Biotechnol. h g . 1gS4, 10, 134-140
194
Gene Structural Analysis and Expression of Human Renal Dipeptidase Susumu Satoh, Kazuyuki Ohtsuka, Yuriko Keida, Chihiro Kusunoki, Yoshiyuki KontaJ Mineo Niwa,' and Masanobu Kohsaka Product Development Laboratories, Fujisawa Pharmaceutical Co., Ltd., 1-6, 2 Chome, Kashima, Yodogawa-ku, Osaka 532, Japan, and Second Department of Internal Medicine, Hirosaki University, 5 Zaifu-cho, Hirosaki 036, Japan
Human renal dipeptidase cDNA and genomic DNA were isolated from human kidney cDNA and genomic libraries, respectively. The human renal dipeptidase gene has a total length of approximately 6 kb and consists of ten exons and nine introns. The exons and cDNA each encode the 411 amino acid residues of the precursor protein, including 16 amino acid residues of signal sequence and a hydrophobic carboxyl terminal sequence for the attachment of a phosphatidylinositol glycan. Although the cDNA was slightly different from the cDNA reported by Adachi et al. (1990),the differences observed suggest, by comparison with human genomic DNA, that it may not represent an allelic variant but a cloning artifact. The recombinant human renal dipeptidase was produced on the surface of transfected L929 cells and had the same character as native renal dipeptidase. Northern blotting hybridization analysis showed that renal dipeptidase mRNA is only transcribed in kidney.
Introduction Renal dipeptidase (RDP) (dehydropeptidase I, microsomal dipeptidase) (EC 3.4.13.19) was initially characterized as a kidney membrane enzyme (Campbell et al., 1963). The enzyme hydrolyzed not only various dipeptides, including glycyldehydrophenylalanine,but also some p-lactam antibiotics (Kropp et al., 1982) and leukotriene D4 (Farrell et al., 1987). The RDP was shown to be a zinc metalloprotease with an apparent Mrof 42 000-59 OOO and to be associated with a membrane by phosphatidylinositol glycan (Hooper and Turner, 1987). Recently,the human (Adachiet al., 1990),porcine (Satoh et al., 1990; Rached et al., 1990),and rabbit (Igarashi and Karniski, 1991) RDP cDNAs were cloned, and several physicochemical characteristics were elucidated. However, the physiological role of RDP remains unclear. In the present study, we describe the cloning and expression of a cDNA and the cloning of human genomic DNA for RDP. Materials and Methods Materials. Restriction enzymes and modification enzymes were purchased from Takara Syuzo, Toyobo, Nippon Gene, BRL, or New England Biolabs. The human kidney cDNA library and poly(A)+RNApre-transblotted nylon membrane (multipletissue Northern blot) were from Clontech. Sequenase was from United States Biochemical Corp. Glycyldehydrophenylalaninewas prepared as described by Phelps et al. (1982). All other chemicals were of reagent grade. The human genomic library was a kind gift from Dr. Shimada (Osaka University). Preparation of s2P-LabeledProbe. The probe DNA used in screening the human cDNA library was prepared
* Author towhom correspondenceshould be addressed at Fujisawa Pharmaceutical Co., Ltd. Telephone: 06-390-1148.Fax: 06-3041192. + Hirosaki University.
