glucans: Impact of Thio-Bridges on Immunostimulating Activities and

Article pubs.acs.org/jmc

Oligo-β-(1 → 3)-glucans: Impact of Thio-Bridges on Immunostimulating Activities and the Development of Cancer Stem Cells Balla Sylla,†,‡ Laurent Legentil,†,‡ Sujata Saraswat-Ohri,§ Aruna Vashishta,§ Richard Daniellou,∥ Hsei-Wei Wang,⊥ Vaclav Vetvicka,*,# and Vincent Ferrières*,†,‡ †

Ecole Nationale Supérieure de Chimie de Rennes, CNRS, UMR 6226, 11 Allée de Beaulieu, CS 50837, 35708 Rennes Cedex 7, France ‡ Université européenne de Bretagne, 5 Boulevard Laënnec, 35000 Rennes, France § Department of Neurological Surgery, University of Louisville, 220 Abraham Flexner Way, 15th Floor, Louisville, Kentucky 40202, United States ∥ Institut de Chimie Organique et Analytique, Université d’Orléans, CNRS, UMR 7311, BP 6759, Rue de Chartres, 45067 Orléans Cedex 2, France ⊥ Lab of Systems Biomedicine, Institute of Microbiology and Immunology, Genome Research Center, Department of Research and Development, National Yang Ming University,, Taipei City Hospital, No. 155, Sec 2, Li-Nong Street, Taipei 112, Taiwan # Department of Pathology, University of Louisville, 627 South Preston Street, Louisville, Kentucky 40292, United States S Supporting Information *

ABSTRACT: Recent developments of innovative anticancer therapies are based on compounds likely to stimulate the immune defense of the patients. β-(1 → 3)-Glucans are natural polysaccharides well-known for their immunostimulating properties. We report here on the synthesis of small oligo-β(1 → 3)-glucans characterized by thioglycosidic linkages. The presence of sulfur atom(s) was not only crucial to prolong in vivo immunoactive activities in time, compared to native polysaccharides, but sulfur atoms also had a direct impact on the development of colorectal cancer stem cells. As a result, a short, pure, and structurally well-defined trisaccharidic thioglucan demonstrated similar activities compared to those of natural laminarin.

■

approaches, it was shown that β-(1 → 3)-glucans can also act in synergy with tumor-specific antibodies.8,9 Moreover, they can find favorable effects in radio- or cardioprotection as well as in protection against infections caused by bacteria and protozoa, and many other biological properties have also been reported.10−12 It is recognized that both physicochemical and biological properties tightly depend on organisms which produce the targeted polysaccharide and on general conditions of production (salinity, temperature, harvest season). From a structural point of view, properties of β-(1 → 3)-glucans vary with the the following: molecular weight, the degree and regioselectivity of branching that are species specific, the solubility in water, the tridimensional conformation and related changes between triple helix, single helix or random coils, the dispersity, the batch homogeneity, and of course, the purity. Although these polysaccharides are considered as nondigestible carbohydrates, they can be fragmented in vivo into smaller

INTRODUCTION The immunostimulating ability of β-(1 → 3)-glucans, which were first used as folk medicine in Chinese populations and further identified in fungi, yeasts, and seaweeds, is now well established.1 It was subsequently shown that they interact with specific receptors such as the complement receptor 3 (CR3), dectin-1, lactosylceramides, and scavengers belonging to the family of acetylated or oxidized low density lipoproteins.2−5 The corresponding biological cascades are therefore activated and induce the production of effectors, for example, nuclear factor-κB (NF-κB), tumor necrosis factor-α (TNF-α), interleukins, interferons α and γ, thus resulting in the stimulation of macrophages, monocytes, dendritic cells, and neutrophils in mammals. These immunostimulating properties of β-(1 → 3)glucans have led to a great array of applications for the development of immunotherapies in order to enhance the natural ability of the immune system to fight against diseases or to relieve the patients of the side effects associated with severe treatments. For instance, lentinan is used against colorectal and gastro-intestinal cancers,6 whereas schizophyllan is preferred for the treatment of stomach and uterus cancers.7 In more recent © 2014 American Chemical Society

Received: March 31, 2014 Published: September 30, 2014 8280

dx.doi.org/10.1021/jm500506b | J. Med. Chem. 2014, 57, 8280−8292

Journal of Medicinal Chemistry

Article

thioacetal must be first prepared to further react with an electrophilic species presenting a leaving group at the 3-center. This synthetic pathway was thus applied for the synthesis of 1− 4 starting from peracetylated glucans (Scheme 1). Tri- and tetraglucans 1 and 2, containing one thioglycosidic linkage, were thus obtained from peracetylated laminaribiose and laminaritriose 5 and 12, respectively. After bromination of the reducing anomeric center, the bromide in 6 and 13 was substituted by thioacetate anion according to a SN2 mechanism. Specific deacylation of 7 and 14 was further performed with cysteamine in acetonitrile. The resulting hemithioacetal 8 and 15 were subsequently activated by deprotonation with sodium hydride in the presence of 1,7,10-trioxa-4,13-diazacyclopentadecane, a crown ether called Kryptofix 21. Nucleophilic substitution of the trifluoromethanesulfonyl group in allofuranosyl derivative 919 afforded the desired intermediates building blocks 10 and 16, respectively. Even if stability of glycosyl thiols is not guaranteed, only the desired β-anomers were obtained, as certified by NMR data (JH1b‑H2b = 10.0 Hz for both glucans) The subsequent removal of all protecting groups was based on a three-step procedure: an acidic hydrolysis of both isopropylidene protections, which also resulted in a ring extension of the reducing residue, a peracetylation required for efficient chromatographic purification (compounds 11 and 17), and finally a Zemplen transesterification. A similar synthetic scheme was applied for glucans 3 and 4; however, this scheme was characterized by the presence of two thioglycosidic linkages, respectively, starting from the known derivative 1819 and building block 11 previously obtained. Overall yields reach 24% for 3 and 4 starting from 18 and 23, respectively. Biological Evaluations. With the synthetic thioglucans in hand, we first focused on evaluation of their impact on phagocytic ability. The effects of glucans on phagocytosis are well established.20 As β-(1 → 3)-glucans stimulate primarily cellular immunity, phagocytosis is the reaction of choice for assessment of the immunostimulation activity of glucan or glucan-based molecules. Testing both the stimulation of peritoneal macrophages and peritoneal blood neutrophils and monocytes, we used synthetic microspheres based on 2hydroxymethyl methacrylate. Our results showed strong effects of 2, 3, and 4 in all experimental designs and also in a lower extent for compound 1 (Figure 2A). As it is known that the effects of one application are usually short-lived and that a significant decrease of activities can be observed already after 48 h after application, we tested the possibility that substitution of O-glycosidic linkage by thio-bridges led to an increased lifetime of our samples. When we measured the phagocytic activity 3 days after a single application, we found almost identical effects when compared to 24 h (Figure 2B), suggesting that our thioglucans survived for a longer duration and therefore can stimulate the immune system for a longer period of time. At the same time, all compounds 1−4 caused an influx of peritoneal macrophages (data not shown). It is also established that glucans and oligosaccharides cause stimulation of formation and/or secretion of various cytokines.15 To determine if our samples influenced the cytokine production, we measured the immunostimulating activity through the production of IL-2 by splenocytes and through the levels of IL-1β and TNF-α in peripheral blood. Our data, summarized in Figure 3, showed that oligosaccharides 1, 2, and 4 stimulated the production of tested cytokines, with tetrasaccharide 4 being consistently the most active one.

polymers by fermentation by the intestinal microbial flora and/ or within macrophages after internalization.2 These studies led to an ambivalent conclusion. Large β-(1 → 3)-glucans can directly elicit the immune response, and partial degradation may interestingly extend the desired activity. However, random hydrolysis occurs, especially by endoglucanases, thus resulting in an uncontrolled variety of compounds with uncertain activities and in a damaging loss of the desired immunostimulating ability. In this context, we have initiated a program dealing with the use of synthetic and structurally well-defined oligo-β-(1 → 3)-glucans, mannose- and mannitol-conjugates, and we have shown that linear penta- and hexasaccharides have biological properties in vivo at least equivalent to those of various natural poly-β-(1 → 3)-glucans.13−16 In this study, we anticipate that the substitution of O-glycosidic linkages by thiobridges will positively increase lifetime of glucans and therefore biological impact in vivo. Indeed, it is known that thioglycosides are more stable than their O-counterparts against acidic or enzymatic conditions and that this chemical modulation has only minor impact on the tridimensional arrangement.17,18 Moreover, on the assumption that thioglucans are potentially more stable, we also hypothesize that the biological efficiency of the target thioglucans will be preserved even if the saccharidic chain length is shortened compared to that of oligoglucans previously studied and that systematic substitution is not required. Therefore, we have designed two families of tri- and tetrasaccharides (Figure 1): the first one presents only one

Figure 1. Chemical structure of potent immunostimulating oligo-β-(1 → 3)-thioglucans.

sulfur atom connecting the two residues close to the reducing end (mimics of laminaritriose 1 and laminaritetraose 2), and the second one contains two successive sulfur bridges (mimics of laminaritriose 3 and laminaritetraose 4).

■

RESULTS AND DISCUSSION Chemistry. Two main strategies were envisaged for the introduction of a sulfur atom between two glucosyl entities. The first one relies on a standard glycosylation reaction based on a glucopyranosyl donor and an acceptor bearing a thiol function on position 3. Unfortunately, the desired iterative approach,16 using either ethyl thioglucoside or a trichloroacetimidate, was not efficient. The second strategy was first described by Defaye and co-workers:19 a nucleophilic hemi8281



Article

Scheme 1. Synthesis of the Mono- and Dithioglucansa

Experimental conditions: (a) HBr, 33%, 0 °C; (b) KSAc, DMF; (c) H2NCH2CH2SH, CH3CN; (d) NaH, THF, Kryptofix 21; (e) i- TFA, H2O, iiAc2O, pyridine; (f) MeONa, MeOH.

a

Previous studies using 4-deoxy-(1 → 3)-β-glucan-based oligosaccharides showed significant effects on gene expression.14 Therefore, we further evaluated these effects using human breast cancer cell line ZR-75−1 and human fibroblast cell line Detroit-573. Our RT-PCR data showed differential effects of individual oligosaccharides on individual genes (Figures 4 and 5). In the case of NF-κB, samples 1 and 2 lowered expression in fibroblast, but 1 elevated the expression in cancer cell line. Nevertheless, tetrasaccharide 4 strongly increased the expression of NF-κB in fibroblasts. Conversely, CDC42 belongs to the RHO family of proteins and is implicated in the cell growth regulation.21 In addition, its levels are elevated in numerous cancers.22 Our data showed that in fibroblast, its level was elevated by 3 and 4. However, in the cancer cell line, the level of CDC42 was significantly decreased by 2. PKC is a family of serine/threonine kinases involved in numerous biological processes such as differentiation, cell proliferation, and apoptosis. The role of PKC in cancer is controversial, with findings of both elevated and suppressed expression.23 In fibroblasts, PKC expression was elevated by all oligosaccharides (in the case of 3, nonsignificantly), and in breast cancer cells, we also found significant elevation by all samples. We also focused our attention on CDC25, which activates cyclin-dependent kinases by removing phosphate from residues in the CDK active site. The CDC25s are protooncogenes in humans and have been shown to be overexpressed in a number of cancers.24 In the fibroblast cell line, samples 1, 2, and 3 strongly inhibited expression of CDC25, whereas in the breast cancer cells, these effects were negligible.

As the lipopolysaccharide (LPS) contamination might influence the effects of any biologically active molecule, we measured the possible LPS contamination employing an EToxate assay. All the samples showed LPS levels below 0.01 EU/mL. In addition, we added a 10 μg/mL solution of polymyxin B to our samples and performed the phagocytic assay again. As the results were identical to the results obtained with untreated samples (data not shown), we did not use polymyxin B in any additional assays. Finally, colorectal cancer (CRC) is one of the most common cancers worldwide. In Taiwan, for example, colon cancer is not only the most prevalent cancer but also the third most fatal one. Tumor recurrence after surgery and distant CRC liver metastasis represents crucial transitions in disease development and progression25 and has profound impacts on patient survival for not only CRC but also a wide variety of cancers. Evidence suggests that a small population of cancer cells within tumor tissues possesses characteristics reminiscent of those of normal stem cells. These cells, which are called cancer-initiating cells or cancer stem cells (CSCs), are more malignant and resistant to current chemo-radiotherapy methods. CSCs therefore are recognized as the cell source of cancer initiation, recurrence, and distant metastasis.26 It is urgent to develop new therapeutic approaches for targeting colon CSCs, or colonosphere cells since they intend to form spheres in serum-free culture medium.27 Therefore, β-(1 → 3)-glucans were assessed for their potency in inhibiting colon CSC-mediated tumor formation and/or metastasis, using a serum-free culture system that enables us to isolate colonospheres from primary CRC tissues and cell lines.22 Two cell-lines from human colon adenocarcinoma were probed: HCT15 and HT29 spheres. In 8282



Article

Figure 2. Stimulation of peritoneal macrophages and peritoneal blood neutrophils and monocytes (A) 24 h, (B) 3 days, after injection of thioglucans 1−4. Cells with three or more particles were considered positive. As a control, mice were injected with PBS. The results represent the mean of three independent experiments ± SD. All differences were significant at P < 0.05 level.

