Hg2+ and Cd2+ stimulated ROS generation within the in rat hepatoma AS-30D cells at low concentrations but decreased ROS generation at higher concentrations.55 Eugenol also caused biphasic ROS production characterized by enhancement at lower concentrations (5− 10 μM) and decrease at higher concentrations (500 μM).56 A possible explanation of these more complex dose−response curves is that chemicals may have both pro-oxidant activity and antioxidant activity on cells with different concentrations.57 Furthermore, the activities of SOD and catalase and the levels of GSH in CHO cells coexposed to MX and MC-LR were determined, since the changes in these enzymes activities and GSH level indirectly indicate the overall activity of the antioxidant capabilities of the cells. SOD and catalase in cellular antioxidant systems are important in the elimination of excess ROS in living organisms. Excessive superoxide radical is converted to hydrogen peroxide by SOD and to water by catalase.58 Consistent with previous studies,22,59,60 the antioxidant enzymes levels increased with treatment with either MX or MC-LR alone. Notably, SOD and catalase induced by the combination of the two chemicals were lower than expected based on the sum of the increases of the single treatment; this could be related to an early increase in their scavenger activity corresponding to a limited damage induced by MX and MC-LR alone. GSH is responsible for defending against cellular injuries induced by ROS. Its de novo and salvage syntheses serve to maintain a reduced cellular environment.61 Here, we found that the intracellular level of GSH showed a dose-dependent 1684
dx.doi.org/10.1021/es304541a | Environ. Sci. Technol. 2013, 47, 1678−1687
Environmental Science & Technology
Article
(7) Yeatts, S. D.; Gennings, C.; Wagner, E. D.; Simmons, J. E.; Plewa, M. J. Detecting departure from additivity along a fixed-ratio mixture ray with a piecewise model for dose and interaction thresholds. J. Agric. Biol. Environ. Stat. 2010, 15 (4), 510−522. (8) Stork, L. G.; Gennings, C.; Carter, W. H.; Johnson, R. E.; Mays, D. P.; Simmons, J. E.; Wagner, E. D.; Plewa, M. J. Testing for additivity in chemical mixtures using a fixed-ratio ray design and statistical equivalence testing methods. J. Agric. Biol. Environ. Stat. 2007, 21 (4), 514−533. (9) Backlund, P.; Kronberg, L.; Tikkanen, L. Formation of Ames mutagenicity and of the strong bacterial mutagen 3-chloro-4(dichloromethyl)-5-hydroxy-2(5H)-furanone and other halogenated compounds during disinfection of humic water. Chemosphere 1988, 17 (7), 1329−1336. (10) Ross, C.; Santiago-Vazquez, L.; Paul, V. Toxin release in response to oxidative stress and programmed cell death in the cyanobacterium Microcystis aeruginosa. Aquat. Toxicol. 2006, 78 (1), 66−73. (11) Zamyadi, A.; Ho, L.; Newcombe, G.; Bustamante, H.; Prévost, M. Fate of toxic cyanobacterial cells and disinfection by-products formation after chlorination. Water Res. 2012, 46 (5), 1524−1535. (12) Mäki-Paakkanen, J.; Hakulinen, P. Assessment of the genotoxicity of the rat carcinogen 3-chloro-4-(dichloromethyl)-5hydroxy-2(5H)-furanone (MX) in rat liver epithelial cells in vitro. Toxicol. In Vitro 2008, 22 (2), 535−540. (13) Hakulinen, P.; Yamamoto, A.; Koyama, N.; Kumita, W.; Yasui, M.; Honma, M. Induction of TK mutations in human lymphoblastoid TK6 cells by the rat carcinogen 3-chloro-4-(dichloromethyl)-5hydroxy-2(5H)-furanone (MX). Mutat. Res. 2011, 725 (1−2), 43−49. (14) Zhang, L.; Xu, L.; Zeng, Q.; Zhang, S. H.; Xie, H.; Liu, A.; Lu, W. Q. Comparison of DNA damage in human-derived hepatoma line (HepG2) exposed to the fifteen drinking water disinfection byproducts using the single