8756-7938/94/3010-0134$04.50/0
from porcine RDP cDNA (Satoh et al., 1990) digested with SmaI andKpnI and labeled by nick-translation (Kelly et al., 1970). The probe DNAused in screeningthe genomic library was prepared from human cDNA fragments 1107 bp (PstI-PstI), 200 bp (Au~II-Au~II), and 144 bp (PstISad)] by nick-translation. Isolation of RDP cDNA and Genomic DNA. A total of 4 X lo5 phages of the human kidney cDNA library (Clontech) were screened by plaque hybridization. Replicated filters were prehybridized at 42 "C for 5 h in prehybridization solution containing 30 % formamide, 5X SSC, 5X Denhardt's solution, 0.1 % SDS, and 100 pg/mL yeast tRNA and then hybridized with the probe (2.5 X 106 cpm/filter) at 42 "C for 16 h in the prehybridization solution. The filters were then washed with 4X SSC containing 0.1% ' SDS at room temperature and again at 42 "C. To isolate a human RDP gene, 5 X l o 6 phages of a human genomic library were screened by plaque hybridization. The human RDP gene was isolated under more stringent hybridization conditions (containing 50 % formamide at 42 "C) from the human genomic library. Nucleotide Sequence. Plasmids containing RDP cDNA were treated with restriction endonucleases, and adequate fragments were subcloned into the M13 phage vector. The nucleotide sequences of these clones were determined by the Sanger dideoxy method (Sanger et al., 1977). DNA fragments of A phage clones containing genomic RDP gene were subcloned into pUC18, and the nucleotide sequences were determined by the dye terminator cycle sequencing method (Lee et al., 1992) using an Applied Biosystems Model 370A DNA sequencer. Expression and Identification of RDP. The RDP cDNA was subcloned into the eukaryotic expression plasmid pMM324 (as shown in Figure 3 and Results and Discussion). Thirty micrograms of the expression plasmid, pDHP8, were transfected into mouse L929 cells (seeded at 5 X lo5 cells per 90-mm plate) by a calcium phosphate procedure (Graham and van der Eb, 1973). The resulting G418 resistance clone was incubated in induction medium
0 1994 American Chemical Society and American Instttute of Chemical Engineers
l3btechd. kog., 1994, Vol. I O , No. 2 0.1Kbp H
- - --
(2 % FCS-DMEM medium containing 40 pM zinc sulfate and 2 mM sodium butyrate) at 37 "C for 1 day. The membrane fraction of the cell lysate was assayed for RDP activity by a modification of the method described by Hitchcocket al. (19871, which measures the rate of increase in absorbance at 330 nm. Recombinant RDP was purified by cilastatin Sepharose column chromatogiaphy (Kropp et al., 1982) following separation from the membrane fraction with a solution of 0.5% Triton X-100,O.Ol mM zinc chloride, and 50 mM Tris HC1 (pH 9.0). The K, value for glycyldehydrophenylalanine was measured in the same manner as above (Hitchcocket al., 1987). The purifiedrecombinant human RDP was sequenced by the Edman method (Edman and Begg, 1967) using an Applied Biosystems Model 470 gasphase sequencer. Northern Blotting Analysis. The pre-transblotted nylon membrane (Clontech) was prehybridized and then hybridized under stringent conditions in the same manner as above. The filter was then washed with 2X SSC containing 0.1 7% SDS a t room temperature and again at 42 "C and then washed at 55 "C with 0.2X SSC containing 0.1% SDS. The filter was exposed to X-ray film a t -80 "C for 20 h. Results and Discussion Human RDP cDNA was isolated from a human kidney cDNA library using a porcine RDP cDNA as a probe. Screening under low stringency conditions (see Materials and Methods) isolated a positive clone X 3-1. After the cDNA fragment of the X 3-1 clone was subcloned into pUC9, the resulting plasmid, plambda3-1, was sequenced by the dideoxy method as described by Sanger et al. (1977). The human RDP cDNA consists of 1523 bp containing a complete open reading frame of 1233nucleotides encoding 411 amino acids of RDP (Figure 1).Furthermore, genomic RDP DNA was isolated from a human genomic DNA library as the positive clone 512 (Figures 1and 2). The coding region of the RDP gene was contained in the 2.5-
-.-.
