G-Quadruplex DNA- and RNA-Specific-Binding Proteins Engineered

Sep 11, 2015 - We report that Tyr- and Phe-containing proteins engineered from the TLS RGG domain selectively bind G-quadruplex DNA and RNA, respectiv...
0 downloads 10 Views 1MB Size
Download PDF
Articles pubs.acs.org/acschemicalbiology

G‑Quadruplex DNA- and RNA-Specific-Binding Proteins Engineered from the RGG Domain of TLS/FUS Kentaro Takahama,† Arisa Miyawaki,† Takumi Shitara,† Keita Mitsuya,‡ Masayuki Morikawa,§ Masaki Hagihara,‡ Katsuhito Kino,§ Ayumu Yamamoto,† and Takanori Oyoshi*,† †

Department of Chemistry, Graduate School of Science, Shizuoka University, 836 Ohya, Suruga, Shizuoka 422-8529, Japan Graduate School of Science and Technology, Hirosaki University, 3 Bunkyo-cho, Hirosaki, Aomori 036-8561, Japan § Kagawa School of Pharmaceutical Sciences, Tokushima Bunri University, 1314-1 Shido, Sanuki-shi, Kagawa 769-2193, Japan ‡

S Supporting Information *

ABSTRACT: Human telomere DNA (Htelo) and telomeric repeatcontaining RNA (TERRA) are integral telomere components containing the short DNA repeats d(TTAGGG) and RNA repeats r(UUAGGG), respectively. Htelo and TERRA form G-quadruplexes, but the biological significance of their G-quadruplex formation in telomeres is unknown. Compounds that selectively bind G-quadruplex DNA and RNA are useful for understanding the functions of each G-quadruplex. Here we report that engineered Arg-Gly-Gly repeat (RGG) domains of translocated in liposarcoma containing only Phe (RGGF) and Tyr (RGGY) specifically bind and stabilize the G-quadruplexes of Htelo and TERRA, respectively. Moreover, RGGF inhibits trimethylation of both histone H4 at lysine 20 and histone H3 at lysine 9 at telomeres, while RGGY inhibits only H3 trimethylation in living cells. These findings indicate that G-quadruplexes of Htelo and TERRA have distinct functions in telomere histone methylation.

L

epigenetic marks, trimethylation of histone H3 at lysine 9 (H3K9me3) and trimethylation of histone H4 at lysine 20 (H4K20me3), which are sequentially induced and regulate telomere length by inhibiting the alternative lengthening of telomeres (ALT) mechanism that maintains telomere length by recombination between telomeres.10,11 The biological significance of the G-quadruplexes of Htelo and TERRA in histone modifications at telomeres, however, remains unclear. To elucidate the roles of G-quadruplexes of Htelo and TERRA, it is important to distinguish the functions of each G-quadruplex. GQuadruplex-binding molecules that distinguish G-quadruplex DNA and RNA will be useful for distinguishing their unique functions. The negatively charged adduct derived from pyridostatin preferentially stabilizes the G-quadruplex of TERRA in comparison with the G-quadruplex of Htelo.12 Molecules that specifically bind to either G-quadruplex DNA or RNA, however, have not been reported. In the study presented here, we engineered the RGG domains of TLS to develop proteins that efficiently bind to G-quadruplex structures and distinguish G-quadruplex DNA and RNA. We report that Tyrand Phe-containing proteins engineered from the TLS RGG domain selectively bind G-quadruplex DNA and RNA, respectively. Using these proteins, we also revealed the different

ocal conformations of non-B-form secondary structures in nucleic acids, such as the G-quadruplex, Z-DNA, hairpins, and triplexes, are thought to have biological functions in vivo, such as replication, gene expression, and regulation.1 Functional studies of G-quadruplexes in DNA and RNA using molecules that bind to G-quadruplexes revealed that these molecules repress the transcriptional activity of the G-rich c-myc promoter and inhibit translation of mRNA with a 5′untranslated G-rich region.2,3 Moreover, the single-stranded G-rich 3′ overhang of telomeres, which cap the ends of linear eukaryotic chromosomes and comprise TTAGGG repeats, is maintained by telomerase, and G-quadruplex-binding molecules inhibit telomerase activity.2 Almost G-quadruplex binding molecules, however, are not able to distinguish G-quadruplex DNA and RNA. Such molecules are not suitable for investigating each of the biological functions of G-quadruplex DNA and RNA in vivo. Recently, we reported that a translocated in liposarcoma (TLS) protein (also called FUS) binds to G-quadruplex human telomere DNA (Htelo) and a telomeric repeat-containing RNA (TERRA), which is transcribed from telomeres and comprises tandem arrays of r(UUAGGG), and regulates histone modification at telomeres (Figure 1A).4−9 These findings suggest that G-quadruplexes of Htelo and TERRA are targets of molecules that modify telomeric histones. If the G-quadruplexes of Htelo and TERRA have distinct roles in telomere histone modifications, Gquadruplex Htelo- and TERRA-binding molecules should differentially modify telomeres. Mammalian telomeres have © XXXX American Chemical Society