Figure 3. Production of cytokines IL-1β, TNF-α, and IL-2 by thioglucans 1−4. As a control, mice were injected with PBS. The results represent the mean of three independent experiments ± SD. All differences were significant at P < 0.05 level.

■

both cases, laminaritriose and laminaripentaose exhibited low to moderate but promising activities (Figure 6). Laminarin, the natural polymer isolated from Laminaria digitata, was the most effective natural compound, showing interesting properties with concentration as low as 10 μg/mL and a maximum dose/ response at 100 μg/mL. The observed activities were further compared to those obtained from the non hydrolyzable thioglucan 3, characterized by two thioglycosidic linkages. It is even noteworthy that this trisaccharide demonstrated the most striking results, being the most potent oligosaccharide and even better than the natural laminarin, despite its short size and molecular weight. Once again, the presence of sulfur atoms was crucial for biological activity. Such promising results pave the way for the development of immunomodulating oligosaccharides in the fight of cancer. Future experiments will provide indications onto the molecular pathways linked either to CSCs renewal and drug resistance that could determine specific tumor behaviors and new targets for further therapeutic studies. Receptors for effective polysaccharides will also be explored.

CONCLUSION In this study, we designed and synthesized small oligo-β-(1 → 3)-glucans characterized by the presence of one or two Sglycosidic bounds, and we evaluated their biological properties. These pure and structurally well-defined tri- and tetrasaccharides exhibit very interesting immunostimulating abilities, right from the triglucoside. We thus demonstrated for the first time that very small glucans are as active as polyglucans in vivo and that immunostimulating abilities are prolonged in time. These results have to be connected with the presence of at least one thioglycosidic linkage. Although it was quite difficult to propose structure−activity relationships, all compounds 1−4 are activators or inactivators on gene expression depending on the structure. Very interestingly, thioglucan 3, which is hardly hydrolyzable owing to the presence of two thioglycosidic bounds, significantly suppresses spheroid formation and proliferation of colon cancer stem-like cells from human colon adenocarcinoma. 8283



Article

CRMPO on a flash EA1112 CHN/O microanalyzer and/or 1H NMR data (see Supporting Information). To determine the purity of the final compounds 1−4, high-performance liquid chromatography (HPLC) experiments were conducted using the Agilent 1200 HPLC system (Shimadzu), equipped with LabSolution software, a microvacuum degasser, a quartenary pump, an autosampler , a thermostatic column compartment, a diode array detector, and an analytical Alltech Prevail carbohydrate ES column (Analytical, 4.6 × 250 mm, 5 μm, Grace Davison Product Lines) at 40 °C. All compounds tested in biological assays were ≥95% pure (Supporting Information). General Procedure for Bromination (A). To a solution of peracetylated derivative in dichloromethane (1 mL) was added dropwise 33% HBr in AcOH, and the resulting mixture was stirred at 0 °C for 3 h. Then, dichloromethane (10 mL) was added, and the resulting organic layer was washed with cold water (2 × 5 mL) and brine (5 mL), dried (MgSO4), and concentrated under reduced pressure. The residue was purified by column chromatography. General Procedure for Thioacylation (B). Potassium thioacetate (2 equiv) was added to a solution of glycosyl bromide (1 equiv) in dimethylformamide, and the suspension was stirred overnight at room temperature. Solvent was removed under reduced pressure, and H2O and dichloromethane were added to the reaction mixture. Sodium persulfite was added, and the biphasic solution was brought to reflux. After 12 h, the reaction was allowed to cool, and H2O and dichloromethane were added. The resulting organic layer was dried (MgSO4), filtered, and evaporated to dryness. The product was purified by chromatography. General Procedure for Selective Deacylation (C). 2-Aminoethanethiol (1.1 equiv) was added to a solution of peracylated thioacetate (1 equiv) in acetonitrile. The mixture was stirred at 65 °C for 10 min and concentrated when TLC monitoring indicated completion of the reaction. The residue was further dissolved into dichloromethane and washed with H2O, then concentrated, and the crude product was finally purified by column chromatography. General Procedure for Coupling (D). Sodium hydride 60% (1.5 equiv) was added to a solution of the corresponding hemithioacetal (1 equiv) in dry THF at 0 °C. The suspension was stirred under N2 until hydrogen formation has ceased. To this solution, 1,7,10-trioxa-4,13diazacyclopentadecane (Kryptofix 21, 0.18 equiv) and a solution of the electrophile (1.1 equiv) in THF were added, and the mixture was stirred at RT under N2. When TLC indicated the disappearance of the nucleophilic compound, the mixture was concentrated under reduce pressure, and the residue was diluted with dichloromethane, washed with water, dried (MgSO4), and concentrated. The crude product was purified by column chromatography. General Procedure for Hydrolysis/Acetylation (E). A solution of the required precursor in a mixture of CF3COOH/H2O (4:1, 26 mL) was stirred at RT, for 1 h. Concentration under reduced pressure of the mixture gave a brown residue, which was submitted to standard acetylation (1:1 Ac2O/pyridine). Column chromatography yielded the expected compound. General Procedure for Final Deacylation (F). To a solution of the peracetylated precursor dissolved in anhydrous methanol (2 mL) was added a 0.1 M solution of sodium methylate in methanol (0.1 equiv). The mixture was stirred at RT until no starting product was detected by TLC. Neutralization was subsequently carefully performed by adding IR-120 (H+ form). The resin was further filtered off, and the solvent was removed under reduced pressure. The desired product was purified by size exclusion chromatography over Sephadex G-25 gel eluting with water. Sequence for the Synthesis of 1. 2,3,4,6-Tetra-O-acetyl-β-Dglucopyranosyl-(1 → 3)-2,4,6-tri-O-acetyl-β-D-glucopyranosyl bromide (6). General procedure A starting from 516 (10.2 g, 15.03 mmol), HBr in AcOH (30 mL, 180.36 mmol) afforded 6 (9.05 g) in 86% yield. TLC (3:7 AcOEt/petroleum ether); Rf 0.3; 1H NMR (CDCl3, 400 MHz): δ 6.50 (d, 1H, J1a,2a 4 Hz, H-1a), 5.15 (t, 1H, J2b,3b, J3b,4b 9.6 Hz, H-3b), 5.10 (t, 1H, J3a,4a, J4a,5a 9.6 Hz, H-4a), 5.07 (dd, 1H, J4b,5b 9.6 Hz, H-4b), 4.89 (dd, 1H, J1b,2b 8.0 Hz, H-2b), 4.80 (dd, 1H, J2a,3a 9.6 Hz, H-2a), 4.67 (d, 1H, H-1b), 4.37 (dd, 1H, J6b,6′b 12.4 Hz, J5b,6b 2.4 Hz, H-6b), 4.23−4.15 (m, 1H, H-5a), 4.13 (dd, 1H, H-3a), 4.10−4.05

Figure 4. Evaluation of effects of thio-derivatives 1−4 on gene expression using human breast cancer cell line ZR-75−1. As a control, mice were injected with PBS. The results represent the mean of three independent experiments ± SD. All differences were significant at P < 0.05 level.

Figure 5. Evaluation of effects of thio-derivatives 1−4 on gene expression and human fibroblast cell line Detroit-573. As a control, mice were injected with PBS. The results represent the mean of three independent experiments ± SD. All differences were significant at P < 0.05 level.

■

EXPERIMENTAL SECTION

General Methods. All reactions were performed under nitrogen atmosphere unless otherwise stated. Reactions were monitored by TLC on E. Merck 60 F254 Silica Gel non-activated plates and compounds were revealed by UV absorption and/or charring with a 5% solution of H2SO4 in EtOH followed by heating. Preparative chromatography was conducted on Geduran Si 60 (40−63 μm) Silica Gel. Optical rotations were measured on a PerkinElmer 341 polarimeter. 1H, 13C, HSQC COSY, TOCSY NMR spectra were recorded at the ENSCR on a Bruker Avance III. Chemical shifts are given in δ units (ppm) measured downfield from the solvent signal. The HRMS were performed at the CRMPO (Centre Régional de Mesures physiques de l’Ouest, University of Rennes 1, France) with a MS/MS ZabSpec TOF Micromass by ESI in positive mode. Purity of the compounds was estimated by elemental analyses recorded at the 8284



Article

Figure 6. Trisaccharide 3 and laminarin suppress spheroid formation and proliferation of colon cancer stem-like cells. Left: photographic images of spheroid morphology. Scale bar = 50 μm. *: p < 0.05; **: p < 0.01. Right: a histogram showing spheres formed per 10̂4 seeded cells. (m, 2H, H-6a, H-6′a), 4.08 (dd, 1H, J5b,6′b 4.4 Hz, H-6′b), 3.74 (ddd, 1H, H-5b), 2.15−1.97 (7s, 21H, CH3CO2); 13C NMR (CDCl3, 100 MHz): δ 170.7−168.7 (CO), 100.7 (C-1b), 87.3 (C-1a), 76.5 (C-3a), 72.4 (C-5a, C-3b), 72.3 (C-2a), 71.7 (C-5b), 71.3 (C-2b), 67.8 (C4b), 66.6 (C-4a), 61.6 (C-6b), 61.0 (C-6a), 20.8−20.3 (CH3). 2,3,4,6-Tetra-O-acetyl-β-D-glucopyranosyl-(1 → 3)-1,2,4,6-tetraO-acetyl-1-thio-β-D-glucopyranose (7). Compound 7 was obtained according to general procedure B starting from 6 (1.49 g, 2.13 mmol), potassium thioacetate (0.49 g, 4.26 mmol). A chromatographic purification (AcOEt/petroleum ether, 2:3) afforded 7 (1.27 g) in 85% yield. TLC (2:3 AcOEt/petroleum ether); Rf 0.3; 1H NMR (CDCl3, 400 MHz): δ 5.14 (d, 1H, J1a,2a 10.8 Hz, H-1a), 5.12 (dd, 1H, J2b,3b 9.2 Hz, J3b,4b 9.6 Hz, H-3b), 5.11 (dd, 1H, J2a,3a 9.2 Hz, H-2a), 5.05 (dd, 1H, J4b,5b 9.2 Hz, H-4b), 4.98 (dd, 1H, J3a,4a 9.2 Hz, J4a,5a 10.0

Hz, H-4a), 4.88 (dd, 1H, J1b,2b 8.0 Hz, H-2b), 4.60 (d, 1H, H-1b), 4.37 (dd, 1H, J6a,6′a 12.4 Hz, J5a,6a 4.4 Hz, H-6a), 4.18 (dd, 1H, J5b,6b 4.8 Hz, H-6b), 4.10−4.05 (m, 1H, H6′b), 4.02 (dd, 1H, H-6′a), 3.93 (t, 1H, H-3a), 3.79−3.75 (m, 1H, H-5a), 3.69−3.66 (m, 1H, H-5b), 2.36 (s, 3H, CH3COS), 2.13−1.98 (7s, 21H, CH3CO2); 13C NMR (CDCl3, 100 MHz): δ 192.6 (SCO), 170.7−168.7 (CO), 100.9 (C-1b), 80.0 (C-1a), 76.5 (C-3a, C-5a), 72.0 (C-3b), 71.8 (C-5b), 70.5 (C-2a, C3a), 67.9 (C-4b), 67.6 (C-4a), 61.9 (C-6b), 61.6 (C-6a), 30.9 (CH3COS), 20.9−20.3 (CH3CO2). 2,3,4,6-Tetra-O-acetyl-β-D-glucopyranosyl-(1 → 3)-2,4,6-tri-Oacetyl-1-thio-β-D-glucopyranose (8). The target disaccharide 8 was synthesized as described in the general procedure C starting from 728 (694 mg, 1.5 mmol) and 2-aminoethanethiol (127.6 mg, 1.65 mmol) in MeCN (10 mL). Chromatography (3:2 light petroleum ether/ 8285