Table 1. Location of the Intron/Exon Junction for Human Genome RDP nucleotide sequence intron no. of exonlintron 1 ...GGIGTGAG TCCAG/GC 2 ...AGIGTACC......CACAGITT... 3 ...AGIGTGGG CGCAG/GC 4 ...TGIGTGCG......TCCAGIGG... 5 AG/GTGAG CCCAGICG 6 ...TG/GTGAG......TGCAGIAA... 7 CGIGTAGG... GACAGIAC... 8 ...AGIGTAAG......CACAGIGG
......
......
9
common nucleotides
...
......
..
...
... ... ... ...
...AG/GTGAG......CCCAGIGC... .....CAG/..... ....GICT......
Table 2. Comparison of the Nucleotide Sequence of Cloned cDNA and the Amino Acid Sequence Specified by It, with the Sequences of RDP from Various Other Species' different nucleotide positions and amino acid residues source of RDP cDNA 305 374,375 433 523 porcine I(ATC) I(ATC) S(TCC) x (6Cc) rabbit M(ATG) I(ATC) S(TCC) A(GCT) mouse M(ATG) I(ATC) L(Tl'A) A(GCC) human genome S(TCC) A(GCT) M(ATG) I(ATl') human (clone 3-1) M(ATG) I(ATT) P(CCC) S(TCT) human (reo R(AG*G) R(AG*G*) S(T*CC) A(G*CT) 0 Nucleotides that differ in the cloned cDNA (clone 3-1) from human RDP cDNA (Adachi et al., 1990) are shown aligned with sequences of RDP from porcine cDNA (Satoh et al., 1990),rabbit cDNA (Igarashi and Karniski, 1991), mouse cDNA (Satoh et al., 19931,and human genomic DNA. Nucleotides differing from the sequence in the reference (Adachi et al., 1990) are indicated by *. These nucleotidesand the deduced amino acids are highly conserved in the RDP of various species, with the exception of positions 305, 374,and 375 of the human RDP cDNA (Adachi et al., 1990)and 433 and 523 of our cloned cDNA (clone 3-1).
and 5.5-kb BamHI fragments of clone 512 (Figure 11, as determined by Southern blotting analysis (data not shown). After these two fragments were subcloned, their DNA sequences were determined by the dye terminator
Biotechml, Rog., 1994, Vol. 16, No. 2
ggatcccagtttcttactatgcctccgtctagaccagacaggaacggccagtcat tgagtgtccggccttccatcctacccaccctggtggggaatgtgctggttacttattgaa catgggaag@€Zaggagagcaggcacctgtcatcacttccacccacacctctggt
ggctctcctggcaggcagagtggctcctcacagcctgaagctcatccttctgcacgggcc
agccaggccagcacagaggcaccagggcagcagtgcacacaggtccccggggaccccacc
ATGTGGAGCGGATGGTGGCTGTGGTCCCTTGTGGCCGTCT~ACTGCAGACTTCTTTCGG
(60
MetTrpSerGlyTrpTrpLeuTrpProLeuValAlaValCysThrAlaAspPhePheArg
4
GACGAGGCAGAGAGGATCATGAGGGACTCCCCTGTCATTGATGGgtgagtgctcacctga
104
AspGluAlaGluArgIleMetArgAspSerProValIleAspGl
18
gacaggtgctttagggaaccaggattgggaactggggctgggagagcggcgccgggggag --------------> ca.2Kbp (-------------acagtgctggga ttccaggcgtgagccaccgcgcccggccgggggtcacagttgttagaatctgttacggga
cccaccttcatcccttgcccaccaccagcgacacaggggcaggaagtatcttcaacccaa atggctgtgttccccctaaaagcggggggttttaaactcacaaaggaaaaggaggagaat