Received: July 19, 2015 Accepted: September 11, 2015

A

DOI: 10.1021/acschembio.5b00566 ACS Chem. Biol. XXXX, XXX, XXX−XXX

Articles

ACS Chemical Biology

This finding suggests that the regions containing Phe and Tyr residues in RGG3 are responsible for G-quadruplex DNA and RNA binding, respectively, and that replacing Phe in the region with Tyr converts the DNA-specific binding property to an RNA-specific binding property. To investigate the role of Tyr and Phe in binding of RGG3 to G-quadruplex DNA and RNA, and develop G-quadruplex DNA- or RNA-specific-binding molecules, we examined the binding of truncated versions of RGG3 (RGGF and RGGY) to Htelo or TERRA using an EMSA (Table 1, Figure 1B−D, and Figure S1). Table 1. Sequence of Oligonucleotides Used in EMSA and ITC name

sequence

TERRA mutTERRA Htelo mutHtelo

r(UUAGGG)4 r(UUAGGGUUAGUGUUAGUGUUAGGG) d[AGGG(TTAGGG)3] d(AGGGTTAGTGTTAGTGTTAGGG)

We found that RGGF, which contained solely Phe, bound to Htelo but not to TERRA (Figure 1C,D, RGGF), whereas RGGY, which contains solely Tyr, bound to TERRA but not to Htelo (Figure 1C,D, RGGY). To examine whether RGGY or RGGF specifically binds to a G-quadruplex form of TERRA or Htelo, we performed a competition analysis (Figure S2). RGGY−TERRA binding was not affected by the addition of excess Htelo or mutated TERRA (mutTERRA) that does not form a G-quadruplex, whereas the level was reduced by the addition of excess TERRA (Figure S2A−C). Conversely, RGGF−Htelo binding was not affected by the addition of excess TERRA or mutated Htelo (mutHtelo) that does not form a G-quadruplex, whereas the level was reduced by the addition of excess Htelo (Figure S2D−F). These findings indicate that RGGY and RGGF specifically bind G-quadruplex TERRA and Htelo, respectively. Furthermore, substitution of Phe in RGGF and Tyr in RGGY with Ala abolished their Htelo and TERRA binding abilities (Figure 1C, lanes 4 and 6, Figure 1D, lanes 4 and 6, and Figure S1). These findings indicate that binding of RGGF and RGGY to DNA and RNA, respectively, depends on Phe and Tyr. To determine the binding affinity and stoichiometry of the G-quadruplex to RGGY and RGGF, we examined G-quadruplex binding of RGGY and RGGF by isothermal titration calorimetry (ITC) (Figure S3). The binding isotherm of RGGY with TERRA and that of RGGF with Htelo revealed that both binding reactions were exothermic with similar calculated dissociation constants (Kds) [12 ± 1 nM (TERRA−RGGY) and 10 ± 2 nM (Htelo−RGGF)]. In both cases, the binding stoichiometries were 1 (TERRA−RGGY and Htelo−RGGF), as determined by ITC, indicating that each of these proteins binds Gquadruplexes at a 1:1 ratio. To determine whether RGGY binding stabilizes the Gquadruplex structure of TERRA, we performed reverse transcriptase assays, as described previously (Figure 2A).14,15 Reverse transcriptase complete extension of the primer generates a full-length 76-mer product. Addition of factors that stabilize the G-quadruplex, however, might block primer extension at the site of G-quadruplex formation. Indeed, as the RGGY concentration increased, the amount of full-length 76mer products decreased, and the amount of shorter products increased. The length of the product revealed that the stopping site corresponded to the site of G-quadruplex formation. We

Figure 1. (A) Models of the proposed role of TLS in the telomere regions. (B) Schematic illustration of RGG3, RGGF, RGGY, RGGY/ A, and RGGF/A. (C and D) An EMSA was performed with 32Plabeled Htelo (C) or TERRA (D) and RGG3, RGGF, RGGY, RGGF/ A, or RGGY/A. The DNA− or RNA−protein complexes were resolved by 6% polyacrylamide gel electrophoresis and visualized by autoradiography.

roles of the G-quadruplexes of Htelo and TERRA in histone modifications at the telomere.