cell gel electrophoresis assay. Mutat. Res. 2012, 741 (1−2), 89−94. (15) Komulainen, H. Experimental cancer studies of chlorinated byproducts. Toxicology 2004, 198 (1−3), 239−248. (16) Komulainen, H.; Kosma, V. M.; Vaittinen, S. L.; KalisteKorhonen, E.; Lotjonen, S.; Tuominen, R. K.; Tuomisto, J. Carcinogenicity of the drinking water mutagen 3-chloro-4-(dichloromethyl)-5-hydroxy-2(5H)-furanone in the rat. J. Natl. Cancer Inst. 1997, 89 (12), 848−856. (17) Ding, W. X.; Shen, H. M.; Zhu, H. G.; Lee, B. L.; Ong, C. N. Genotoxicity of microcystic cyanobacteria extract of a water source in China. Mutat. Res. 1999, 442 (2), 69−77. (18) Teixeira, M. G.; Costa, M. C.; de Carvalho, V. L.; Pereira, M. S.; Hage, E. Gastroenteritis epidemic in the area of the Itaparica Dam, Bahia, Brazil. Bull. Pan Am. Health Organ. 1993, 27 (3), 244−253. (19) Zhou, L.; Yu, H.; Chen, K. Relationship between microcystin in drinking water and colorectal cancer. Biomed. Environ. Sci. 2002, 15 (2), 166−171. (20) Yu, S. Z.; Huang, X. E.; Koide, T.; Cheng, G.; Chen, G. C.; Harada, K.; Ueno, Y.; Sueoka, E.; Oda, H.; Tashiro, F.; Mizokami, M.; Ohno, T.; Xiang, J.; Tokudome, S. Hepatitis B and C viruses infection, lifestyle and genetic polymorphisms as risk factors for hepatocellular carcinoma in Haimen. China. Jpn. J. Cancer Res. 2002, 93 (12), 1287− 1292. (21) Krüger, T.; Christian, B.; Luckas, B. Development of an analytical method for the unambiguous structure elucidation of cyclic peptides with special appliance for hepatotoxic desmethylated microcystins. Toxicon 2009, 54 (3), 302−312. (22) Li, Y.; Chen, J. A.; Zhao, Q.; Pu, C.; Qiu, Z.; Zhang, R.; Shu, W. A cross-sectional investigation of chronic exposure to microcystin in relationship to childhood liver damage in the Three Gorges Reservoir Region, China. Environ. Health Perspect. 2011, 119 (10), 1483−1488. (23) Zhan, L.; Sakamoto, H.; Sakuraba, M.; Wu, D. S.; Zhang, L. S.; Suzuki, T.; Hayashi, M.; Honma, M. Genotoxicity of microcystin-LR in human lymphoblastoid TK6 cells. Mutat. Res. 2004, 557 (1), 1−6. (24) Zegura, B.; Volcic, M.; Lah, T. T.; Filipic, M. Different sensitivities of human colon adenocarcinoma (CaCo-2), astrocytoma
secondary mechanisms not directly related to ARE-mediated responses. Perspectives. To the best of our knowledge, this is the first investigation to study a toxicological interaction of MX and MC-LR. Surprisingly, we found that MC-LR (which lacks genotoxicity under the test conditions) enhanced the dosedependent genotoxicity of MX. Our subsequent results indicated that MC-LR may increase MX genotoxicity through alteration in oxidative stress signaling. For further confirmation of whether MC-LR enhances MX genotoxicity via an oxidative stress-related mechanism, genotoxicity of cells treated with antioxidants such as BHA or catalase should be examined.
■
AUTHOR INFORMATION
Corresponding Author
*Phone: 86-21-54237203 (W.Q.). Fax: 86-21-64045165 (W.Q.). E-mail:
[email protected] (W.Q.); gshe@shmu. edu.cn (G.H.). Author Contributions ∥
These authors contributed equally to this work.
Notes
The authors declare no competing financial interest.
■
ACKNOWLEDGMENTS This project was supported by National Natural Science Foundation of China (30972438), National Key Technology R&D Program in the 11th Five Year Plan (2006BAI19B02), Discipline Pioneer Plan for Bureau of Health in Shanghai (08GWD), Dawn Scholar Plan in Shanghai (07SG01), Nonprofit Foundation of National Health Ministry in the 12th Five Year Plan (201002001 and 2012BAJ25B05), and National High-Tech R&D 863 Program of China (2013AA065204). The authors are gratefully appreciative of three anonymous reviewers for many useful suggestions.