ggatcctcactcagccaccagctctgacagccccagctcccccttcctctgcgttcccct tccttctcctttccccttccttctcatttttcctcacgagagctcctaccctcaccacca ccagctcctgggaaaaccttggagaacttcagtcctttggaagtttagaaggatctgatt ggagtttgggtgcagggctcttccctggggacagaggcagcagagaggcctgggtagccc
ccaaagcctgtactcgacaccctgctccccaggaggatggtggtcccaggccccccaagg tcaggacgttccaattacccaggcacccaccatattccccaagaggcaatttgatcttta
aactgaaaactctcagaaacagtatcacccccaggcccttgcccctcacgtctccaatcc tgtccactgaggtcaattggctccttgtgtcccaccctcagacaatgtgtctgcccccca
gcctcctcaacagaaaaagcccctggaagggatgggctacccagctccctgagctcctgg ctcggggttccctcccctgggggtgggcacagttgggaaatgcagcctgcacaggtgtgt tcaggtggccggtgatatgtcacccccgcggcctagacttcagtcctgcgtctgtcgtga
ggagtaggaagtggggagagcagcccagaggccaggagctcggaagcccccaggtcccag
tggccgccctgactgcctggcctctccccggcaaactccag~ACMTGACCTCCCCTGG yHisAsnAspLeuProTrp
123
CAGCTGCTGGATATGTTCMCAACCGGCTGCAGGACGAGAGGGCCMCCTGACCACCTTG
183
GlnLeuLeuAspMetPheAsnAsnArgLeuGlnAspGluArgAlaAsnLeuThrThrLeu
GCCGGCACACACACCMCATCCCCM~TGAGGGCCGGCTTTGTGGGAGGCCAGgtaccg AlaGlyThrHisThrAsnIleProLysLeuArgAlaGlyPheValGlyGlyGln
25 45 237 63
cctgccctgccttgtgcttgccctgtgtggggtcatcccgtctcctacctcaggcctggc
tacagtgggaccatccctgtggtgttcctccagggtccctcggtgcccaggccgagggag ggcttcccagcgggtgggaaaccagactcccacaggcatgcggggggtgggctgagacct
ggctgcatcagctcctggcaccccctgcggcccacagTTCTGGTCCGTGTACAC~CCT~
261
PheTrpSerValTyrThrProCys
71
GACACCCAGAACAAAGACGCCGTGCGGAGGACGCTGGAGCT~AGCAGATGGACGTGGTCCACCGC
32 1
AspThrGlnAsnLysAspAlaValArgArgThrLeuGluGl~etAspValValHisArg
91
ATGTGCCGGATGTACCCGGAGACCTTCCTGTATGTCACCAGCAGTGCAGgtggggtcctg
370
MetCysArgMetTyrProGluThrPheLeuTyrValThrSerSerAlaG
107
acctgggtcctccaggtcctgcgtcttctcacccagccctcatcctgagcagcaggtgcc
ggtcaggacacctcaccctccagataccaggtgcccactcccctgcaccctgactctccc cgcagGCATTCGGCAGGCCTTCCGGGAAGGGAAGGTGGCCc
426
lyIleArgGlnAlaPheArgGluGlyLysValAlaSerLeuIleGlyValGluGly
126
GGCCACTCCATTGACAGCAGTTTGGGCGTCCTGCGGGCACTCTATCAGCT~GCATGCGG GlyHisSerIleAspSerSerLeuGlyValLeuArgAlaLeuTyrGlnLeuGlyMetArg
486
TACCTGACCCTCACCCACAGCTGCAACACGCCCTGgtgcgtgactccccatgggaggccc
52 1
TyrLeuThrLeuThrHisSerCysAsnThrProTr
157
146
ccgggctgtggtcaggagggagggggcagacactccctgccaccctccagagcccatccc ctctggctgtgagtcccaggccgggcctcgcctgctgggctgatgggaggccgagaccac
CgctcacctcttgggcacctgccttttggttctccagGGCTGACMCT~T~T~AC
543
Biotechrwl. Prog.., 1994, Vol. 10, No. 2
PAlaAspAsnTrpLeuValAsp ACGGGAGACAGCGAGCCCCAGAGCCMGGCTTGTCACCCTTTG~CAGgtgagtggggtg ThrGIYAsPSerGluPrOGlnSerGlnGlyLeuSerpropheGlyGln
165 591 181
ggagcggccagtcacccccgaggagaaggcagaggccctggagggtgaccagaacaatgc atctcctcacgtgggacctcagtgtccttgtctgtaaaatggagctggcagccatccccc
cagggtgggtgctgagccctgagtggccccggacttccagccacgaaggatgatgactca catctggtccagcccgtccacctccgcagccccgaccctgggggctgtgagggtggacgg agCCCtgtCttCCCagCGTGTGGTGAAGGAGCTGAACCGTCT~GGGTCCTCATCGACTTG