■

RESULTS AND DISCUSSION The Arg-Gly-Gly repeat (RGG) domain of the C-terminal region (RGG3) of TLS forms a ternary complex with the Htelo and TERRA G-quadruplexes (Figure 1A).9 The binding stoichiometry ratio of G-quadruplex RNA or G-quadruplex DNA to RGG3 of TLS is 1.16 Furthermore, RGG3 contains two regions bearing either Tyr or Phe, and substitution of Phe in one of the regions with Tyr alters both the binding specificity and stoichiometry; RGG with the substitution specifically binds to G-quadruplex RNA with a binding stoichiometry ratio of 2.16 B

DOI: 10.1021/acschembio.5b00566 ACS Chem. Biol. XXXX, XXX, XXX−XXX

Articles

ACS Chemical Biology

positive band at 290 nm and a negative band at 235 nm, whereas the addition of an excess of RGGF induced an increase in ellipticity and shifted the spectrum from a strong positive band to a band at 265 nm and a negative band at 240 nm. This result suggests that the CD spectrum of Htelo with RGGF is characterized as the parallel stranded form, consistent with the results of previous CD studies.9 Thus, RGGF binds and stabilizes the folded G-quadruplex of Htelo. To investigate whether RGGF and RGGY specifically bind Htelo and TERRA, respectively, in vivo, we performed DNA and RNA chromatin immunoprecipitation (ChIP) assays in HeLa cells (Figure 3). TLS, RGG3, RGGF, and RGGY were tagged with a FLAG epitope. RGGY was additionally fused with a nuclear localization signal (NLS) because it lacks the NLS-

Figure 2. Stabilization of G-quadruplex Htelo and TERRA by binding to RGGY or RGGF. (A) Reverse transcriptase assays in the presence of various amounts of RGGY. Primer extension reactions were performed with reverse transcriptase. (B) DNA polymerase stop assays in the presence of various amounts of RGGF. Primer extension reactions were performed with the rTaq DNA polymerase. The protein concentrations were 0 μM (lane 1), 0.15 μM (lane 2), 0.3 μM (lane 3), 0.6 μM (lane 4), 1.5 μM (lane 5), and 3 μM (lane 6). Extension through the template was performed after incubation by increasing the concentrations of each protein. (1)−(3) denote DNA markers.

also confirm that RGGY does not stabilize the Htelo Gquadruplex structure using a DNA polymerase stop assay, as described previously (Figure S4A).13 To investigate the Gquadruplex structure of TERRA in the presence RGGY, we perfomed a CD spectroscopic analysis (Figure S5A), which revealed that addition of excess of RGGY did not alter the positive band at 265 nm as a parallel structure. These findings indicate that RGGY binds and stabilizes the folded Gquadruplex of TERRA. We examined whether RGGF stabilizes the Htelo Gquadruplex structure using a DNA polymerase stop assay (Figure 2B). As the RGGF concentration increased, the amount of full-length 76-mer products decreased, whereas the amount of the expected shorter G-quadruplex-dependent termination product increased. We also confirm that RGGF does not stabilize the TERRA G-quadruplex structure using a reverse transcriptase assay (Figure S4B). To investigate the Gquadruplex structure of Htelo in the presence RGGF, we performed a CD spectroscopic analysis (Figure S5B). The CD spectrum of Htelo, a hybrid (3 + 1) form, showed a strong

Figure 3. Telomere DNA binding and TERRA binding of RGGF and RGGY in vivo. DNA ChIP and RNA ChIP assays were performed in HeLa S3 cells transfected with Flag-tagged TLS, RGG3, RGGF, NLSRGGY, or expression vector alone. (A) IP-recovered DNA was detected with probe (TTAGGG)4 (top panel) or Alu (second panel). (B) RNA ChIP was either mock-treated (−) or treated (+) with RNase A (200 μg/mL) prior to dot-blot analysis. RNA was visualized by hybridization with probe (CCCTAA)4 (top panel), (TTAGGG)4 (second panel), or GAPDH (third panel). Input and FLAG IP material was detected by Western blotting with the antibody to FLAG. (C) Models of RGGF-binding telomere DNA and RGGY-binding TERRA in the telomere regions. C