Article

5.18 (dd, 1H, J2a,3a 10.8 Hz, H-2a), 5.12−5.06 (m, 2H, H-3c, H-4c), 4.98 (dd, 1H, J4a,5a 9.4 Hz, H-4a), 4.93−4.85 (m, 3H, H-2b, H-2c, H4b), 4.63 (d, 1H, J1b,2b 10.0 Hz, H-1b), 4.55 (d, 1H, J1c,2c 8.0 Hz, H1c), 4.39 (dd, 1H, J5b,6b 3.6 Hz, H-6b), 4.24 (dd, 1H, J5a,6a 4.8 Hz, H6a), 4.17−4.16 (m, 1H, H-6c), 4.09−4.08 (m, 1H, H-6′a), 4.06−4.02 (m, 2H, H-6′c, H-6′b), 3.86 (t, 1H, J3b,4b 9.2 Hz, H-3b), 3.83−3.78 (m, 1H, H-5a), 3.71−3.65 (m, 2H, H-5b, H-5c), 2.97 (t, 1H, J3a,4a 10.8 Hz, H-3a), 2.15 (s, 3H, OCOCH3), 2.14 (s, 3H, OCOCH3), 2.13 (s, 3H, OCOCH3), 2.12 (s, 3H, OCOCH3), 2.08 (s, 3H, OCOCH3), 2.07 (s, 3H, OCOCH3), 2.06 (s, 3H, OCOCH3), 2.04 (s, 3H, OCOCH3), 2.03 (s, 3H, OCOCH3), 2.00 (s, 3H, OCOCH3), 1.96 (s, 3H, OCOCH3); 13 C NMR (CDCl3, 100 MHz) 11α: δ 170.5, 170.4, 170.3, 169.8, 169.7, 169.6, 169.5, 169.4, 169.2, 169.1, 168.7, (CO), 100.2 (C-1c), 88.7 (C1aα), 81.7 (C-1b), 79.9 (C-3b), 75.6 (C-5b), 72.9 (C-3c), 71.7 (C-4b, C-5c), 71.6 (C-5a), 70.8 (C-2c), 69.9 (C-2a), 67.9 (C-4c, C-2b), 65.2 (C-4a), 62.0 (C-6c), 61.9 (C-6b), 61.6 (C-6a), 46.2 (C-3a), 20.8, 20.7, 20.6, 20.5, 20.4, 20.3, 20.2 (OCOCH3), 11β: δ 170.5, 170.4, 170.3, 169.8, 169.7, 169.6, 169.5, 169.4, 169.2, 169.1, 168.7 (CO), 100.2 (C1c), 93.3 (C-1aβ), 82.6 (C-1b), 79.9 (C-3b), 75.7 (C-5b), 75.2 (C-5a), 72.9 (C-3c), 71.7 (C-5c), 71.1 (C-2a), 70.9 (C-2b, C-2c), 65.7 (C-4a), 65.2 (C-4b, C-4c), 62.3 (C-6c), 62.1 (C-6b), 62.0 (C-6a), 49.9 (C-3a), 20.8, 20.7, 20.6, 20.5, 20.4, 20.3, 20.2 (OCOCH3). β-D-Glucopyranosyl-(1 → 3)-β-D-glucopyranosyl-(1 → 3)-3deoxy-3-thio-β-D-glucopyranose (1). Compound 1 was prepared according to general procedure F starting from 11 (100 mg, 0.1 mmol) dissolved in anhydrous methanol (2 mL), a 0.1 M solution of sodium methylate in methanol (0.1 equiv). Size exclusion chromatography yielded the required trisaccharide 1 as colorless oil (40.6 mg, 78%). TLC (3:3:2, AcOEt/i-PrOH/H2O) Rf 0.2; [α]D20 −21.2 (c 1.0, CHCl3); 1H NMR (CD3OD, 400 MHz) α/β ratio 0.6:1 (from NMR integration of H-1 signal), 1α: δ 5.11 (d, 1H, J1aα,2aα 3.6 Hz, H1aα), 4.62 (d, 1H, J1b,2b 9.6 Hz, H-1b), 4.57 (d, 1H, J1c,2c 7.6 Hz, H1c), 3.89 (dd, 1H, J6c,6′c 11.6 Hz, J5c,6c 2.0 Hz, H-6c), 3.87 (dd, 1H, J6b,6′b 12.0 Hz, J5b,6b 2.0 Hz, H-6b), 3.85−3.81 (m, 1H, H-5a), 3.74 (dd, 1H, J6a,6′a 11.2 Hz, J5a,6a 4.4 Hz, H-6a), 3.67 (dd, 1H, H-6′b), 3.65 (dd, 1H, H-6′c), 3.59 (t, 1H, J3b,4b 8.8 Hz, H-3b), 3.51 (dd, 1H, H-6′a), 3.49−3.44 (m, 2H, H-2b, H-4b), 3.39 (t, 1H, J3c,4c 9.2 Hz, H-3c), 3.37 (t, 2H, J2a,3a, J4a,5a 9.6 Hz, H-2a, H-4a), 3.39−3.35 (m, 1H, H-5b), 3.33−3.26 (m, 3H, H-2c, H-4c, H-5c), 3.12 (dd, 1H, J3a,4a 10.4 Hz, H3a); 1β: δ 4.63 (d, 1H, J1b,2b 9.6 Hz, H-1b), 4.57 (d, 1H, J1c,2c 7.6 Hz, H-1c), 4.49 (d, 1H, J1aβ,2aβ 7.6 Hz, H-1aβ), 3.89 (dd, 1H, J6c,6′c 11.6 Hz, J5c,6c 2.0 Hz, H-6c), 3.87 (dd, 1H, J6b,6′b 12.0 Hz, J5b,6b 2.0 Hz, H-6b), 3.86 (dd, 1H, J6a,6′a 11.2 Hz, J5a,6a 2.0 Hz, H-6a), 3.69 (dd, 1H, H-6′a), 3.67 (dd, 1H, H-6′b), 3.65 (dd, 1H, H-6′c), 3.59 (t, 1H, J3b,4b 8.8 Hz, H-3b), 3.49−3.44 (m, 2H, H-2b, H-4b), 3.39 (t, 1H, J3c,4c 9.2 Hz, H3c), 3.39−3.31 (m, 2H, H-4a, H-5a), 3.39−3.35 (m, 1H, H-5b), 3.33− 3.26 (m, 3H, H-2c, H-4c, H-5c), 3.23 (dd, 1H, J2a,3a 10.8 Hz, H-2a), 2.79 (t, 1H, J3a,4a 10.0 Hz, H-3a); 13C NMR (CD3OD, 100 MHz) 1α: δ 102.7 (C-1c), 91.4 (C-1aα), 85.2 (C-3b), 84.2 (C-1b), 79.3 (C-5b), 78.3 (C-5c), 75.9 (C-3c), 75.5 (C-5a), 73.4 (C-2b), 72.2 (C-2c), 70.5 (C-2a), 69.5 (C-4c), 67.0 (C-4b), 66.9 (C-4a), 60.9 (C-6c), 60.8 (C6b), 60.6 (C-6a), 50.9 (C-3a); 1β: δ 102.7 (C-1c), 96.9 (C-1aβ), 85.2 (C-3b), 84.2 (C-1b), 79.3 (C-5b), 78.3 (C-5c), 75.9 (C-3c), 75.5 (C5a), 73.2 (C-2b), 72.1 (C-2c), 69.5 (C-2a, C-4c), 67.8 (C-4b), 67.0 (C-4a), 60.9 (C-6c), 60.8 (C-6b), 60.6 (C-6a), 54.2 (C-3a). HMRS (ESI+) m/z: [M + Na]+ calcd for C18H32O15NaS, 543.13596; found, 543.1367. Sequence for the Synthesis of 2. 2,3,4,6-Tetra-O-acetyl-β-Dglucopyranosyl-(1 → 3)-2,4,6-tri-O-acetyl-β-D-glucopyranosyl-(1 → 3)-2,4,6-tri-O-acetyl-α-D-glucopyranosyl bromide (13). Trisaccharide 13 (119 mg, 80%) was isolated as a colorless oil according to general procedure A and starting from peracetylated laminaritriose 1216 (141 mg, 0.15 mmol) and 33% HBr in AcOH (1.5 mL, 12 equiv). TLC 1 (3:2, toluene/AcOEt): Rf 0.3; [α]20 D +18.9 (c 1.0, CHCl3); H NMR (CDCl3, 400 MHz): δ 6.52 (d, 1H, J1a,2a 3.6 Hz, H-1a), 5.12 (dd, 1H, J1c,2c 8.4 Hz, J2c,3c 9.2 Hz, H-2c), 5.06 (dd, 1H, J4c,5c 9.6 Hz, J3c,4c 9.4 Hz, H-4c), 5.04 (t, 1H, J3a,4a, J4a,5a 9.6 Hz, H-4a), 4.93 (dd, 1H, J6a,6′a 11.2 Hz, J4b,5b 9.6 Hz, H-4b), 4.90 (dd, 1H, J1b,2b 8.0 Hz, J2b,3b 9.6 Hz, H-2b), 4.88 (dd, 1H, H-3c), 4.78 (dd, 1H, J2a,3a 10.0 Hz, H-2a), 4.53 (d, 1H, H-1b), 4.50 (d, 1H, H-1c), 4.37 (dd, 1H, J6b,6′b 12.4 Hz, J5b,6b

AcOEt) yielded 8 as white solid (75 mg, 77%). TLC (3:2 light petroleum ether/AcOEt); Rf 0.3; [α]20 D −18 (c 1.0; CHCl3); mp: 98− 100 °C; 1H NMR (CDCl3, 400 MHz): δ 5.12 (t, 1H, J2b,3b, J3b,4b 9.2 Hz, H-3b), 5.06 (t, 1H, J4b,5b 9.2 Hz, H-4b), 4.98 (t, 1H, J3a,4a, J4a,5a 9.6 Hz, H-4a), 4.96 (dd, 1H, J1a,2a 10.4 Hz, J2a,3a 9.6 Hz, H-2a), 4.90 (dd, 1H, J1b,2b 8.0 Hz 9.2 Hz, H-2b), 4.60 (d, 1H, H-1b), 4.40 (t, 1H, J1a,SH 10.4 Hz, H-1a), 4.37 (dd, 1H, J6b,6′b 12.4 Hz, J5b,6b 2.4 Hz, H-6b), 4.16−4.10 (m, 2H, H-6a, H-6′a), 4.02 (dd, 1H, H-6′b), 3.84 (t, 1H, H3a), 3.69−3.66 (m, 2H, H-5a, H-5b), 2.29 (d, 1H, SH), 2.96 (s, 3H, OCOCH3), 2.08 (s, 3H, OCOCH3), 2.07 (s, 3H, OCOCH3), 2.02 (s, 3H, OCOCH3), 2.01 (s, 3H, OCOCH3), 2.00 (s, 3H, OCOCH3), 1.97 (s, 3H, OCOCH3); 13C NMR (CDCl3, 100 MHz): δ 170.7, 170.4, 170.3, 169.4, 169.3, 169.2, 169.1 (CO), 100.9 (C-1b), 79.8 (C-3a), 78.8 (C-1a), 76.3 (C-5a), 75.0 (C-2a), 72.9 (C-3b), 71.7 (C-5b), 71.0 (C-2b), 67.9 (C-4b), 67.8 (C-4a), 62.2 (C-6b), 61.6 (C-6a), 21.7, 20.8, 20.6, 20.5, 20.4, 20.3 (OCOCH3). HRMS (ESI+) m/z: [M + Na]+ calcd for (C26H36O17NaS), 675.15709; found, 675.1572. 2,3,4,6-Tetra-O-acetyl-β-D-glucopyranosyl-(1 → 3)-2,4,6-tri-Oacetyl-β-D-glucopyranosyl-(1 → 3)-1,2:5,6-di-O-isopropylidene-3deoxy-3-thio-β-D-glucofuranose (10). According to the general procedure D, the desired trisaccharide was obtained starting from the nucleophile 8 (720 mg, 1.1 mmol) in THF (12 mL) containing sodium hydride (39.8 mg, 1.65 mmol), 1,7,10-trioxa-4,13-diazacyclopentadecane (Kryptofix 21, 4.3 mg, 0.18 equiv) and a solution of 919 (0.48 g, 1.2 mmol) in THF (8 mL). The desired product 10 (804 mg, 86%) was purified by column chromatography (3:2 toluene/AcOEt). TLC (3:2 toluene/AcOEt): Rf 0.4; mp: 108−110 °C; [α]20 D −28.5 (c 1.0, CHCl3); 1H NMR (CDCl3, 400 MHz): δ 5.81 (d, 1H, J1a,2a 3.6 Hz, H-1a), 5.12 (dd, 1H, J3c,4c 9.6 Hz, J2c,3c 9.4 Hz, H-3c), 5.06 (dd, 1H, J4c,5c 9.6 Hz, H-4c), 5.00 (dd, 1H, J1b,2b 10.2 Hz, J2b,3b 10.1 Hz, H2b), 4.93 (dd, 1H, J4b,5b 9.6 Hz, J3b,4b 9.4 Hz, H-4b), 4.89 (dd, 1H, H2c), 4.85 (t, 1H, J2a,3a 3.6 Hz, H-2a), 4.60 (d, 1H, J1c,2c 8.0 Hz, H-1c), 4.58 (d, 1H, H-1b), 4.38 (dd, 1H, J6b,6′b 12.4 Hz, J5b,6b 4.2 Hz, H-6b), 4.32−4.20 (m, 2H, H-4a, H-5a), 4.23 (dd, 1H, J6c,6′c 12.4 Hz, J5c,6c 2.4 Hz, H-6c), 4.11 (dd, 1H, H-6′c), 4.10 (dd, 1H, J6a,6′a 8.8 Hz, J5a,6a 4.6 Hz, H-6a), 4.03 (dd, 1H, H-6′b), 4.00 (dd, 1H, H-6′a), 3.89 (dd, 1H, H-3b), 3.70−3.62 (m, 2H, H-5c, H-5b), 3.52 (dd, 1H, J3a,4a 3.7 Hz, H3a), 2.14 (s, 3H, OCOCH3), 2.07 (s, 3H, OCOCH3), 2.03 (s, 3H, OCOCH3), 2.01 (s, 3H, OCOCH3), 2.00 (s, 6H, OCOCH3), 1.97 (s, 3H, OCOCH3), 1.50 [s, 3H, C(CH3)2], 1.41 [s, 3H, C(CH3)2], 1.33 [s, 3H, C(CH3)2], 1.31 [s, 3H, C(CH3)2]; 13C NMR (CDCl3, 100 MHz): δ 170.5, 170.4, 170.3, 169.3, 169.2, 169.1, 168.7 (CO), 111.9, 109.4 (2 CIV), 104.8 (C-1a), 100.9 (C-1c), 86.1 (C-2a), 82.8 (C-1b), 80.1 (C-4a), 79.9 (C-3b), 76.3 (C-5b), 73.7 (C-5a), 72.9 (C-3c), 71.7 (C-5c), 71.2 (C-2b), 71.0 (C-2c), 67.9 (C-4b, C-4c), 67.2 (C-6a), 62.2 (C-6c), 61.6 (C-6b), 49.9 (C-3a), 26.8, 26.5, 26.3, 25.3 [C(CH3)2], 20.9, 20.7, 20.6, 20.5, 20.4, 20.3 (OCOCH3). Microanalysis: Calcd for C38H54O22S: C, 51.00; H, 6.08; S, 3.58. Found: C, 50.53; H, 6.06; S, 3.42. 2,3,4,6-Tetra-O-acetyl-β-D-glucopyranosyl-(1 → 3)-2,4,6-tri-Oacetyl-β-D-glucopyranosyl-(1 → 3)-1,2,4,6-tetra-O-acetyl-3-deoxy3-thio-α,β-D-glucopyranose (11). The target compound 11 was obtained according to general procedure E starting from 10 (1.74 g, 1.95 mmol) and CF3COOH/H2O (4:1, 26 mL). Acetylation was performed using 1:1 Ac2O/pyridine (3 mL). Column chromatography (2:3, cyclohexane/AcOEt) afforded the expected trisaccharide 11 (1.3 g, 70%) as colorless oil. TLC (2:3, cyclohexane/AcOEt): Rf 0.3, [α]20 D − 22.1 (c 1.0, CHCl3), α/β ratio 1.6:1 (from NMR integration of H-1 1 signal), H NMR (CDCl3, 400 MHz) 11α: δ 5.81 (d, 1H, J1aα,2aα 3.2 Hz, H-1aα), 5.10−5.02 (m, 4H, H-4c, H-3c, H-4a, H-2a), 4.93−4.85 (m, 3H, H-2b, H-4b, H-2c), 4.72 (d, 1H, J1b,2b 10.0 Hz, H-1b), 4.56 (d, 1H, J1c,2c 8.4 Hz, H-1c), 4.36 (dd, 1H, J5b,6b 4.0 Hz, H-6b), 4.24 (dd, 1H, J5a,6a 4.8 Hz, H-6a), 4.17−4.16 (m, 2H, H-6′a, H-6c), 4.13−4.11 (m, 1H, H-6′c), 4.06−4.04 (m, 1H, H-5a), 4.05−4.02 (m, 1H, H-6′b), 3.90 (t, 1H, J3b,4b 9.2 Hz, H-3b), 3.71−3.65 (m, 2H, H-5b, H-5c), 3.17 (t, 1H, J3a,4a 11.2 Hz, H-3a), 2.15 (s, 3H, OCOCH3), 2.14 (s, 3H, OCOCH3), 2.13 (s, 3H, OCOCH3), 2.12 (s, 3H, OCOCH3), 2.08 (s, 3H, OCOCH3), 2.07 (s, 3H, OCOCH3), 2.06 (s, 3H, OCOCH3), 2.04 (s, 3H, OCOCH3), 2.03 (s, 3H, OCOCH3), 2.00 (s, 3H, OCOCH3), 1.96 (s, 3H, OCOCH3); 11β: δ 5.59 (d, 1H, J1aβ,2aβ 8.0 Hz, H-1aβ), 8286