ArgValValLysGluLauAsnArgLeuGlyValLeuIleAspLeu GCTCACGTGTCTGTGGCCACCATGAAGGCCACCCTGCAGCTGTCCA~GCCCCGGTCATC AlaHisValSerValAlaThrMetLysAlaThrLeuGlnLeuSerArgAlaProValIle
636
TTCAGCCACTCCTCGGCCTACAGCGTGTGCGCAAGCCGGCCGTC
196 696 216 756
PheSerHisSerSerAlaTyrSerValCysAlaSerArgArgAsnValProAspAspVal
236
CTGAGGCTGGTGgtgagggccgagggggcgacctccaccccgcctccctgggcaggccct LeuArgLeuVal
768 240 789 247
CccagctctcagcttcaccctgtcttccttcttgtgcagATG
LysGlnThrAspSerLeuVal
ATGGTGAACTTCTACAACAATTACATTTCCTGCACCAAC~G~C~CCTGTCCC~GTG 849 267 MetVa1AsnpheTyrAsnAsnTyrI1eSerCYSThrASnLYsAl~snLeuserG1nVa1 853 GCCGgtaggtggggtgtgagcggccaagggggccgaagggggagggcctCactCgggaCC 268 Ala c a t a c c t g c t g c t c c c t g g a c a g A C C A T C T G G A T C A C A T c M ~ A ~ T ~ A ~ A G c c A G A891 281 spHisLeuAspHisIleLysGluValAlaGlYAlaArS 929 GCCGTGGGTTTTGGTGGGGACTTTGATGGTGTTcc~~taaggggctgagagctctgtc 293 AiavaiGlyPheGlyGlyAspPheASPGlY~~~~rOAr ctgtggatgagccgggaggttcatggcctcgtcagagggatgaggtggctggaggaggga
cctgtgtcctagtgtgggggcccaggttctcctggcctcaacacag~TCCCTGA~ gValProGluGly
942
CTGGAGGACGTCTCCAAGTATCCAGACCTGATCGCTGAGCTGCTCA~AG~CTGGACG
1002
LeuGluAspValSerLysTyrProAspLeulleAlaGluLeuLeuArgArgAsnTrpThr
318 1062
GAGGCGGAGGTCAAGGGCGCACTGGCTGACkACCTGCTGAGGGTCTTCGAGGCTGTGTG~
298
GluAlaGluValLysG1yAlaLeuAl~spAsnLeuLeuArgValPheGluA11ValGlu
338
CAGgtgaggatggggtgaccgcctgagtctccccccccaccaccagcagacagactgccC cacccgtgtctgtctgtccccagGCCAGCAACCTCACACAGGCTCCCGAGGA~A~CC
1065 339 1101
AlaSerAsnLeuThrGlnAlaProGluGluGluPro ATCCCGCTGGACCAGCTGGGTGGCTCCTGCAGGACCCCATTACGGCTACTCCTCT~GGCT
1161
Gln
351
371 IleProLeuAspGlnLeuGlyGlySerCysArgThrHisTyrGlyTyrSerSerGlyAla TCCAGCCTCCATCGCCACTGGGGGCTCCTGCTCCTGCTGGCCTCCCTC~TCCCCT~TCCTCTGT 1221 391 SerSerLeuHisArgHisTrpGlyLeuLeuLeuAlaSerLeuAlaProLeuValLeuCys 1233 CTGTCTCTCCTGtgaaacctgggagaccagagtCcccctttagggttcccggagctccggg LeuSerLeuLeu*** aagacccgcccatcccaggactccagatgccaggagccctgctgcccacatgcaaggacc
395
agcatctcctgagaggacgcctgggcttacctgsgggggcaggatgcctggggacagttca ggacacacacacagtaggcccgcaataaaagcaacacccccttcacatcctggggtacgtg
tcatcggcatccggctcaggaggtggggtgttttgtgaaaattgctcctggttggacgtg
gggcactcctgtgatcc Figure 2. Nucleotide sequence of human genomic RDP gene and ita deduced amino acid sequence. Coding sequences of exon8 are shown in capital letters and are numbered beginning with the initiation codon ATG.Amino acid residues are numbered as -16 with amino-terminal methionine. Introns and noncoding sequences of exons are shown in lowercase letters. The stop codon is indicated by ***, the TATA box is boxed,and the potential polyadenylation signal is underlined.