DOI: 10.1021/acschembio.5b00566 ACS Chem. Biol. XXXX, XXX, XXX−XXX

Articles

ACS Chemical Biology containing C-terminal region of RGG3. When these domains were expressed in HeLa cells, they were successfully localized at the nucleus (Figure S6). Western blot analysis of whole lysates and immunoprecipitates by the anti-FLAG antibody indicated that these proteins were expressed and recovered by immunoprecipitation (IP) at similar levels. The DNA and RNA ChIP assays revealed that the RGGF binding fraction contained Htelo but not TERRA, and that the RGGY binding fraction conversely contained TERRA but not Htelo. This finding indicates that RGGF binds telomeres in the doublestranded region because a (TTAGGG)4 probe hybridized to the telomere double-stranded region, but not to a singlestranded G-rich 3′-overhang. The fact that both Htelo and TERRA were detected in the TLS and RGG3 binding fraction is consistent with a dual binding activity of TLS and RGG3 and our previous results indicating that RGG3 binds the Gquadruplex in the telomere double-stranded region.9 None of the DNA and RNA recovered from the FLAG IPs cross-reacted with the Alu and GAPDH probes. These binding assays in vitro and in vivo suggest that RGGY specifically binds G-quadruplex TERRA while RGGF specifically binds G-quadruplex Htelo in the double-stranded region of the telomere. Moreover, to investigate whether G-quadruplexes of Htelo and TERRA have distinct roles in histone modifications at telomeres, we performed DNA ChIP assays to assess H3K9me3 and H4K20me3 modification levels at telomeres in RGGF- or RGGY-overexpressing cells (Figure 4A). DNA ChIP analysis using antibodies against H3K9me3 and H4K20me3 revealed a significant decrease in the number of both H3K9me3 and H4K20me3 histone modifications at telomeres in RGGFoverexpressing cells. On the other hand, only the number of H3K9me3 histone modifications was decreased at telomeres in RGGY-overexpressing cells (Figure 4B). These findings suggest that G-quadruplex Htelo promotes both H3K9me3 and H4K20me3 modifications at telomeres, while G-quadruplex TERRA promotes only H3K9me3 modifications at telomeres. Here we reported that engineered TLS RGG domains, RGGF and RGGY, selectively bind the G-quadruplexes of Htelo and TERRA, respectively. Moreover, RGGF inhibited trimethylation of both histone H3K9 and H4K20 at telomeres, but RGGY inhibited only H3K9 trimethylation. These findings suggest that the G-quadruplexes of Htelo and TERRA function as different marks for histone modifications at telomeres. Telomere double-stranded DNA-binding protein TRF2 interacts with G-quadruplex TERRA and promotes H3K9me3 modifications at telomeres.17,18 Moreover, TLS binds Gquadruplex Htelo and TERRA and promotes H3K9me3 and H4K20me3 modifications at telomeres. Although TLS promotes both H3K9me3 and H4K20me3 modifications, it interacts with only the H4K20me3 modification enzyme, Suv420h2.9 RGGF perhaps inhibits TLS from binding telomeres and methylating H3K9 and H4K20, while RGGY might inhibit TERRA from binding TLS, but not TLS binding to Htelo, which results in H4K20me3 (Figure S7). On the basis of these findings, we propose the following model. TLS binds Gquadruplex Htelo and recruits TERRA at telomeres, and telomere-localized TLS recruits the H3K9me3 and H4K20me3 modification enzymes. Further studies are required to identify the role and function of the G-quadruplex-binding protein TLS in telomere maintenance. This research demonstrates that Gquadruplexes regulate histone modifications in telomeres, which act as marks for chromatin structures. RGGY and RGGF proteins will be useful as a tool for investigating the

Figure 4. Histone mark changes in RGGF- and RGGY-overexpressed HeLa cells. DNA ChIP assays were performed in the same cells (Figure 3). (A) Each IP-recovered DNA was visualized by hybridization with probe d(TTAGGG)4 (top panel) or Alu (bottom panel). Antibodies specific for H3K9me3, H4K20me3, or control IgG were used for the ChIP assays. The right panels show quantification of the ChIP assays shown in the left panels. Student’s t test; P < 0.00002 compared with vector (n = 3). Error bars indicate the standard error of the mean. (B) Models of the proposed roles of G-quadruplex telomere DNA and TERRA for histone modifications in the telomere regions.

mechanism of regulating chromatin structures by G-quadruplexes, which are thought to be widely present in genomic DNA and noncoding RNA.2,19,20 Previously, the functions of G-quadruplex DNA and RNA in gene promoters, mRNAs, and telomeres have been studied using molecules that bind to Gquadruplexes.2,3,21,22 Small molecules targeting the G-quadruplex in the 5′-untranslated regions of mRNA were shown to modulate the translational activity of the mRNA.3 GQuadruplex-specific antibodies revealed formation of Gquadruplexes in the genome and their modulation during the cell cycle.21,22 However, the previously reported G-quadruplexbinding molecules for living cells do not distinguish DNA and RNA and are not suitable for studying individual functions of G-quadruplex DNA and RNA. Apparently, G-quadruplexbinding proteins that distinguish G-quadruplex DNA and RNA will be useful for elucidating their G-quadruplex functions in living cells and might have potential pharmaceutical implications.