Article

4.0 Hz, H-6b), 4.34 (dd, 1H, J6c,6′c 12.4 Hz, J5c,6c 4.8 Hz, H-6c), 4.22 (dd, 1H, J5a,6a 4.4 Hz, H-6a), 4.21−4.19 (m, 1H, H-5a), 4.15 (dd, 1H, H-3a), 4.14−4.11 (m, 1H, H-6′a), 4.10 (dd, 1H, H-6′c), 4.04 (dd, 1H, H-6′b), 3.82 (dd, 1H, H-3b), 3.73−3.65 (m, 2H, H-5b, H-5c), 2.21 (s, 3H, OCOCH3), 2.09 (s, 3H, OCOCH3), 2.08 (s, 3H, OCOCH3), 2.07 (s, 3H, OCOCH3), 2.04 (s, 3H, OCOCH3), 2.01 (s, 3H, OCOCH3), 2.00 (s, 6H, OCOCH3), 1.99 (s, 3H, OCOCH3), 1.97 (s, 3H, OCOCH3); 13C NMR (CDCl3, 100 MHz): δ 170.5, 170.4, 170.3, 169.5, 169.4, 169.3, 169.2, 169.1, 168.8 (CO), 101.0 (C-1c), 100.7 (C1b), 87.4 (C-1a), 78.9 (C-3b), 76.1 (C-3a), 72.8 (C-2c, C-2b), 72.5 (C-5a), 72.4 (C-2a), 71.6 (C-5c, C-5b), 70.9 (C-3c), 68.0 (C-4c, C4b), 66.5 (C-4a), 61.9 (C-6c), 61.6 (C-6b), 61.1 (C-6a), 20.8, 20.7, 20.6, 20.5, 20.4, 20.3 (OCOCH3). 2,3,4,6-Tetra-O-acetyl-β-D-glucopyranosyl-(1 → 3)-2,4,6-tri-Oacetyl-β-D-glucopyranosyl-(1 → 3)-1,2,4,6-tetra-O-acetyl-1-thio-βD-glucopyranose (14). Application of the general procedure B starting from potassium thioacetate (25 mg, 0.22 mmol) and 13 (108 mg, 0.11 mmol) in DMF (2 mL) allowed the synthesis of 14 (73 mg, 68%) which was purified by chromatography (1:1, toluene/AcOEt). TLC 1 (1:1, toluene/AcOEt): Rf 0.3; [α]20 D −19,0 (c 1.0, CHCl3); H NMR (CDCl3, 400 MHz): δ 5.14 (d, 1H, J1a,2a 10.8 Hz, H-1a), 5.13 (dd, 1H, J1c,2c 8.0 Hz, J2c,3c 8.8 Hz, H-2c), 5.11 (t, 1H, J3c,4c 8.8 Hz, H-3c), 5.05 (t, 1H, J4c,5c 8.8 Hz, H-4c), 4.98 (dd, 1H, J4a,5a 9.6 Hz, J3a,4a 8.8 Hz, H4a), 4.96 (dd, 1H, J2a,3a 9.6 Hz, H-2a), 4.89 (t, 2H, J2b,3b, J4b,5b 8.8 Hz, H-2b, H-4b), 4.48 (d, 1H, H-1c), 4.45 (d, 1H, J1b,2b 8.0 Hz, H-1b), 4.38 (dd, 1H, J6a,6′a 10.4 Hz, J5a,6a 4.0 Hz, H-6a), 4.32 (dd, 1H, J6b,6′b 8.4 Hz, J5b,6b 4.4 Hz, H-6b), 4.15 (dd, 1H, J6c,6′c 10.0 Hz, J5c,6c 4.4 Hz, H-6c), 4.12 (dd, 1H, H-6′b), 4.04 (dd, 1H, H-6′c), 4.00 (dd, 1H, H6′a), 3.93 (dd, 1H, H-3a), 3.79 (dd, 1H, J3b,4b 8.0 Hz, H-3b), 3.80− 3.77 (m, 1H, H-5a), 3.76−3.67 (m, 2H, H-5b, H-5c), 2.37 (s, 3H, SCOCH3), 2.13 (s, 3H, OCOCH3), 2.09 (s, 3H, OCOCH3), 2.08 (s, 3H, OCOCH3), 2.07 (s, 3H, OCOCH3), 2.06 (s, 3H, OCOCH3), 2.02 (s, 3H, OCOCH3), 2.01 (s, 6H, OCOCH3), 1.99 (s, 3H, OCOCH3), 1.97 (s, 3H, OCOCH3); 13C NMR (CDCl3, 100 MHz): δ 192.5 (SCO), 170.7, 170.6, 170.5, 170.3, 169.4, 169.2, 169.1, 169.0, 168.9, 168.6 (CO), 101.0 (C-1c), 100.7 (C-1b), 80.1 (C-1a), 79.6 (C-3b), 79.4 (C-3a), 76.4 (C-5a), 72.8 (C-2c, C-2b), 71.7 (C-5b), 71.6 (C-5c), 70.8 (C-3c, C-2a), 67.9 (C-4c, C-4b), 67.6 (C-4a), 61.9 (C-6b, C-6c), 61.6 (C-6a), 30.8 (SCOCH3), 21.0, 20.7, 20.6, 20.5, 20.4, 20.3 (OCOCH3). 2,3,4,6-Tetra-O-acetyl-β-D-glucopyranosyl-(1 → 3)-2,4,6-tri-Oacetyl-β-D-glucopyranosyl-(1 → 3)-2,4,6-tri-O-acetyl-1-thio-β-D-glucopyranose (15). General procedure C was applied for the synthesis of 15 starting from 14 (68 mg, 0.07 mmol) in MeCN (4 mL) and 2aminoethanethiol (6 mg, 0.07 mmol). Purification by chromatography eluting with 7:3 toluene/AcOEt yielded 15 (40 mg, 62%). TLC (7:3, 1 toluene/AcOEt): Rf 0.2; [α]20 D −26.9 (c 1, CHCl3); H NMR (CDCl3, 400 MHz): δ 5.12 (dd, 1H, J2c,3c 9.6 Hz, J3c,4c 9.2 Hz, H-3c), 5.05 (dd, 1H, J1c,2c 8.0 Hz, H-2c), 4.96 (dd, 1H, J1b,2b 8.4 Hz, J2b,3b 10.0 Hz, H2b), 4.94 (dd, 1H, J4b,5b 10.4 Hz, J3b,4b 9.2 Hz, H-4b), 4.92 (dd, 1H, J4a,5a 10.4 Hz, J3a,4a 9.6 Hz, H-4a), 4.87 (dd, 1H, J4c,5c 10.8 Hz, H-4c), 4.85 (dd, 1H, J1a,2a 10.0 Hz, J2a,3a 10.8 Hz, H-2a), 4.49 (d, 1H, H-1c), 4.44 (d, 1H, H-1b), 4.37 (dd, 1H, J1a,SH 10.3 Hz, H-1a), 4.36−4.33 (m, 1H, H-6a), 4.33 (dd, 1H, J6b,6′b 8.0 Hz, J5b,6b 4.4 Hz, H-6b), 4.15−4.14 (m, 2H, H-6c, H-6′c), 4.04 (dd, 1H, H-6′b), 4.02 (dd, 1H, J6a,6′a 8.0 Hz, H-6′a), 3.83 (dd, 1H, H-3b), 3.79 (dd, 1H, H-3a), 3.70−3.65 (m, 3H, H-5a, H-5b, H-5c), 2.27 (d, 1H, SH), 2.18 (s, 3H, OCOCH3), 2.10 (s, 3H, OCOCH3), 2.08 (s, 3H, OCOCH3), 2.07 (s, 3H, OCOCH3), 2.06 (s, 3H, OCOCH3), 2.02 (s, 3H, OCOCH3), 2.01 (s, 6H, OCOCH3), 1.99 (s, 3H, OCOCH3), 1.97 (s, 3H, OCOCH3); 13C NMR (CDCl3, 100 MHz): δ 170.7, 170.6, 170.5, 170.3, 169.4, 169.2, 169.1, 169.0, 168.9, 168.6 (CO) 101.0 (C-1c), 100.7 (C-1b), 79.2 (C3a), 79.0 (C-3b), 78.7 (C-1a), 75.3 (C-5a), 75.2 (C-2b), 72.8 (C-2c), 72.6 (C-2a), 71.6 (C-5b, C-5c), 70.8 (C-3c), 68.0 (C-4b, C-4c, C-4a), 61.9 (C-6c, C-6b), 61.6 (C-6a), 21.0, 20.7, 20.6, 20.5, 20.4, 20.3 (OCOCH3). 2,3,4,6-Tetra-O-acetyl-β-D-glucopyranosyl-(1 → 3)-2,4,6-tri-Oacetyl-β-D-glucopyranosyl-(1 → 3)-2,4,6-tri-O-acetyl-β-D-glucopyranosyl-(1 → 3)-1,2:5,6-di-O-isopropylidene-3-deoxy-3-thio-β-D-glucofuranose (16). According to the general procedure D, compound