■
REFERENCES
(1) Villanueva, C. M.; Castaño-Vinyals, G.; Moreno, V.; CarrascoTurigas, G.; Aragonés, N.; Boldo, E. Concentrations and correlations of disinfection by-products in municipal drinking water from an exposure assessment perspective. Environ. Res. 2012, 114, 1−11. (2) Greenlee, A. R.; Ellis, T. M.; Berg, R. L. Low-dose agrochemicals and lawn-care pesticides induce developmental toxicity in murine preimplantation embryos. Environ. Health Perspect. 2004, 112 (6), 703−709. (3) Simmons, J. E.; Richardson, S. D.; Speth, T. F.; Miltner, R. J.; Rice, G.; Schenck, K. M.; Hunter, E. S., III; Teuschler, L. K. Development of a research strategy for integrated technology-based toxicological and chemical evaluation of complex mixtures of drinking water disinfection byproducts. Environ. Health Perspect. 2002, 110 (suppl 6), 1013−1024. (4) Simmons, J. E.; Richardson, S. D.; Teuschler, L. K.; Miltner, R. J.; Speth, T. F.; Schenck, K. M.; Hunter, E. S., III; Rice, G. Research issues underlying the four-lab study: integrated disinfection byproducts mixtures research. J. Toxicol. Environ. Health, Part A 2008, 71 (17), 1125−1132. (5) Andrews, J. E.; Nichols, H. P.; Schmid, J. E.; Mole, L. M.; Hunter, E. S., III; Klinefelter, G. R. Developmental toxicity of mixtures: the water disinfection by-products dichloro-, dibromo- and bromochloro acetic acid in rat embryo culture. Reprod. Toxicol. 2004, 19 (1), 111− 116. (6) Zhang, X.; Bull, R. J.; Fisher, J.; Cotruvo, J. A.; Cummings, B. S. The synergistic effect of sodium chlorite and bromochloroacetic acid on BrO3−-induced renal cell death. Toxicology 2011, 289 (2−3), 151− 159. 1685
dx.doi.org/10.1021/es304541a | Environ. Sci. Technol. 2013, 47, 1678−1687
Environmental Science & Technology
Article
(IPDDC-A2) and lymphoblastoid (NCNC) cell lines to microcystinLR induced reactive oxygen species and DNA damage. Toxicon 2008, 52 (3), 518−525. (25) Zhang, D. W.; Xie, P.; Liu, Y. Q.; Qiu, T. Transfer, distribution and bioaccumulation of microcystins in the aquatic food web in Lake Taihu, China, with potential risks to human health. Sci. Total Environ. 2009, 407 (7), 2191−2199. (26) Athens, G. The Occurrence of Disinfection By-Products (DBPs) of Health Concern in Drinking Water: Results of a Nationwide DBP Occurrence Study; National Exposure Research Laboratory, Office of Research and Development, U.S. EPA: Las Vegas, NV, 2002. (27) Chen, Y. M.; Lee, T. H.; Lee, S. J.; Huang, H. B.; Huang, R.; Chou, H. N. Comparison of protein phosphatase inhibition activities and mouse toxicities of microcystins. Toxicon 2006, 47 (7), 742−746. (28) Mortelmans, K.; Zeiger, E. The Ames Salmonella/microsome mutagenicity assay. Mutat. Res. 2000, 455 (1−2), 29−60. (29) Amado, L. L.; Monserrat, J. M. Oxidative stress generation by microcystins in aquatic animals: why and how. Environ. Int. 2010, 36 (2), 226−235. (30) Jiang, J.; Gu, X.; Song, R.; Wang, X.; Yang, L. Microcystin-LR induced oxidative stress and ultrastructural alterations in mesophyll cells of submerged macrophyte Vallisneria natans (Lour.) Hara. J. Hazard. Mater. 