cycle sequencingmethod (Lee et al., 1992) (Figure 2). The completesequence of the humanRDP cDNA was encoded in these two BamHI fragmentstogether with nine introns.
These results show that clone 512 containsthe entire gene for RDP,consisting of ten exons and nine introns with a total length of approximately 6 kb, and that these nine
Bbtechnol. Rug., 1994, Vol. 10, No. 2
198
ligation
\
Figure 3. Human RDP cDNA expression plasmid construction.A human RDP cDNA expression plasmid was constructed.SpeI and SalI linkers were introduced in turn into PstI and Sac1 sites of plambda3-1. The DNA fragment prepared from the resulting plasmid by digestion with SpeI and SalI contained the complete coding sequence of the RDP cDNA. This fragment was subcloned into the eukaryotic expression plasmid, pMM324.
introns were conserved with 5'GT-AG3' structure, as shown in Table 1. Human RDP cDNA has been cloned previously by Adachi et al. (1990); however, the cDNA sequence from X 3-1 differs slightly from the previously reported sequence. The bases at positions (as indicated by arrows in Figure 1and Table 2) 305,374,375,433, and 523 were G, G, G, T, and G, respectively, in the sequence reported by Adachi et al. (1990). These changes may represent an allelic variant, resulting in the changes Metlo2-Arg,Ile125-Arg, ProlG-Ser, and Serl'S-Ala. We compared the nucleotide sequence of X 3-1with that of the genomic DNA obtained above and with those of other mammalian RDP cDNAs. On the basis of these comparisons, these differences are spread across three exons. The bases at these positions and the deduced amino acid residues are well conserved inporcinecDNA(SatohetaL,1990),rabbitcDNA(Igarashi and Karniski, 19911, mouse cDNA (Satoh et al., 19931, and human genomic DNA, as shown in Table 2. These results suggat that the bases at positions 305,374,375, 433, and 523 in human RDP might be T, T, T, T, and G. This means that the differences in cDNA sequences may
represent not an allelic variant but a cloning artifact. The wild-typesequence for human RDP may be that of genomic DNA, as determined here. To study the expression of the human RDP cDNA, the full-length RDP cDNA from plambda3-1 was subcloned into the eukaryotic expression plasmid pMM324 as shown in Figure 3. The subcloned RDP cDNA was expressed under the regulation of the mouse metallothionein promoter (Durham et al., 1980). The constructed plasmid pDHP8 was transfected into mouse L929 cells (ATCCNo. CCLl, derived from mouse L cell@. The transfected L929 cells produced 1pg RDP/2.5 X 1Vcells on the cell surface, but the parent L929 cells did not produce RDP at all. By cilastatin Sepharose (Kropp et al., 1982) affinity chromatography, the recombinant human RDP was purified to homogeneity asjudged by SDS-PAGE (Laemmli, 1970) (Figure 4). The& value for glycyldehydrophenylalanine was 330 pM. This value is almost the same as that for native human RDP (230 pM) (Adachi et al., 1989). The apparent molecular weight was estimated to be 59 OOO by SDS-PAGE under reducing conditions. Furthermore, we estimated the molecular weight of human RDP to be
Bbtdtt?d. Prog., 1994, Vd. 10, NO. 2
1 2 3
4 ,
VmmF
5 6
139
7
- - T
e 97K 66K
45K
+31K Figure 4. SDS-PAGE of recombinant human RDP. Human recombinant RDP purified from L929 cells transfected with pDHP8 was subjected to 10% SDS-PAGE, performed essentially as described by Laemmli (1970), under both reducing and nonreducing conditions. Lanes 1and 7: MW markers. Lanes 2, 4, and 5: Recombinant human RDP (nonreduced, reduced, glycopeptidase F-treated reduced). Lanes 3 and 6: Human kidney RDP (nonreduced and reduced).