■

MATERIALS AND METHODS

Plasmid Constructs and DNA. The RGG3 plasmid, which was previously cloned as RGG3 of TLS into the pGEX6P-1 vector, was used as a template for polymerase chain reaction (PCR).9 pGEXRGGF and pGEX-RGGY were obtained by deletion in pGEX-RGG3 using a KOD-Plus-Mutagenesis Kit (Toyobo, Tokyo, Japan) and the D

DOI: 10.1021/acschembio.5b00566 ACS Chem. Biol. XXXX, XXX, XXX−XXX

Articles

ACS Chemical Biology primers for RGGF or RGGY (Table S1). pGEX-RGGF/A and pGEXRGGY/A were obtained by substitution and deletion of pGEX-RGG3 using a KOD-Plus-Mutagenesis Kit and the primers for RGGF/A or RGGY/A (Table S1). The Flag-tagged TLS plasmid (pcDNA3.1FLAG-TLS) and the GFP-tagged TLS plasmid (pcDNA3.1-GFP-TLS) were previously described.1,2 pcDNA3.1-FLAG-RGG3 and pcDNA3.1GFP-RGG3 were obtained by deletion of pcDNA3.1-FLAG-TLS and pcDNA3.1-GFP-TLS using a KOD-Plus-Mutagenesis Kit and the primers for RGG3 (Table S1). pcDNA3.1-FLAG-RGGF, pcDNA3.1FLAG-RGGY, pcDNA3.1-GFP-RGGF, and pcDNA3.1-GFP-RGGY were obtained by deletion of pcDNA3.1-FLAG-RGG3 and pcDNA3.1GFP-RGG3 using a KOD-Plus-Mutagenesis Kit and the primers for RGGF or RGGY (Table S1). To create nuclear localization sequencefused FLAG-RGGY (pcDNA3.1-NLS-FLAG-RGGY) and GFP-RGGY (pcDNA3.1-NLS-FLAG-RGGY), an oligonucleotide encoding KKKRKVLA was inserted between the XbaI site of pcDNA3.1FLAG-RGGY and pcDNA3.1-GFP-RGGY. All constructs were verified by automated DNA sequencing. All DNA primers were obtained from Operon Biotechnologies (Tokyo, Japan). The other oligomers used for the electrophoretic mobility shift assay (EMSA), isothermal titration calorimetry (ITC), DNA polymerase stop assay, and reverse transcriptase stop assay were obtained from Hokkaido System Science Co., Ltd. (Hokkaido, Japan). Expression and Purification of Glutathione S-Transferase (GST) Fusion Proteins. All recombinant proteins for in vitro experiments were fused to GST at the N-terminus and overexpressed in Escherichia coli as described previously.9 GST tags were cleaved using buffer containing 8 units/mL PreScission protease (GE Healthcare) on a column for 16 h at 4 °C, and the protein was eluted by potassium buffer or lithium buffer. The protein concentrations were determined using a BCA Protein Assay Kit (Thermo Scientific). Electrophoretic Mobility Shift Assay. The EMSAs were performed as described previously.9 Binding reactions were performed in a final volume of 20 μL using 1 nM labeled oligonucleotide and 50 nM purified protein in a binding buffer [50 mM Tris-HCl (pH 7.5), 0.5 mM EDTA, 0.5 mM dithiothreitol, 0.1 mg mL−1 bovine serum albumin, 1 μg/mL calf thymus DNA, and 100 mM KCl]. After the samples had been incubated for 1 h at 4 °C, they were loaded on a 6% polyacrylamide [19:1 acrylamide/bis(acrylamide)] nondenaturing gel. The gels were exposed in a phosphorimager cassette and imaged by Personal Molecular Imager FX (Bio-Rad Laboratories). DNA Polymerase Stop Assay. DNA polymerase stop assays were performed as described previously.13 The 25-mer primer was 100 nM 5′-labeled with 32P, mixed with 300 nM 76-mer template DNA containing d(TTAGGG)4, and annealed. Duplex PCR was performed for 10 min at 30 °C in 50 mM Tris-HCl (pH 7.5), 10 mM KCl, and 5 mM MgCl2 with 2 units/μL rTaq DNA polymerase (Toyobo). Electrophoresis was performed at 1500 V for 2 h at 20 °C, and gels were visualized on a phosphorimager. DNA markers were obtained from Hokkaido System Science Co., Ltd., and 5′-labeled with 32P. Reverse Transcriptase Stop Assay. Reverse transcriptase stop assays were performed as described previously.14,15 The 25-mer primer was 100 nM 5′-labeled with 32P, mixed with 300 nM 76-mer template RNA containing r(UUAGGG)4, and annealed. Reverse transcriptase reactions were performed for 30 min at 20 °C in 50 mM Tris-HCl (pH 7.5), 10 mM KCl, and 5 mM MgCl2 with 2 units/μL ReverTra Ace reverse transcriptase (Toyobo). Electrophoresis was performed at 1500 V for 2 h at 20 °C, and gels were visualized on a phosphorimager. DNA markers were obtained from Hokkaido System Science Co., Ltd., and 5′-labeled with 32P. Measurement of Binding Affinities by Isothermal Titration Calorimetry. Measurements of binding affinities by ITC were performed as described previously.16 Binding of RGGY to TERRA and RGGF to Htelo in a potassium buffer [50 mM Tris-HCl (pH 7.5) and 100 mM KCl] was assessed by ITC using a DP ITC unit (MicrocaliTC200, GE Healthcare). TERRA and Htelo annealing and quadruplex formation were induced by heating samples to 95 °C on a thermal heating block and cooling them to 4 °C at a rate of 2 °C/min in a potassium buffer. RGGF, RGGY, Htelo, and TERRA were