2011, 190 (1−3), 188−196. (31) Zeni, O.; Salvemini, F.; Di Pietro, R.; Buonincontri, D.; Komulainen, H.; Romano, M.; Scarfi, M. R. Induction of oxidative stress in murine cell lines by 3-chloro-4-(dichloromethyl)-5-hydroxy2(5H)-furanone (MX). Toxicol. Lett. 2004, 147 (1), 79−85. (32) Yuan, J.; Liu, H.; Zhou, L. H.; Zou, Y. L.; Lu, W. Q. Oxidative stress and DNA damage induced by a drinking-water chlorination disinfection byproduct 3-chloro-4-(dichloromethyl)-5-hydroxy-2(5H)furanone (MX) in mice. Mutat. Res. 2006, 609 (2), 129−136. (33) Pi, J.; He, Y.; Bortner, C.; Huang, J.; Liu, J.; Zhou, T.; Qu, W.; North, S. L.; Kasprzak, K. S.; Diwan, B. A.; Chignell, C. F.; Waalkes, M. P. Low level, long-term inorganic arsenite exposure causes generalized resistance to apoptosis in cultured human keratinocytes: potential role in skin co-carcinogenesis. Int. J. Cancer 2005, 116 (1), 20−26. (34) Sgro, L. A.; Simonelli, A.; Pascarella, L.; Minutolo, P.; Guarnieri, D.; Sannolo, N.; Netti, P.; D’Anna, A. Toxicological properties of nanoparticles of organic compounds (NOC) from flames and vehicle exhausts. Environ. Sci. Technol. 2009, 43 (7), 2608−2613. (35) Fenech, M. Cytokinesis-block micronucleus cytome assay. Nat Protoc. 2007, 2 (5), 1084−1104. (36) Tice, R. R.; Agurell, E.; Anderson, D.; Burlinson, B.; Hartmann, A.; Kobayashi, H.; Miyamae, Y.; Rojas, E.; Ryu, J. C.; Sasaki, Y. F. Single cell gel/comet assay: guidelines for in vitro and in vivo genetic toxicology testing. Environ. Mol. Mutagen. 2000, 35 (3), 206−221. (37) Rothe, G.; Valet, G. Flow cytometric analysis of respiratory burst activity in phagocytes with hydroethidine and 2′,7′-dichlorofluorescin. J. Leukocyte Biol. 1990, 47 (5), 440−448. (38) Cakmak, I.; Marschner, H. Magnesium deficiency and high light intensity enhance activities of superoxide dismutase, ascorbate peroxidase, and glutathione reductase in bean leaves. Plant Physiol. 1992, 98 (4), 1222−1227. (39) Woods, C. G.; Fu, J.; Xue, P.; Hou, Y.; Pluta, L. J.; Yang, L.; Zhang, Q.; Thomas, R. S.; Andersen, M. E.; Pi, J. Dose-dependent transitions in Nrf2-mediated adaptive response and related stress responses to hypochlorous acid in mouse macrophages. Toxicol. Appl. Pharmacol. 2009, 238 (1), 27−36. (40) Berenbaum, M. C. What is synergy. Pharmacol. Rev. 1989, 41 (2), 93−141. (41) Lee, J. J.; Kong, M.; Ayers, G. D.; Lotan, R. Interaction index and different methods for determining drug interaction in combination therapy. J. Biopharm. Stat. 2007, 17 (3), 461−480. (42) Repavich, W. M.; Sonzongni, W. C.; Standridge, J. H.; Wedephohl, R. E.; Meisner, L. F. Cyanobacteria (blue-green algae) in Wisconsin waters: acute and chronic toxicity. Water Res. 1990, 24 (2), 225−231.
(43) Abramsson-Zetterberg, L.; Sundh, U. B.; Mattsson, R. Cyanobacterial extracts and microcystin-LR are inactive in the micronucleus assay in vivo and in vitro. Mutat. Res. 2010, 699 (1− 2), 5−10. (44) Neale, P. A.; Antony, A.; Bartkow, M. E.; Farré, M. J.; Heitz, A.; Kristiana, I.; Tang, J. Y.; Escher, B. I. Bioanalytical assessment of the formation of disinfection byproducts in a drinking water treatment plant. Environ. Sci. Technol. 2012, 46 (18), 10317−10325. (45) Plewa, M. J.; Kargalioglu, Y.; Vankerk, D.; Minear, R. A.; Wagner, E. D. Mammalian cell cytotoxicity and genotoxicity analysis of drinking water disinfection by-products. Environ. Mol. Mutagen. 2002, 40 (2), 134−142. (46) Pi, J.; Zhang, Q.; Woods, C. G.; Wong, V.; Collins, S.; Andersen, M. E. Activation of Nrf2-mediated oxidative stress response in macrophages by hypochlorous acid. Toxicol. Appl. Pharmacol. 