16 was obtained starting from 15 (32 mg, 0.03 mmol) in dry THF (3 mL), sodium hydride (1.5 mg, 0.05 mmol), 1,7,10-trioxa-4,13diazacyclopentadecane (Kryptofix 21, 1.34 mg, 0.18 equiv), and a solution of 9 (13.4 mg, 0.033 mmol) in THF (1 mL). The mixture was further stirred for 5 h at RT under N2. After extraction, the crude product was purified by column chromatography using 7:3 light petroleum/AcOEt to yield 16 (29 mg, 71%). TLC (7:3, light 1 petroleum/AcOEt): Rf 0.3; [α]20 D −17.5 (c 1, CHCl3); H NMR (CDCl3, 400 MHz): δ 5.81 (d, 1H, J1a,2a 3.6 Hz, H-1a), 5.12 (dd, 1H, J1d,2d 8.0 Hz, J2d,3d 9.6 Hz, H-2d), 5.09 (dd, 1H, J3d,4d 8.0 Hz, J4d,5d 9.6 Hz, H-4d), 5.01 (dd, 1H, J1b,2b 10.0 Hz, J2b,3b 9.6 Hz, H-2b), 4.93 (dd, 1H, J4c,5c 10.0 Hz, J3c,4c 8.8 Hz, H-4c), 4.91 (dd, 1H, H-3d), 4.90 (dd, 1H, J4b,5b 9.6 Hz, J3b,4b 8.8 Hz, H-4b), 4.89 (dd, 1H, J1c,2c 8.0 Hz, J2c,3c 9.6 Hz, H-2c), 4.85 (t, 1H, J2a,3a 3.6 Hz, H-2a), 4.59 (d, 1H, H-1b), 4.50 (d, 1H, H-1d), 4.45 (d, 1H, H-1c), 4.42 (dd, 1H, J6d,6′d 12.0 Hz, J5d,6d 4.0 Hz, H-6d), 4.36 (dd, 1H, J6c,6′c 12.0 Hz, J5c,6c 4.4 Hz, H-6c), 4.32−4.26 (m, 1H, H-5a), 4.24 (dd, 1H, J6b,6′b 12.4 Hz, J5b,6b 4.4 Hz, H-6b), 4.22 (dd, 1H, J4a,5a 4.4 Hz, J3a,4a 3.7 Hz, H-4a), 4.12 (dd, 1H, J6a,6′a 8.8 Hz, J5a,6a 4.4 Hz, H-6a), 4.10 (dd, 1H, H-6′b), 4.06 (dd, 1H, H-6′c), 4.05 (dd, 1H, H-6′d), 4.00 (dd, 1H, H-6′a), 3.90 (dd, 1H, H3b), 3.81 (dd, 1H, H-3c), 3.69−3.64 (m, 3H, H-5b, H-5c, H-5d), 3.52 (dd, 1H, H-3a), 2.16 (s, 3H, OCOCH3), 2.11 (s, 3H, OCOCH3), 2.07 (s, 6H, OCOCH3), 2.02 (s, 6H, OCOCH3), 2.01 (s, 6H, OCOCH3), 1.99 (s, 3H, OCOCH3), 1.97 (s, 3H, OCOCH3), 1.51 [s, 3H, C(CH3)2], 1.42 [s, 3H, C(CH3)2], 1.34 [s, 3H, C(CH3)2], 1.31 [s, 3H, C(CH3)2]; 13C NMR (CDCl3, 100 MHz): δ 170.6, 170.5, 170.3, 169.4, 169.2, 169.1, 168.7, 168.6 (CO), 111.9, 109.4 (2 CIV), 104.8 (C1a), 100.7 (C-1c), 100.0 (C-1d), 86.1 (C-2a), 82.7 (C-1b), 80.1 (C4a), 79.3 (C-3b, C-3c), 76.3 (C-5b), 73.7 (C-5a), 72.8 (C-2d, C-2c), 71.6 (C-2b, C-5d), 71.5 (C-5c), 70.8 (C-4c, C-4b), 68.4 (C-3d), 68.3 (C-4d), 67.3 (C-6a), 62.3 (C-6b), 61.9 (C-6c), 61.6 (C-6d), 49.9 (C3a), 26.8, 26.6, 26.3, 25.3 [C(CH3)2], 21.0, 20.7, 20.6, 20.5, 20.4, 20.3 (OCOCH3). 2,3,4,6-Tetra-O-acetyl-β-D-glucopyranosyl-(1 → 3)-2,4,6-tri-Oacetyl-β-D-glucopyranosyl-(1 → 3)-2,4,6-tri-O-acetyl-β-D-glucopyranosyl-(1 → 3)-1,2,4,6-tetra-O-acetyl-3-deoxy-3-thio-α,β-D-glucopyranose (17). Tetrasaccharide 17 was prepared according to general procedure E starting from 16 (28.7 mg, 0.024 mmol) and CF3COOH/ H2O (4:1, 1 mL), and then 1:1 Ac2O/pyridine (1 mL). Flash chromatography gave the expected tetrasacharide 17 (15.6 mg, 51%). TLC (2:3, cyclohexane/AcOEt); 1H NMR (CDCl3, 400 MHz) α/β ratio 2:1 (from NMR integration of H-1 signal): δ 6.27 (d, 1H, J1aα,2aα 3.2 Hz, H-1aα), 5.59 (d, 1H, J1aβ,2aβ 8.0 Hz, H-1aβ), 5.17 (dd, 1H, J2aβ,3aβ 10.8 Hz, H-2aβ), 5.09 (dd, 1H, J3aα,4aα 11.2 Hz, J4aα,5aα 9.2 Hz, H-4aα), 5.08 (t, 2H, J3d,4d 9.6 Hz, H-3dα, H-3dβ), 5.06 (t, 2H, J4d,5d 10.4 Hz, H-4dα, H-4dβ), 5.04 (dd, 1H, J2aα,3aα 9.2 Hz, H-2aα), 5.02 (dd, 1H, J4aβ,5aβ 10.4 Hz, J3aβ,4aβ 10.0 Hz, H-4aβ), 4.96−4.84 (m, 10H, H-2bα, H-2bβ, H-2dα, H-2dβ, H-2cα, H-2cβ, H-4bα, H-4bβ, H-4cα, H-4cβ), 4.70 (d, 1H, J1bα,2bα 10.0 Hz, H-1bα), 4.62 (d, 1H, J1bβ,2bβ 10.0 Hz, H-1bβ), 4.47 (d, 2H, J1d,2d 8.0 Hz, H-1dα, H-1dβ), 4.42 (d, 1H, J1cα,2cα 8.4 Hz, H-1cα), 4.40 (d, 1H, J1cβ,2cβ 7.6 Hz, H-1cβ), 4.39 (dd, 2H, J5d,6d 3.6 Hz, H-6dα, H-6dβ), 4.34−4.29 (m, 4H, H-6bα, H-6bβ, H-6cα, H-6cβ), 4.24 (dd, 1H, J5aβ,6aβ 4.8 Hz, H-6aβ), 4.21 (dd, 1H, J5aα,6aα 4.4 Hz, H-6aα), 4.18−4.10 (m, 6H, H-6′aα, H-6′bα, H-6′bβ, H6′cα, H-6′cβ, H-6′aβ), 4.08−4.05 (m, 2H, H-6′dα, H-6′dβ), 4.00− 3.96 (m, 4H, H-3bα, H-3bβ, H-3cα, H-3cβ), 3.87−3.79 (m, 1H, H5aα), 3.74−3.64 (m, 7H, H-5bα, H-5bβ, H-5cα, H-5cβ, H-5dα, H5dβ, H-5aβ), 3.17 (dd, 1H, H-3aα), 2.97 (dd, 1H, H-3aβ), 2.16 (s, 3H, OCOCH3), 2.12 (s, 3H, OCOCH3), 2.11 (s, 3H, OCOCH3), 2.10 (s, 3H, OCOCH3), 2.09 (s, 3H, OCOCH3), 2.08 (s, 3H, OCOCH3), 2.07 (s, 3H, OCOCH3), 2.06 (s, 3H, OCOCH3), 2.05 (s, 3H, OCOCH3), 2.03 (s, 3H, OCOCH3), 2.01 (s, 3H, OCOCH3), 2.00 (s, 3H, OCOCH3), 1.99 (s, 3H, OCOCH3), 1.96 (s, 3H, OCOCH3); 13C NMR (CDCl3, 100 MHz): δ 170.6, 170.4, 170.3, 169.5, 169.4, 169.2 169.1, 169.0, 168.7, 168.6, 168.3 (CO), 101.0 (C-1dα, C-1dβ), 100.7 (C-1cα, C-1cβ), 93.5 (C-1aβ), 88.7 (C-1aα), 82.8 (C-1bα), 81.9 (C1bβ), 79.6 (C-3cα, C-3cβ), 79.3 (C-3bα, C-3bβ), 75.6 (C-5bα, C5bβ), 75.3 (C-5aβ), 72.4 (C-2cα, C-2cβ), 71.8 (C-2bα, C-2bβ), 71.6 (C-5dα, C-5dβ), 71.5 (C-5cα, C-5cβ, C-5aβ), 71.3 (C-2aβ), 70.7 (C5aα), 70.4 (C-2dα, C-2dβ), 70.1 (C-2aα), 68.4 (C-3dα, C-3dβ), 68.1 8287



Article

4.42−4.40 (m, 2H, H-1c), 4.39−4.05 (m, 6H, H-6a, H-6b, H-6c), 3.85−3.80 (m, 1H, H-5aβ), 3.70−3.64 (m, 3H, H-5aα, H-5b, H-5c), 3.17 (dd, 1H, J3aα,4aα 11.2 Hz, H-3aα), 2.97 (dd, 1H, J3aβ,4aβ 10.0 Hz, H-3aβ), 2.95−2.90 (m, 1H, H-3b), 2.15 (s, 3H, OCOCH3), 2.11 (s, 3H, OCOCH3), 2.10 (s, 3H, OCOCH3), 2.09 (s, 3H, OCOCH3), 2.08 (s, 3H, OCOCH3), 2.06 (s, 3H, OCOCH3), 2.04 (s, 3H, OCOCH3), 2.03 (s, 3H, OCOCH3), 2.01 (s, 3H, OCOCH3), 1.99 (s, 3H, OCOCH3), 1.96 (s, 3H, OCOCH3); 13C NMR (CDCl3, 100 MHz): δ 170.4, 169.5, 169.2 169.1, 168.7, 168.6, 168.3 (CO), 93.4 (C-1aβ), 88.8 (C-1aα), 84.0 (C-1c), 82.6 (C-1bα), 81.7 (C-1bβ), 75.6 (C-5b, C-5c), 75.3 (C-5aβ),72.8 (C-3c), 72.3 (C-2c), 71.8 (C-2b), 71.3 (C2aβ), 70.7 (C-5aα), 70.1 (C-2aα), 68.1 (C-4b), 65.5 (C-4aβ), 65.3 (C4c), 65.2 (C-4aα), 62.2, 61.7, 61.3 (C-6c, C-6b, C-6a), 49.7 (C-3aβ), 51.9 (C-3b), 46.1 (C-3aα), 20.8, 20.6, 20.5, 20.4, 20.3 (OCOCH3). β-D-Glucopyranosyl-(1 → 3)-3-deoxy-3-thio-β-D-glucopyranosyl(1 → 3)-3-deoxy-3-thio-α,β-D-glucopyranose (3). Final deacetylation (procedure F) of 20 (42 mg, 0.04 mmol) in anhydrous methanol (4 mL) with a 0.1 M solution of sodium methylate in methanol (0.1 equiv) and then Steric Exclusion chromatography (SEC) purification gave 3 as a colorless oil (19 mg, 84%). TLC (5:5:2, BuOH/EtOH/ H2O): Rf 0.3; 1H NMR (CD3OD, 400 MHz) α/β ratio 1:1.3 (from NMR integration of H-1 signal): δ 5.14 (d, 1H, J1aα,2aα 3.5 Hz, H-1aα), 4.64 (d, 2H, J1c,2c 9.6 Hz, H-1b), 4.63 (d, 2H, J1b,2b 9.7 Hz, H-1c), 4.51 (d, 1H, J1aβ,2aβ 7.5 Hz, H-1aβ), 3.93−3.80 (m, 5H, H-5aα, H6b, H6c), 3.86 (dd, 1H, J6aβ,5aβ 2.5 Hz, J6aβ,6′aβ 11.6 Hz, H-6aβ), 3.79−3.60 (m, 5H, H-6aα, H6′b, H6′c), 3.68 (dd, 1H, J6′aβ,5aβ 5.5 Hz, H-6′aβ), 3.51 (dd, 1H, J2aα,3aα 10.6 Hz, H-2aα), 3.45−3.30 (m, 14H, H-4aβ, H-5aβ, H-2b, H-4b, H-5b, H-3c, H-4c, H-5c), 3.36 (t, 1H, J4aα,5aα, J4aα,3aα 10.6 Hz, H-4aα), 3.28−3.22 (m, 2H, H-2c), 3.23 (dd, 1H, J2aβ,3aβ 10.0 Hz, H-2aβ), 3.13 (t, 1H, H-3aα), 2.87−2.81 (m, 2H, H-3b), 2.80 (t, 1H, J3aβ,4aβ 10.0 Hz, H-3aβ); 13C NMR (CD3OD, 100 MHz): δ 99.3 (C1aβ), 93.25 (C-1aα), 87.8, 87.5 (C-1b), 86.5 (C-1c), 83.84, 83.76 (C5b), 82.0 (C-3c), 80.4 (C-5aβ), 79.4 (C-5c), 75.3 (C-2aβ), 74.6 (C2c), 74.0, 73.8 (C-2b), 73.8 (C-5aα), 72.7 (C-2aα), 71.2 (C-4c), 69.5 (C-4aβ), 69.2 (C-4aα), 68.9 (C-4b), 63.0, 62.9, 62.8, 62.7 (C-6a, C-6b, C-6c), 58.2, 58.1 (C-3b), 56.8 (C-3aβ), 53.2 (C-3aα). HRMS (ESI+) m/z: [M + Na]+calcd for C18H32O14NaS2, 559.1131; found, 559.1201. Sequence for the Synthesis of 4. 2,3,4,6-Tetra-O-acetyl-β-Dglucopyranosyl-(1 → 3)-2,4,6-tri-O-acetyl-β-D-glucopyranosyl-(1 → 3)-2,4,6-tri-O-acetyl-3-deoxy-3-thio-1-α-D-glucopyranosyl bromide (21). Building Block 21 was synthesized according to general procedure A starting from 11 (720 mg, 0.73 mmol) in dichloromethane (2 mL) and 33% HBr in AcOH (4 mL, 12 equiv). A chromatographic purification afforded the desired bromide 21 (525 mg, 72%) as a colorless oil. TLC (3:2, petroleum ether/AcOEt): Rf 1 0.3; [α]20 D +29.7 (c 1.0, CHCl3); H NMR (CDCl3, 400 MHz): δ 6.64 (d, 1H, J1a,2a 3.6 Hz, H-1a), 5.10 (t, 1H, J2c,3c, J3c,4c 9.4 Hz, H-3c), 5.06 (t, 1H, J4c,5c 9.4 Hz, H-4c), 5.07−5.03 (m, 1H, H-4a), 4.94−4.86 (m, 2H, H-2b, H-4b), 4.89 (dd, 1H, J1c,2c 8.1 Hz, H-2c), 4.83 (dd, 1H, J2a,3a 11.3 Hz, H-2a), 4.70 (d, 1H, J1b,2b 10.1 Hz, H-1b), 4.56 (d, 1H, H-1c), 4.37 (dd, 1H, J6b,6′b 12.4 Hz, J5b,6b 4.2 Hz, H-6b), 4.29 (dd, 1H,, J6a,6′a 12.5 Hz, J5a,6a 4.2 Hz, H-6a), 4.23−4.19 (m, 1H, H-5a), 4.17 (dd, 1H, J5c,6c 5.0 Hz, H-6c), 4.12 (dd, 1H, H-6′a), 4.12−4.08 (m, 1H, H-6′c), 4.04 (d, 1H, H-6′b), 3.90 (t, 1H, J3b,4b 9.2 Hz, H-3b), 3.71−3.65 (m, 2H, H-5b, H-5c), 3.29 (t, 1H, J3a,4a 11.2 Hz, H-3a), 2.13 (s, 3H, OCOCH3), 2.10 (s, 3H, OCOCH3), 2.09 (s, 3H, OCOCH3), 2.08 (s, 3H, OCOCH3), 2.07 (s, 3H, OCOCH3), 2.01 (s, 3H, OCOCH3), 2.00 (s, 6H, OCOCH3), 1.99 (s, 3H, OCOCH3), 1.97 (s, 3H, OCOCH3); 13 C NMR (CDCl3, 100 MHz): δ 170.5, 170.4, 170.3, 169.5, 169.4, 169.3, 169.2, 169.1, 168.8 (CO), 100.8 (C-1c), 89.0 (C-1a), 81.9 (C1b), 79.9 (C-3b), 75.7 (C-5b), 72.9 (C-5a), 72.8 (C-3c), 71.7 (C-5c, C-2b), 71.3 (C-2a), 70.9 (C-2c), 67.8 (C-4c), 67.6 (C-4b), 64.4 (C4a), 62.0 (C-6c), 61.6 (C-6b), 61.4 (C-6a), 46.7 (C-3a), 20.8, 20.7, 20.6, 20.5, 20.4, 20.3 (OCOCH3). 2,3,4,6-Tetra-O-acetyl-β-D-glucopyranosyl-(1 → 3)-2,4,6-tri-Oacetyl-β-D-glucopyranosyl-(1 → 3)-1,2,4,6-tetra-O-acetyl-3-deoxy1 → 3-dithio-β-D-glucopyranose (22). According to procedure B, potassium thioacetate (196 mg, 1.72 mmol) and a solution of 21 (862 mg, 0.86 mmol) in DMF (5 mL) gave 22 (680 mg, 79%) which was purified by column chromatography (3:2, cyclohexane/AcOEt). TLC