degassed by centrifugation. Binding experiments were performed at 25 °C. A sample syringe with stirring at 1000 rpm was used to titrate the TERRA (24 μM) or Htelo (24 μM) into a cell containing 200 μL of RGGF or RGGY (3 μM). Titrations comprised 20 injections of these nucleic acids (one 0.5 μL injection followed by nineteen 2 μL injections). The initial data point was routinely deleted to allow for diffusion of TERRA/RGGY or Htelo/RGGF across the needle tip during the equilibration period. ITC binding isotherms were analyzed using a simple set of identical independent binding site models with the ITC data analysis software (ORIGIN) provided by the manufacturer. Circular Dichroism Spectroscopy. CD spectroscopy was performed as described previously.9 CD spectra were recorded on a model J-820 (JASCO Corp., Tokyo, Japan) instrument. The CD spectra of Htelo or TERRA (base concentration of 0.2 mM) and RGGF (5, 2, 1) equivalent to Htelo (RGGF/Htelo) or RGGY (5, 2, 1) equivalent to TERRA (RGGY/TERRA) in 50 mM Tris-HCl (pH 7.5) and 10 mM KCl were recorded using a 0.2 cm path-length cell at 25 °C. Cell Culture and Transfection. Cell culture and transfection were performed as described previously.9 HeLa cells were maintained in Dulbecco’s modified Eagle’s medium supplemented with 10% fetal bovine serum. For assays, cells were cultured in six-well plates and transfected with plasmids for protein expression using Xfect Transfection Reagent (Clontech Laboratories Inc.) according to the manufacturer’s instructions. G418 (200 μg/mL) was added to the culture media every 3 days. DNA ChIP Assay. The DNA ChIP assay was performed as described previously.9 HeLa cells infected with Flag-tagged TLS (TLS), RGG3 (RGG3), and RGGF (RGGF) or nuclear localization signal (NLS)-fused Flag-tagged RGGY (RGGY) or control vector were cross-linked with 1% formaldehyde for 15 min at 25 °C, and the cross-linking was stopped by the addition of 125 mM glycine. Cells were lysed and sonicated to obtain DNA fragments of 500−1000 bp. For each immunoprecipitation, 1 μg of protein lysate with RNase A was used with 4 μg of mouse monoclonal anti-FLAG M2 antibody (Sigma-Aldrich, St. Louis, MO), rabbit polyclonal anti-TRF2 antibody (Santa Cruz Biotechnology, Santa Cruz, CA), rabbit polyclonal antitrimethyl-histone H3 (Lys9) antibody (Merck Millipore), rabbit polyclonal anti-trimethyl-histone H4 (Lys20) antibody (Merck Millipore), or normal mouse control IgG (Santa Cruz Biotechnology). The immunoprecipitated DNA was extracted and transferred to Immobilon membranes (Merck Millipore). Duplicate membranes were hybridized with a radioactive telomeric repeat probe [(TTAGGG)4] or an Alu repeat probe (CACGCC TGTAAT CCCAGC ACTTTG), and the gels were visualized on a phosphorimager. RNA ChIP Assay. The RNA ChIP assay was performed as previously described.9 HeLa cells infected with TLS, RGG3, and RGGF or RGGY or control vector were cross-linked with 1% formaldehyde for 15 min at 25 °C, and the cross-linking was stopped by the addition of 125 mM glycine. For each immunoprecipitation, 1 μg of protein lysate with DNase I was used with 4 μg of mouse monoclonal anti-FLAG M2 antibody (Sigma-Aldrich) and Protein GAgarose (Roche, Basel, Switzerland) at 4 °C overnight and further analyzed using the method described above. Sodium Dodecyl Sulfate−Polyacrylamide Gel Electrophoresis and Western Blot Analysis. TLS, RGG3, RGGY, and RGGY were analyzed by sodium dodecyl sulfate−polyacrylamide gel electrophoresis in an e-PAGEL 5 to 20% gradient gel (ATTO Corp.). Flagtagged proteins were visualized by being transferred to a polyvinylidene difluoride membrane and probed with rabbit polyclonal anti-FLAG antibody (Medical & Biological Laboratories). The secondary antibodies included anti-rabbit horseradish peroxidase (Cell Signaling Technology). Protein bands were visualized using the ECL Western blotting analysis system (GE Healthcare). Microscopy. Nuclear DNA was stained with DNA-specific dye (Hoechst 33342), as described previously.9 GFP-tagged proteins were analyzed using an Olympus IX71 inverted microscope equipped with an Olympus DP30BW CCD camera (Olympus, Corp.). Images were E