2008, 226 (3), 236−243. (47) Fenech, M. Cytokinesis-block micronucleus assay evolves into a “cytome” assay of chromosomal instability, mitotic dysfunction and cell death. Mutat. Res. 2006, 600 (1−2), 58−66. (48) Thomas, P.; Umegaki, K.; Fenech, M. Nucleoplasmic bridges are a sensitive measure of chromosome rearrangement in the cytokinesisblock micronucleus assay. Mutagenesis 2003, 18 (2), 187−194. (49) Stewénius, Y.; Gorunova, L.; Jonson, T.; Larsson, N.; Höglund, M.; Mandahl, N.; Mertens, F.; Mitelman, F.; Gisselsson, D. Structural and numerical chromosome changes in colon cancer develop through telomere-mediated anaphase bridges, not through mitotic multipolarity. Proc. Natl. Acad. Sci. U.S.A. 2005, 102 (15), 5541−5546. (50) El-Zein, R. A.; Schabath, M. B.; Etzel, C. J.; Lopez, M. S.; Franklin, J. D.; Spitz, M. R. Cytokinesis-blocked micronucleus assay as a novel biomarker for lung cancer risk. Cancer Res. 2006, 66 (12), 6449−6456. (51) Burlinson, B. The in vitro and in vivo comet assays. Methods Mol. Biol. 2012, 817, 143−163. (52) Kassie, F.; Parzefall, W.; Knasmüller, S. Single cell gel electrophoresis assay: a new technique for human biomonitoring studies. Mutat. Res. 2000, 463 (1), 13−31. (53) Li, Y.; Han, X. Microcystin-LR causes cytotoxicity effects in rat testicular Sertoli cells. Environ. Toxicol. Pharmacol. 2012, 33 (2), 318− 326. (54) Sicińska, P.; Bukowska, B.; Michałowicz, J.; Duda, W. Damage of cell membrane and antioxidative system in human erythrocytes incubated with microcystin-LR in vitro. Toxicon 2006, 47 (4), 387− 397. (55) Belyaeva, E. A.; Dymkowska, D.; Wieckowski, M. R.; Wojtczak, L. Mitochondria as an important target in heavy metal toxicity in rat hepatoma AS-30D cells. Toxicol. Appl. Pharmacol. 2008, 231 (1), 34− 42. (56) Atsumi, T.; Fujisawa, S.; Tonosaki, K. A comparative study of the antioxidant/prooxidant activities of eugenol and isoeugenol with various concentrations and oxidation conditions. Toxicol. In Vitro 2005, 19 (8), 1025−1033. (57) Khan, N. S.; Ahmad, A.; Hadi, S. M. Anti-oxidant, pro-oxidant properties of tannic acid and its binding to DNA. Chem.−Biol. Interact. 2000, 125 (3), 177−189. (58) Mates, J. M. Effects of antioxidant enzymes in the molecular control of reactive oxygen species toxicology. Toxicology 2000, 153 (1−3), 83−104. (59) Chen, Y.; Zeng, S. F.; Cao, Y. F. Oxidative stress response in zebrafish (Danio rerio) gill experimentally exposed to subchronic microcystin-LR. Environ. Monit. Assess. 2011, 184 (11), 6775−6787. (60) Burmester, V.; Nimptsch, J.; Wiegand, C. Adaptation of freshwater mussels to cyanobacterial toxins: response of the biotransformation and antioxidant enzymes. Ecotoxicol. Environ. Saf. 2012, 78 (1), 296−309. (61) Townsend, D. M.; Tew, K. D.; Tapiero, H. The importance of glutathione in human disease. Biomed. Pharmacother. 2003, 57 (3), 145−155. 1686
dx.doi.org/10.1021/es304541a | Environ. Sci. Technol. 2013, 47, 1678−1687
Environmental Science & Technology
Article
(62) Kobayashi, M.; Yamamoto, M. Nrf2-Keap1 regulation of cellular defense mechanisms against electrophiles and reactive oxygen species. Adv. Enzyme Regul. 2006, 46 (1), 113−140. (63) Valko, M.; Leibfritz, D.; Moncol, J.; Cronin, M. T.; Mazur, M.; Telser, J. Free radicals and antioxidants in normal physiological functions and human disease. Int. J. Biochem. Cell Biol. 2007, 39 (1), 44−84. (64) Stahl, W.; Junghans, A.; de Boer, B.; Driomina, E. S.; Briviba, K.; Sies, H. Carotenoid mixtures protect multilamellar liposomes against oxidative damage: synergistic effects of lycopene and lutein. FEBS Lett. 1998, 427 (2), 305−308. (65) Halliwell, B.; Whiteman, M. Measuring reactive species and oxidative damage in vivo and in cell culture: how should you do it and what do the results mean? Br. J. Pharmacol. 2004, 142 (2), 231−255. (66) Ding, W. X.; Shen, H. M.; Ong, C. N. Microcystic cyanobacteria extract induces cytoskeletal disruption and intracellular glutathione alteration in hepatocytes. Environ. Health Perpect. 2000, 108 (7), 605− 609.
1687
dx.doi.org/10.1021/es304541a | Environ. Sci. Technol. 2013, 47, 1678−1687