(C-4bα, C-4bβ, C-4cα, C-4cβ), 65.3 (C-4dα, C-4dβ), 65.6 (C-4aβ), 65.3 (C-4aα), 62.1 (C-6dα, C-6dβ, C-6cα, C-6cβ), 61.6 (C-6bα, C6bβ), 61.4 (C-6aα, C-6aβ), 49.8 (C-3aβ), 46.2 (C-3aα), 20.8, 20.7, 20.6, 20.5, 20.4, 20.3 (OCOCH3). β-D-Glycopyranosyl-(1 → 3)-β-D-glucopyranosyl-(1 → 3)-β-Dglucopyranosyl-(1 → 3)-3-deoxy-3-thio-α,β-D-glycopyranose (2). Final deacetylation (procedure F) of 17 (15 mg, 0.01 mmol) in anhydrous methanol (1 mL) with a 0.1 M solution of sodium methylate in methanol (0.1 equiv), and then SEC purification gave 2 as a colorless oil (6.3 mg, 77%). TLC (3:3:2, AcOEt/i-PrOH/H2O) Rf 0.2; 1H NMR (D2O, 400 MHz) α/β ratio 1.2:1 (from NMR integration of H-1 signal), characteristic signals: δ 5.21 (d, 1H, J1aα,2aα 3.6 Hz, H-1aα), 4.74 (d, 4H, J1c,2c = J1d,2d 8.0 Hz, H-1cα, H-1cβ, H1dα, H-1dβ), 4.72 (d, 2H, J1b,2b 10.4 Hz, H-1bα, H-1bβ), 4.63 (d, 1H, J1aβ,2aβ 7.6 Hz, H-1aβ), 3.12 (dd, 1H, J3aα,4aα 11.2 Hz, H-3aα), 2.90 (dd, 1H, J3aβ,4aβ 10.4 Hz, H-3aβ), other signals 3.92−3.83 (m, 8H, H-6aα, H-6aβ, H-6bα, H-6bβ, H-6cα, H-6cβ, H-6dα, H-6dβ), 3.80−3.66 (m, 18 H, H-6′aα, H-6′aβ, H-6′bα, H-6′bβ, H-6′cα, H-6′cβ, H-6′dα, H6′dβ, H-4aα, H-4aβ, H-3dα, H-3dβ, H-4bα, H-4bβ, H-4cα, H-4cβ, H4dα, H-4dβ), 3.66−3.30 (m, 20H, H-5aα, H-5aβ, H-5bα, H-5bβ, H5cα, H-5cβ, H-5dα, H-5dβ, H-2aα, H-2aβ, H-2bα, H-2bβ, H-2cα, H2cβ, H-2dα, H-2dβ, H-3bα, H-3bβ, H-3cα, H-3cβ); 13C NMR (D2O, 100 MHz) δ 102.7 (C-1dα, C-1dβ, C-1cα, C-1cβ), 97.5 (C-1aβ), 91.3 (C-1aα), 82.9 (C-1bα), 82.0 (C-1bβ), 77.2 (C-5aα, C-5aβ, C-5bα, C5bβ, C-5cα, C-5cβ, C-5dα, C-5dβ), 74.6 (C-2aα, C-2aβ, C-2cα, C-2cβ, C-2dα, C-2dβ), 72.4 (C-2bα, C-2bβ), 71.2 (C-4aα, C-4aβ, C-4bα, C4bβ, C-4cα, C-4cβ, C-4dα, C-4dβ), 62.1 (C-6aα, C-6aβ, C-6bα, C6bβ, C-6cα, C-6cβ, C-6dα, C-6dβ), 49.9 (C-3aβ), 46.3 (C-3aα). HMRS (ESI+) m/z: [M + Na]+ calcd for C24H42O20NaS, 705.18879; found, 705.1882. Sequence for the Synthesis of 3. 2,3,4,6-Tetra-O-acetyl-β-Dglucopyranosyl-(1 → 3)-2,4,6-tri-O-acetyl-3-deoxy-3-β-D-glucopyranosyl-(1 → 3)-1,2:5,6-di-O-isopropylidene-3-deoxy-3-thio-β-D-glucofuranose (19). The required tetrasaccharide 19 was synthesized according to procedure D starting from 1819 (70 mg, 0.1 mmol) in solution in dry THF (3 mL), and a solution of 9 (45 mg, 0.12 mmol) in THF (3 mL). After workup and column chromatography using 7:3, petroleum ether/AcOEt, 19 was isolated as a colorless oil (61 mg, 67%). TLC (3:2, petroleum ether/AcOEt): Rf 0.3; 1H NMR (CDCl3, 400 MHz): δ 5.81 (d, 1H, J1a,2a 3.2 Hz, H-1a), 5.17 (t, 1H, J2c,3c, J3c,4c 9.2 Hz, H-3c), 5.06 (dd, 1H, J1b,2b 9.6 Hz, J2b,3b 10.4 Hz, H-2b), 5.04 (t, 1H, J4c,5c 9.2 Hz, H-4c), 4.89 (t, 1H, J3b,4b, J4b,5b 10.8 Hz, H-4b), 4.89 (dd, 1H, J1c,2c 10.4 Hz, H-2c), 4.83 (dd, 1H, J2a,3a 3.6 Hz, H-2a), 4.64 (d, 1H, H-1c), 4.60 (d, 1H, H-1b), 4.32−4.28 (m, 1H, H-5), 4.28− 4.08 (m, 6H, H-4a, H-6a, H-6b, H-6′b, H-6c, H-6′c), 4.00 (dd, 1H, J5a,6′a 4.8 Hz, J6a,6′a 8.8 Hz, H-6′a), 3.71 (ddd, 1H, J5c,6c 2.4 Hz, J5c,6′c 4.8 Hz, H-5c), 3.65 (ddd, 1H, J5b,6b 2.4 Hz, J5b,6′b 7.6 Hz, H-5b), 3.53 (dd, 1H, J3a,4a 4.0 Hz, H-3a), 2.99 (dd, 1H, H-3b), 2.14 (s, 3H, CH3CO), 2.09 (s, 3H, CH3CO), 2.07 (s, 3H, CH3CO), 2.02 (s, 3H, CH3CO), 2.01 (s, 3H, CH3CO), 2.00 (s, 3H, CH3CO), 1.98 (s, 3H, CH3CO), 1.50 [s, 3H, (CH3)2C], 1.41 [s, 3H, (CH3)2C], 1.33 [s, 3H, (CH3)2C], 1.31 [s, 3H, (CH3)2C]; 13C NMR (CDCl3, 100 MHz): δ 170.6, 170.5, 170.2, 169.5, 169.3, 169.1, 168.5 (CH3CO), 111.9, 109.5 [(CH3)2C], 104.8 (C-1a), 86.1 (C-2a), 84.5, 84.3 (C-1b, C-1c), 80.1 (C-4a), 78.4 (C-5b), 76.0 (C-5c), 73.7, 73.6 (C-5a, C-3c), 71.8 (C-2c), 70.0 (C2b), 68.2 (C-4c), 67.3 (C-6a), 66.3 (C-4b), 62.5, 61.9 (C-6b, C-6c), 52.2 (C-3b), 50.1 (C-3a), 26.9, 26.6, 26.3, 25.3 [(CH3)2C]; ], 21.0, 20.7, 20.6, 20.5, 20.4, 20.3 (OCOCH3). 2,3,4,6-Tetra-O-acetyl-β-D-glucopyranosyl-(1 → 3)-2,4,6-tri-Oacetyl-3-deoxy-3-thio-β-D-glucopyranosyl-(1 → 3)-1,2,4,6-tetra-Oacetyl-3-deoxy-3-thio-α,β-D-glucopyranose (20). Procedure E, starting from 19 (53 mg, 0.06 mmol) and using CF3COOH/H2O (4:1, 4 mL), followed by acetylation (1:1 Ac2O/pyridine, 2 mL) and flash chromatography gave the expected tetrasaccharide 20 (28 mg, 44%). 1 H NMR (CDCl3, 400 MHz) α/β ratio 2:1 (from NMR integration of H-1 signal): δ 6.29 (d, 1H, J1aα,2aα 3.2 Hz, H-1aα), 5.61 (d, 1H, J1aβ,2aβ 8.0 Hz, H-1aβ), 5.19 (dd, 1H, J2aβ,3aβ 10.8 Hz, H-2aβ), 5.10 (t, 2H, J3c,4c 9.6 Hz, H-3c), 5.06 (dd, 1H, J2aα,3aα 9.2 Hz, H-2aα), 5.05−5.02 (m, 2H, H-4a), 4.96−4.84 (m, 8H, H-2b, H-2c, H-4b, H-4c), 4.73 (d, 1H, J1bα,2bα 10.0 Hz, H-1bα), 4.64 (d, 1H, J1bβ,2bβ 10.0 Hz, H-1bβ), 8288