DOI: 10.1021/acschembio.5b00566 ACS Chem. Biol. XXXX, XXX, XXX−XXX

Articles

ACS Chemical Biology obtained through a 60×, 1.42 NA Plan Apo oil immersion objective lens using MetaMorph (version 7) (Molecular Devices Japan, Inc.).

■

G-quadruplex structure with mixed parallel/antiparallel strands in potassium solution. Nucleic Acids Res. 34, 2723−2735. (8) Azzalin, C. M., Reichenbach, P., Khoriauli, L., Giulotto, E., and Lingner, J. (2007) Telomeric repeat containing RNA and RNA surveillance factors at mammalian chromosome ends. Science 318, 798−801. (9) Takahama, K., Takada, A., Tada, S., Shimizu, M., Sayama, K., Kurokawa, R., and Oyoshi, T. (2013) Regulation of telomere length by G-quadruplex telomere DNA- and TERRA-binding protein TLS/FUS. Chem. Biol. 20, 341−350. (10) Arnoult, N., Van Beneden, A., and Decottignies, A. (2012) Telomere length regulates TERRA levels through increased trimethylation of telomeric H3K9 and HP1α. Nat. Struct. Mol. Biol. 19, 948−956. (11) Benetti, R., Gonzalo, S., Jaco, I., Schotta, G., Klatt, P., Jenuwein, T., and Blasco, M. A. (2007) Suv4−20h deficiency results in telomere elongation and derepression of telomere recombination. J. Cell Biol. 178, 925−936. (12) Di Antonio, M. Di, Biffi, G., Mariani, A., Raiber, E.-A., Rodriguez, R., and Balasubramanian, S. (2012) Selective RNA versus DNA G-quadruplex targeting by in situ click chemistry. Angew. Chem., Int. Ed. 51, 11073−11078. (13) Takahama, K., Kino, K., Arai, S., Kurokawa, R., and Oyoshi, T. (2011) Identification of Ewing’s sarcoma protein as a G-quadruplex DNA- and RNA-binding protein. FEBS J. 278, 988−998. (14) Hagihara, M., Yamauchi, L., Seo, A., Yoneda, K., Senda, M., and Nakatani, K. (2010) Antisense-induced guanine quadruplexes inhibit reverse transcription by HIV-1 reverse transcriptase. J. Am. Chem. Soc. 132, 11171−11178. (15) Hagihara, M., Yoneda, K., Yabuuchi, H., Okuno, Y., and Nakatani, K. (2010) Antisense-induced guanine quadruplexes inhibit reverse transcription by HIV-1 reverse transcriptase. Bioorg. Med. Chem. Lett. 20, 2350−2353. (16) Takahama, K., and Oyoshi, T. (2013) Specific binding of modified RGG domain in TLS/FUS to G-quadruplex RNA: tyrosines in RGG domain recognize 2′-OH of the riboses of loops in Gquadruplex. J. Am. Chem. Soc. 135, 18016−18019. (17) Deng, Z., Norseen, J., Wiedmer, A., Riethman, H., and Lieberman, P. M. (2009) TERRA RNA binding to TRF2 facilitates heterochromatin formation and ORC recruitment at telomeres. Mol. Cell 35, 403−413. (18) Biffi, G., Tannahill, D., and Balasubramanian, S. (2012) An intramolecular G-quadruplex structure is required for binding of telomeric repeat-containing RNA to the telomeric protein TRF2. J. Am. Chem. Soc. 134, 11974−11976. (19) Gray, L. T., Vallur, A. C., Eddy, J., and Maizels, N. (2014) G quadruplexes are genomewide targets of transcriptional helicases XPB and XPD. Nat. Chem. Biol. 10, 313−318. (20) Jayaraj, G. G., Pandey, S., Scaria, V., and Maiti, S. (2012) Potential G-quadruplexes in the human long non-coding transcriptome. RNA Biol. 9, 81−86. (21) Biffi, G., Tannahill, D., McCafferty, J., and Balasubramanian, S. (2013) Quantitative visualization of DNA G-quadruplex structures in human cells. Nat. Chem. 5, 182−186. (22) Biffi, G., Di Antonio, M., Tannahill, D., and Balasubramanian, S. (2013) Visualization and selective chemical targeting of RNA Gquadruplex structures in the cytoplasm of human cells. Nat. Chem. 6, 75−80.