9.5Kb 7.5Kb
w
+
4.4Kb 2.4Kb
___)
1.35Kb->
Figure 5. Northern blotting analysis of poly(A)+RNA from human tissues. The pre-transblotted filter with poly(A)+RNA from several human tissues (Clontech)was hybridized with 32Plabeled human RDP cDNA. The positions of the molecular weight markers are indicated by arrows.
120 OOO by SDS-PAGE under nonreducing conditions and by gel filtration HPLC (data not shown). These results show that human RDP exists in a two-subunit structure linked by disulfide bonds. The deglycosylated RDP treated with glycopeptidase F has almost the same molecular weight, 42 000 (Adachi et al., 1989), as that of
porcine RDP determined by SDS-PAGE. Therefore, the differences in molecular weight between various RDPs depend on additional sugar moieties. The amino-terminal amino acid sequence of the recombinant ,RDP was determined by the Edman method (Edman and Begg, 1967). The 10initial amino-terminal amino acid residues are in agreement with the amino acid terminal sequence of native human RDP. Northern hybridization analysis of various tissues using the RDP cDNA probe is shown in Figure 5. Northem blotting analysis only identified RDP mRNA in the kidney, but RDP has been identified in the lung of rat (Farrell et al., 1987) and sheep (Campbell et al., 1990). Hirota et al. (1986) revealed that rat RDP mainly exists in lung; however, human RDP mRNA is mainly transcribed in kidney. A t present, the reason for this discrepancy is not clear. However, our findings for human cDNA and genomic DNA make it possible to analyze both the transcriptional regulation of the RDP gene and the function of RDP in vivo.
Literature Cited Adachi, H.; Kubota, I.; Okamura, N.; Iwata, H.; Tsujimoto, M.; Nakazato, H.; Nishihara, T.; Noguchi, T. Purification and characterization of human microsomal dipeptidase. J. Biochem. 1989,105,957-96. Adachi, H.; Tawaragi, Y.; Inuzuka, C.; Kubota, I.; Tsujimoto,M.; Nishihara, T.; Nakazato, H. Primary structure of human microsomal dipeptidase deduced from molecular cloning. J. Biol. Chem. 1990,265,3992-3995. Campbell, B. J.; Lin, Y.-C.;Bird, M. E. Renal aminopeptidaseand copper-activatedpeptide hydrolysis. J.Biol. Chem. 1963, 238,3632-3639. Campbell, B. J.; Baker, S. F.; Shukla, S. D.; Forrester, L. J.; Zahlen, W. L. Bioconversion of leukotriene D4 by lung dipeptidase. Biochim. Biophys. Acta 1990,1042,107-112. Durham, D. M.; Perrin, F.; Gannon, F.; Palmiter, R. D. Isolation and characterization of the mouse metallothionein-1gene. R o c . Natl. Acad. Sci. U.S.A. 1980, 77,6511-6515. "an, P.; Begg, G. A protein sequenator. Eur. J. Biochem. 