Article

(7:3, cyclohexane/AcOEt): Rf 0.4; mp: 122−124 °C; [α]20 D − 7.2 (c 1.0, CHCl3); 1H NMR (CDCl3, 400 MHz): δ 5.18 (dd, 1H, J1a,2a 10.4 Hz, J2a,3a 10.1 Hz, H-2a), 5.10 (d, 1H, H-1a), 5.08 (t, 1H, J2c,3c, J3c,4c 9.4 Hz, H-3c), 5.06 (t, 1H, J4c,5c 9.4 Hz, H-4c), 5.03 (dd, 1H, J3a,4a 10.4 Hz, J4a,5a 9.6 Hz, H-4a), 4.94−4.89 (m, 2H, H-2b, H-4b), 4.88 (dd, 1H, J1c,2c 8.1 Hz, H-2c), 4.63 (d, 1H, J1b,2b 10.0 Hz, H-1b), 4.54 (d, 1H, H1c), 4.38 (dd, 1H, J6c,6′c 12.4 Hz, J5c,6c 4.2 Hz, H-6c), 4.21 (dd, 1H, J6a,6′a 12.5 Hz, J5a,6a 4.4 Hz, H-6a), 4.19−4.15 (m, 2H, H-6b, H-6′b), 4.08 (dd, 1H, H-6′c), 4.02 (dd, 1H, H-6′a), 3.90 (t, 1H, J3b,4b 9.2 Hz, H-3b) 3.82−3.79 (m, 1H, H-5a), 3.68−3.65 (m, 2H, H-5b, H-5c), 3.66 (t, 1H, H-3a), 2.35 (s, 3H, SCOCH3), 2.09 (s, 3H, OCOCH3), 2.10 (s, 3H, OCOCH3), 2.07 (s, 3H, OCOCH3), 2.06 (s, 3H, OCOCH3), 2.05 (s, 3H, OCOCH3), 2.01 (s, 3H, OCOCH3), 2.00 (s, 3H, OCOCH3), 1.98 (s, 3H, OCOCH3), 1.97 (s, 3H, OCOCH3), 1.95 (s, 3H, OCOCH3); 13C NMR (CDCl3, 100 MHz): δ 170.6, 170.5, 170.4, 170.3, 169.5, 169.3, 169.2, 169.1, 168.8, 168.4 (CO), 100.9 (C1c), 82.7 (C-1b), 82.2 (C-1a), 80.0 (C-3b), 78.4 (C-5a), 75.7 (C-5b), 72.8 (C-3c), 71.7 (C-2b), 71.6 (C-5c), 70.9 (C-2c), 70.1 (C-2a), 67.8 (C-4c, C-4b), 65.7 (C-4a), 62.2 (C-6b), 62.1 (C-6a), 61.5 (C-6c), 52.0 (C-3a), 30.8 (SCOCH3), 20.8, 20.7, 20.6, 20.5, 20.4, 20.3, 20.2 (OCOCH3). Microanalysis: Calcd for C40H54O25S2: C, 48.09; H, 5.45; S, 6.42. Found: C, 47.92; H, 5.58; S, 6.27. 2,3,4,6-Tetra-O-acetyl-β-D-glucopyranosyl-(1 → 3)-2,4,6-tri-Oacetyl-β-D-glucopyranosyl-(1 → 3)-2,4,6-tri-O-acetyl-3-deoxy-1 → 3-dithio-β-D-glucopyranose (23). Application of general procedure C starting from a solution of 22 (580 mg, 0.58 mmol) in acetonitrile (10 mL) and 2-aminoethanethiol (77.15 mg 0.58 mmol) gave 23 (382 mg 69%) as a white solid after chromatography eluting with 3:2 cyclohexane/AcOEt. TLC (3:2, cyclohexane/AcOEt): Rf 0.4; mp: 1 118−120 °C; [α]20 D − 16.1 (c 1.0, CHCl3); H NMR (CDCl3, 400 MHz): δ 5.12 (dd, 1H, J2c,3c 9.2 Hz, J3c,4c 9.6 Hz, H-3c), 5.08 (dd, 1H, J1a,2a 9.6 Hz, J2a,3a 10.4 Hz, H-2a), 5.06 (dd, 1H, J4c,5c 9.2 Hz, H-4c), 4.92 (dd, 1H, J3b,4b 9.2 Hz, J4b,5b 10.4 Hz, H-4b), 4.90 (dd, 1H, J4a,5a 10.4 Hz, J3a,4a 10.8 Hz, H-4a), 4.89 (t, 1H, J1b,2b, J2b,3b 10.4 Hz, H-2b), 4.88 (dd, 1H, J1c,2c 8.0 Hz, H-2c), 4.64 (d, 1H, H-1b), 4.56 (d, 1H, H1c), 4.43 (t, 1H, J1a,SH 9.6 Hz, H-1a), 4.40 (dd, 1H, J6c,6′c 12.4 Hz, J5c,6c 4.4 Hz, H-6c), 4.26 (dd, 1H, J6b,6′b 12.4 Hz, J5b,6b 5.2 Hz, H-6b), 4.24 (dd, 1H, J6a,6′a 12.4 Hz, J5a,6a 4.8 Hz, H-6a), 4.18 (dd, 1H, H-6′b), 4.12 (dd, 1H, H-6′a), 4.06 (dd, 1H, H-6′c), 3.85 (dd, 1H, H-3b), 3.70− 3.66 (m, 3H, H-5b, H-5c, H-5a), 2.94 (t, 1H, H-3a), 2.39 (d, 1H, SH), 2.09 (s, 3H, OCOCH3), 2.10 (s, 3H, OCOCH3), 2.07 (s, 3H, OCOCH3), 2.06 (s, 3H, OCOCH3), 2.05 (s, 3H, OCOCH3), 2.01 (s, 3H, OCOCH3), 2.00 (s, 3H, OCOCH3), 1.98 (s, 3H, OCOCH3), 1.97 (s, 3H, OCOCH3), 1.95 (s, 3H, OCOCH3); 13C NMR (CDCl3, 100 MHz): δ 170.7, 170.6, 170.4, 170.3, 169.5, 169.3, 169.2, 169.1, 168.9, 168.8 (CO), 100.9 (C-1c), 82.9 (C-1b), 80.7 (C-1a), 80.0 (C-3b), 78.4 (C-5a), 75.7 (C-5b), 74.8 (C-2a), 72.8 (C-3c), 71.8 (C-2b), 71.6 (C5c), 70.9 (C-2c), 68.0 (C-4b), 67.9 (C-4c), 66.0 (C-4a), 62.4 (C-6a), 62.2 (C-6b), 61.6 (C-6c), 51.8 (C-3a), 20.9, 20.8, 20.7, 20.6, 20.5, 20.4, 20.2 (OCOCH3); Microanalysis: Calcd for C38H52O24S2: C, 47.70; H, 5.48; S, 6.70. Found: C, 47.38; H, 5.61; S, 6.25. 2,3,4,6-Tetra-O-acetyl-β-D-glucopyranosyl-(1 → 3)-2,4,6-tri-Oacetyl-β-D-glucopyranosyl-(1 → 3)-2,4,6-tri-O-acetyl-3-deoxy-3thio-β-D-glucopyranosyl-(1 → 3)-1,2:5,6-di-O-isopropylidene-3deoxy-3-thio-β-D-glucofuranose (24). The required tetrasaccharide 24 was synthesized according to procedure D starting from 23 (240 mg, 0.25 mmol) in dry THF (5 mL), 1,7,10-trioxa-4,13-diazacyclopentadecane (Kryptofix 21, 9.8 mg, 0.18 equiv) and a solution of 9 (107.9 mg, 0.27 mmol) in THF (3 mL). After workup and column chromatography using 7:3, petroleum ether/AcOEt, 24 was isolated as a colorless oil (149 mg, 62%). TLC (7:3, petroleum ether/AcOEt): Rf 1 0.3; [α]20 D − 17.5 (c 1.0, CHCl3); H NMR (CDCl3, 400 MHz): δ 5.80 (d, 1H, J1a,2a 3.2 Hz, H-1a), 5.12 (t, 1H, J2d,3d, J3d,4d 9.6 Hz, H-3d), 5.08 (dd, 1H, J1d,2d 3.2 Hz, H-2d), 5.05 (t, 1H, J4d,5d 9.6 Hz, H-4d), 4.90 (dd, 1H, J3c,4c 9.2 Hz, J4c,5c 9.6 Hz, H-4c), 4.90 (dd, 1H, J1b,2b 10.4 Hz, J2b,3b 9.6 Hz, H-2b), 4.88 (dd, 1H, J1c,2c 10.0 Hz, J2c,3c 9.6 Hz, H-2c), 4.83 (dd, 1H, J3b,4b 9.2 Hz, J4b,5b 9.6 Hz, H-4b), 4.80 (dd, 1H, J2a,3a 3.6 Hz, H-2a), 4.60 (d, 1H, H-1b), 4.58 (d, 1H, H-1c), 4.54 (d, 1H, H1d), 4.38 (dd, 1H, J6b,6b′ 12.4 Hz, J5b,6b 4.4 Hz, H-6b), 4.35 (dd, 1H, J6a,6a′ 8.8 Hz, J5a,6a 4.4 Hz, H-6a), 4.32−4.28 (m, 1H, H-5a), 4.28−4.26