ASSOCIATED CONTENT

S Supporting Information *

The Supporting Information is available free of charge on the ACS Publications website at DOI: 10.1021/acschembio.5b00566. Primer sequences used in this study (Table S1), SDS− PAGE of mutated RGG3 in TLS on a 5 to 20% gradient polyacrylamide gel (Figure S1), G-quadruplex DNA or RNA binding specificity of RGGY and RGGF (Figure S2), binding affinities and stoichiometries of RGGY or RGGF and TERRA or Htelo measured by ITC (Figure S3), DNA polymerase stop assays with RGGY and reverse transcriptase assays with RGGF (Figure S4), circular dichroism spectra of TERRA or Htelo in the presence of various amounts of RGGY or RGGF (Figure S5), identification of a localization about each protein in HeLa cells (Figure S6), and models of the proposed role of RGGF and RGGY in the telomere regions (Figure S7) (PDF)

■

AUTHOR INFORMATION

Corresponding Author

*E-mail: [email protected]. Funding

This research was supported by a JGC-S Scholarship Foundation, a Grant-in-Aid for Scientific Research (C) (26410176 to T.O.), and JSPS Fellows (243925 to K.T.) from the Ministry of Education, Culture, Sports, Science, and Technology of Japan. Notes

The authors declare no competing financial interest.

■

ABBREVIATIONS DTT, dithiothreitol; EMSA, electrophoretic mobility shift assay; TLS, translocated in liposarcoma; GST, glutathione Stransferase; RGG, Arg-Gly-Gly repeat; TERRA, telomeric repeat-containing RNA.

■

REFERENCES

(1) Du, Y., and Zhou, X. (2013) Targeting non-B-form DNA in living cells. Chem. Rec. 13, 371−384. (2) Balasubramanian, S., Hurley, L. H., and Neidle, S. (2011) Targeting G-quadruplexes in gene promoters: a novel anticancer strategy? Nat. Rev. Drug Discovery 10, 261−275. (3) Bugaut, A., and Balasubramanian, S. (2012) 5′-UTR RNA Gquadruplexes: translation regulation and targeting. Nucleic Acids Res. 40, 4727−4741. (4) Martadinata, H., and Phan, A. T. (2009) Structure of propellertype parallel-stranded RNA G-quadruplexes, formed by human telomeric RNA sequences in K+ solution. J. Am. Chem. Soc. 131, 2570−2578. (5) Luu, K. N., Phan, A. T., Kuryavyi, V., Lacroix, L., and Patel, D. J. (2006) Structure of the human telomere in K+ solution: an intramolecular (3 + 1) G-quadruplex scaffold. J. Am. Chem. Soc. 128, 9963−9970. (6) Dai, J., Carver, M., Punchihewa, C., Jones, R. A., and Yang, D. (2007) Structure of the Hybrid-2 type intramolecular human telomeric G-quadruplex in K+ solution: insights into structure polymorphism of the human telomeric sequence. Nucleic Acids Res. 35, 4927−4940. (7) Ambrus, A., Chen, D., Dai, J., Bialis, T., Jones, R. A., and Yang, D. (2006) Human telomeric sequence forms a hybrid-type intramolecular F

DOI: 10.1021/acschembio.5b00566 ACS Chem. Biol. XXXX, XXX, XXX−XXX