1967, 1, 80-91. Fanell, C. A,; Allegretto, N. J.; Hitchcock, J. M. Cilastachinsensitive dehydropeptidase I enzymes from three sources all catalyzecarbapenemhydrolysis and conversionof leukotriene E4.Arch. Biochem. Biophys. 1987,256,253-259. Graham, F. L.; van der Eb, A. A new technique for the assay of infectivity of human adenovirus 5 DNA. Virology 1973,52, 456-467. Hirota, T.; Nishikawa, Y.;Tanaka, M.;Igarashi, T.; Kitagawa, H Characterizationof dehydropeptidase I in rut lung. Eur. J. Biochem. 1986,160,521-525. Hitchcock, M. J. M.; Farrell, C. A.; Huybensz, S.; Luh,B.-Y.; Phelps, D. J. Affinity purification of renal dipeptidase solubilized with detergent. Anal. Biochem. 1987,163,219-223. Hooper, N. M.; Turner, A. J. Isolation of two differentially glycosylated forms of peptidyl-dipeptidase A (angiotensin converting enzyme) from pig brain. Biochem. J. 1987, 244, 625-633. Igarashi, P; Karniski, L. P. Cloning of cDNAs encoding a rabbit renal brush border membrane protein immunologicallyrelated to band 3. Biochem. J. 1991,280,71-78. Kelly, R. B.; Cozzarelli, N. R.; Deutacher, M. P.; Lehman, I. R.; Komberg, A. Enzymatic synthesis of deoxyribonucleic acid. J. Biol. Chem. 1970,245, 39-45. Kropp, H.; Sundelof, J. G.; Hajdu, R.; Kahar, F. H.Metabolism of thienamycin and related carbapenem antibiotics by the renal dipeptidase,dehydropeptidase-I. Antimicrob. Agents Chemother. 1982,22,62-70. Laemmli, U. K. Cleavage of structural proteinduringthe assembly of the head of bacteriophageT4. Nature (London) 1970,227, 680-685.
BkmcMoI. Rog., 1994, Vol. 10, No, 2
140
Lee,L.G.; Connel, C. R.; Woo, 5.L.;Cheng, R. D.; McArdle, B. F.; Fuller, C. W.;Halloran, N. D.; Wilson, R. K. DNA sequencing with dye-labeled terminatore and T7 DNA polymerase. Nucleic Acide Res. 1992,20,2471-2483. Phelps, 0.J.; Gaeta, F. C. A. A convenient synthesis of glycyl(,9-aryl)-dehydroalaninalanin. Synthesis 1982,3,234-235. Rached, E.;Hooper, N.M.; Jamee, P.; Semenza, G.; Tumer, A. J.;Mantei, N. cDNA cloning and expression in Xenopus laeuis oocyte of pig renal dipeptidaw, a glycosyl-phoephatidylinwitolanchored ectoenzyme. Biochem. J. 1990,271,755-760. Sanger, F.; Nicklen, S.;Couleon, A. R. DNA sequencing with chain terminatinginhibitor. Proc. Natl. Acad Sci. U.S.A.1977,
74,5463-5467.
Satoh, S.;Koyama,S.;Ohteuka, K.; Keida, Y.; Kobayashi, M.; Niwa, M.; Shibayama,F. Molecular cloning and expression of human and porcine renal dipeptidase. Seikagaku 1990,62,
766.
Satoh,S.;Keida,Y.;Konta,Y.;Maeda,M.;Mataumoto,Y.;Niwa, M.; Koheaka, M. Purification and molecular cloning of mouse renal dopeptidam. Biochim. Biophys. Acta 1998,1163,234-
242. Accepted November 4,1993.0 0 Abstract published in Advance ACS Abstracts, December 15, 1993.