(m, 2H, H-6c, H-6′c), 4.26−4.22 (m, 2H, H-6d, H-6′d), 4.10 (dd, 1H, J3a,4a 4.0 Hz, J4a,5a 4.4 Hz, H-4a), 4.05 (dd, 1H, H-6′b), 4.00 (dd, 1H, H-6′a), 3.84 (dd, 1H, H-3c), 3.70−3.61 (m, 3H, H-5b, H-5c, H-5d), 3.52 (dd, 1H, H-3a), 2.92 (dd, 1H, H-3b), 2.12 (s, 3H, OCOCH3), 2.09 (s, 3H, OCOCH3), 2.08 (s, 3H, OCOCH3), 2.07 (s, 3H, OCOCH3), 2.01 (s, 6H, OCOCH3), 1.99 (s, 6H, OCOCH3), 1.98 (s, 3H, OCOCH3), 1.97 (s, 3H, OCOCH3), 1.49 [s, 3H, C(CH3)2], 1.40 [s, 3H, C(CH3)2], 1.32 [s, 3H, C(CH3)2], 1.31 [s, 3H, C(CH3)2]; 13C NMR (CDCl3, 100 MHz): δ 170.7, 170.4, 170.3, 169.5, 169.3, 169.2, 169.1, 168.8, 168.3 (CO), 111.9, 109.4 (2 CIV), 104.8 (C-1a), 100.9 (C-1d), 86.0 (C-2a), 84.8 (C-1c), 83.1 (C-1b), 80.1 (C-3c), 80.0 (C4a), 78.4 (C-5d), 75.6 (C-5b), 73.7 (C-5a), 72.8 (C-3d), 71.8 (C-2b), 71.7 (C-5c), 71.4 (C-2c), 70.9 (C-2d), 68.0 (C-4d), 67.9 (C-4c), 67.3 (C-6a), 66.3 (C-4b), 62.6 (C-6d), 62.2 (C-6c), 61.6 (C-6b), 51.9 (C3b), 50.1 (C-3a), 26.8, 26.6, 26.3, 25.3 [C(CH3)2], 20.9, 20.8, 20.7, 20.6, 20.5, 20.4, 20.3 (OCOCH3). 2,3,4,6-Tetra-O-acetyl-β-D-glucopyranosyl-(1 → 3)-2,4,6-tri-Oacetyl-β-D-glucopyranosyl-(1 → 3)-2,4,6-tri-O-acetyl-3-deoxy-3thio-β-D-glucopyranosyl-(1 → 3)-1,2,4,6-tetra-O-acetyl-3-deoxy-3thio-α,β-D-glucopyranose (25). Procedure E, starting from 24 (156 g, 0.13 mmol) and using CF3COOH/H2O (4:1, 4 mL), followed by acetylation (1:1 Ac2O-pyridine, 3 mL) and flash chromatography gave the expected tetrasaccharide 25 (86 mg, 52%). TLC (2:3, cyclo1 hexane/AcOEt): Rf 0.3; [α]20 D −18.1 (c 1.0, CHCl3); H NMR (CDCl3, 400 MHz) α/β ratio 1:1.1. (from NMR integration of H-1 signal): δ 6.27 (d, 1H, J1aα,2aα 3.6 Hz, H-1aα), 5.60 (d, 1H, J1aβ,2aβ 8.0 Hz, H-1aβ), 5.21 (dd, 1H, J2aβ,3aβ 10.8 Hz, H-2aβ), 5.10 (t, 2H, J3d,4d 9.2 Hz, H-3dα, H-3dβ), 5.09−5.07 (m, 1H, H-2aα), 5.05 (t, 2H, J1b,2b, J2b,3b 9.6 Hz, H-2bα, H-2bβ), 5.04 (t, 2H, J3c,4c, J4c,5c 9.2 Hz, H-4cα, H4cβ), 5.00 (dd, 1H, J3aα,4aα 10.0 Hz, J4aα,5aα 9.2 Hz, H-4aα), 4.95 (dd, 2H, J1c,2c 9.6 Hz, J2c,3c 10.0 Hz, H-2cα, H-2cβ), 4.93 (dd, 1H, J4aβ,5aβ 9.6 Hz, H-4aβ), 4.90 (t, 2H, J4b,5b 10.8 Hz, H-4bα, H-4bβ), 4.89 (t, 2H, J4d,5d 9.2 Hz, H-4dα, H-4dβ), 4.87 (t, 1H, J3aβ,4aβ 9.2 Hz, H-3aβ), 4.69 (d, 2H, H-1cα, H-1cβ), 4.62 (d, 2H, H-1bα, H-1bβ), 4.55 (d, 2H, J1d,2d 8.4 Hz, H-1dα, H-1dβ), 4.37 (dd, 2H, J6b,6′b 12.4 Hz, J5b,6b 4.4 Hz, H6bα, H-6bβ), 4.23−4.06 (m, 12H, H-6aα, H-6aβ, H-6cα, H-6cβ, H6dα, H-6dβ, H-6′aα, H-6′aβ, H-6′cα, H-6′cβ, H-6′dα, H-6′dβ), 4.00 (dd, 2H, H-6′bα, H-6′bβ), 3.84 (dd, 2H, H-3cα, H-3cβ), 4.82−4.80 (m, 2H, H-5aα, H-5aβ), 3.75−3.60 (m, 6H, H-5bα, H-5bβ, H-5cα, H5cβ, H-5dα, H-5dβ), 3.21 (t, 1H, H-3aα), 2.96−2.82 (m, 3H, H-3aβ, H-3bα, H-3bβ), 2.15 (s, 3H, OCOCH3), 2.09 (s, 6H, OCOCH3), 2.08 (s, 6H, OCOCH3), 2.07 (s, 9H, OCOCH3), 2.06 (s, 6H, OCOCH3), 2.03 (s, 6H, OCOCH3), 2.00 (s, 3H, OCOCH3); 13C NMR (CDCl3, 100 MHz): δ 170.7, 170.4, 170.3, 169.5, 169.3, 169.2, 169.1, 168.8, 168.3 (CO), 100.9 (C-1dα, C-1dβ), 93.3 (C-1aβ), 88.7 (C-1aα), 84.1 (C-1bβ), 82.8 (C-1bα), 80.0 (C-1cβ), 79.9 (C-1cα), 77.9 (C-3c), 77.7 (C-5d), 75.6 (C-5aβ), 75.3 (C-5aα), 72.8 (C-3d), 71.7 (C-2b, C-2c, C2d), 71.6 (C-5b, C-5c), 71.3 (C-2aβ), 70.1 (C-2aα), 67.9 (C-4b, C4c), 66.1 (C-4aβ), 65.4 (C-4d, C-4aα), 62.2 (C-6a, C-6c, C-6d), 61.6 (C-6b), 51.9 (C-3b), 50.1 (C-3a), 20.9, 20.8, 20.7, 20.6, 20.5, 20.4, 20.3 (OCOCH3). β-D-Glucopyranosyl-(1 → 3)-β-D-glucopyranosyl-(1 → 3)-3deoxy-3-thio-β-D-glucopyranosyl-(1 → 3)-3-deoxy-3-thio-α,β-D-glucopyranose (4). Final Zemplen deacetylation was performed according to procedure F starting from 25 (14 mg, 0.01 mmol) in anhydrous methanol (1 mL) and a 0.1 M solution of sodium methylate in methanol (0.1 equiv). Workup and size exclusion chromatography gave the required tetrasaccharide 4 (6.7 mg, 88%). TLC (5:5:2, BuOH/EtOH/H2O): Rf 0.2; 1H NMR (CD3OD, 400 MHz) α/β ratio 1.5:1 (from NMR integration of H-1 signal), 4α: δ 5.11 (d, 1H, J1aα,2aα 3.6 Hz, H-1aα), 4.67 (d, 1H, J1c,2c 10.0 Hz, H-1c), 4.62 (d, 1H, J1b,2b 9.6 Hz, H-1b), 4.56 (d, 1H, J1d,2d 8.0 Hz, H-1d), 3.92 (dd, 1H, J6c,6′c 12.0 Hz, J5c,6c 2.1 Hz, H-6c), 3.90 (dd, 1H, J6d,6′d 12.0 Hz, J5d,6d 2.0 Hz, H-6d), 3.89 (dd, 1H, J6b,6′b 12.4 Hz, J5b,6b 2.0 Hz, H6b), 3.80 (dd, 1H, J6a,6′a 11.6 Hz, J5a,6a 2.0 Hz, H-6a), 3.79 (dd, 1H, H6′c), 3.74 (dd, 1H, H-6′a), 3.70 (dd, 1H, H-6′b), 3.65 (dd, 1H, H6′d), 3.56 (t, 1H, J3c,4c 9.2 Hz, H-3c), 3.52 (dd, 1H, J2a,3a 10.2 Hz, H2a), 3.48−3.31 (m, 3H, H-2c, H-4c, H-5c), 3.46−3.32 (m, 3H, H-2b, H-4b, H-5b), 3.39 (dd, 1H, J2d,3d 9.2 Hz, J3d,4d 8.8 Hz, H-3d), 3.37 (dd, 1H, J3a,4a 10.8 Hz, J4a,5a 9.2 Hz, H-4a), 3.33−3.30 (m, 1H, H-5d), 8289



Article

3.32−3.30 (m, 1H, H-5a), 3.31 (dd, 1H, H-2d), 3.28 (dd, 1H, J4d,5d 9.2 Hz, H-4d), 3.14 (dd, 1H, H-3a), 2.86 (t, 1H, J3b,4b 10.0 Hz, H-3b); 4β 4.66 (d, 1H, J1c,2c 10.0 Hz, H-1c), 4.60 (d, 1H, J1b,2b 9.6 Hz, H-1b), 4.56 (d, 1H, J1d,2d 8.0 Hz, H-1d), 4.49 (d, 1H, J1aβ,2aβ 7.6 Hz, H-1aβ), 3.92 (dd, 1H, J6c,6′c 12.0 Hz, J5c,6c 2.1 Hz, H-6c), 3.90 (dd, 1H, J6d,6′d 12.0 Hz, J5d,6d 2.0 Hz, H-6d), 3.89 (dd, 1H, J6a,6′a 11.6 Hz, J5b,6b 2.0 Hz, H-6b), 3.88 (dd, 1H, J6b,6′b 12.4 Hz, J5a,6a 2.0 Hz, H-6a), 3.79 (dd, 1H, H-6′c), 3.70 (dd, 1H, H-6′a), 3.68 (dd, 1H, H-6′b), 3.65 (dd, 1H, H6′d), 3.56 (t, 1H, J3c,4c 9.2 Hz, H-3c), 3.48−3.31 (m, 3H, H-2c, H-4c, H-5c), 3.46−3.32 (m, 3H, H-2b, H-4b, H-5b), 3.40−3.30 (m, 2H, H4a, H-5a), 3.39 (t, 1H, J2d,3d, J3d,4d 9.0 Hz, H-3d), 3.33−3.30 (m, 1H, H-5d), 3.31 (dd, 1H, H-2d), 3.28 (t, 1H, J4d,5d 9.0 Hz, H-4d), 3.24 (dd, 1H, J2a,3a 10.4 Hz, H-2a), 2.86 (t, 1H, J3b,4b 10.0 Hz, H-3b), 2.80 (t, 1H, J3a,4a 10.0 Hz, H-3a); 13C NMR (CD3OD, 100 MHz): 4α: δ 105.1 (C1d), 93.2 (C-1aα), 88.8 (C-3d), 87.6 (C-1b), 85.9 (C-1c), 83.8 (C5b), 81.7 (C-5c), 81.6 (C-5a), 78.2 (C-5d), 77.8 (C-3c), 74.1 (C-2b), 74.0 (C-2c), 72.7 (C-2a), 71.5 (C-2d), 69.7 (C-4d), 69.5 (C-4c), 69.1 (C-4b), 68.8 (C-4a), 63.0 (C-6d), 62.9 (C-6c), 62.8 (C-6b), 62.6 (C6a), 58.0 (C-3b), 56.7 (C-3a); 4β: δ 105.1 (C-1d), 99.3 (C-1aβ), 88.8 (C-3d), 87.6 (C-1b), 85.9 (C-1c), 83.8 (C-5b), 81.7 (C-5c), 80.4 (C5a), 78.2 (C-5d), 77.8 (C-3c), 75.3 (C-2a), 74.1 (C-2b), 74.0 (C-2c), 71.5 (C-2d), 69.7 (C-4d), 69.5 (C-4c), 69.1 (C-4b), 68.8 (C-4a), 63.0 (C-6d), 62.9 (C-6c), 62.8 (C-6b), 62.6 (C-6a), 58.0 (C-3b), 53.2 (C3a). HRMS (ESI+)m/z: [M + Na]+ calcd for C24H42O19NaS2), 721.16594; found, 721.1661. Animals. Female, 6−8 weeks old, BALB/c mice were purchased from The Jackson Laboratory (Bar Harbor, ME, U.S.A.). All animal work was done according to the University of Louisville IACUC protocol. Animals were sacrificed by CO2 asphyxiation. Cell Lines. The human breast cancer cell line ZR-75−1 and human fibroblast cell line Detroit-573 were obtained from the American Tissue Culture Collection, ATCC (Manassas, VA, U.S.A.). The cell lines were grown in RPMI 1640 medium (HT-474 and HaCaT) or Dulbecco’s medium (Detroit 573) containing HEPES buffer supplemented with 10% heat-inactivated FCS, 2 mM L-glutamine, 100 units/mL penicillin, and 100 μg/mL streptomycin, in plastic disposable tissue culture flasks at 37 °C in a 5%, CO2/95% air incubator. Chemicals. RPMI 1640 medium, Iscoves’s modified Dulbecco’s medium, HEPES, heparine, E-Toxate, polymyxin B, and antibiotics were obtained from Sigma Chemical Co. (St. Louis, MO, U.S.A.). Fetal calf serum (FCS) was procured from Hyclone Laboratories (Logan, UT, U.S.A.). Laminarine, from Laminaria digitata, was purchased from Sigma. This is a linear β-(1 → 3)-glucan composed of 33 glucosyl units in average. Other oligo-β-(1 → 3)-glucans were purchased from Seikagaku (Coger SA, France). Phagocytosis. Peritoneal macrophages were isolated from the peritoneal cavities of mice injected 1 or 4 days previously with oligosaccharides. The cells were diluted in RPMI-1640 medium with 5% fetal calf serum (Hyclone, Logan, UT) to 1 × 107 and incubated with HEMA particles as described earlier.29 Phagocytosis and differential counts were evaluated after Giemsa staining. Macrophages with three or more HEMA particles were considered positive. Phagocytic activity in peripheral blood cells were evaluated by the same technique using one drop of peripheral blood obtained from the orbital plexus and collected into heparine. Evaluation of IL-2 Production. Purified spleen cells (2 × 106/mL in RPMI 1640 medium with 5% FCS) were added into wells of a 24well tissue culture plate. After addition of 1 μg of Concanavalin A into positive-control wells, cells were incubated for 72 h. in a humidified incubator (37 °C, 5% CO2). At the end point of incubation, supernatants were collected, filtered through 0.45 μm filters, and tested for the presence of IL-2.30 Levels of the IL-2 were measured using a Quantikine mouse IL-2 kit (R&D Systems, Minneapolis, MN). IL-β and TNF-α Assay. BALB/c mice were intraperitoneally injected with 100 μg of oligosaccharides. Control mice obtained PBS only. After different intervals, mice were sacrificed, and blood was collected in Eppendorf tubes. Subsequently, the serum was prepared, collected, and stored at −80 °C for no more than 1 week.

The levels of IL-1β and TNF-α in serum samples were evaluated using a commercial kit OptEIA Mouse IL-1β or OptEIA Mouse TNFα Set (Pharmingen, San Diego, CA, U.S.A.), respectively, according to the manufacturer’s instructions. The optical density was determined using a STL ELISA reader (Tecan U.S., Research Triangle Park, NC) at 450 nm with a correction at 570 nm. Data shown were calculated from the standard curve prepared by the automated data reduction using linear regression analysis. A standard curve was run with each assay. RNA Extraction and Reverse Transcriptase-PCR. Total RNA was extracted from control and treated cells using Trizol reagent (Life Technologies, Inc.). RNA quality and quantity were determined by ultraviolet spectrophotometry and agarose gel electrophoresis. Total RNA (200 ng) was reverse transcribed using SuperScript One-Step RT-PCR with Platinum Taq kit (Invitrogen Inc.) using gene-specific primers with the following conditions: 30 min at 50 °C followed by 2 min at 95 °C and then 25 cycles of 30 s at 95 °C, 45s at 52 °C for NFκβ2, CDC42, CDC25 and β-Actin (43 °C for CDC42), 3 min at 72 °C for NF-κβ2 (45 s for CDC42, CDC25, BCL-2, 90 s for β-Actin). PCR reaction was completed by 7 min at 72 °C. RT-PCR products were then separated on a 1.0% agarose gel, visualized under UV light and photographed. β-Actin served as internal control. Quantitative RNA Analysis. RNA was isolated from cells using TRIZOL Reagent (Invitrogen). The remaining DNA was removed by digestion with DNase I (Promega), and RNA was reverse transcribed with AMV First-Strand cDNA Synthesis Kit (Invitrogen) in the presence of random hexamers. For quantitative Real Time-PCR (qRTPCR), RT2 Real-Time SYBR Green mix (SuperArray Bioscience Corporation, Frederick, MD) and the ΔΔct method of quantification were applied. The reference RNA was β-actin. The qRT-PCR primers were as follows: β-actin 5′AATGTGGCCGAGGACTTTGATTGC3′ 5′TTAGGATGGCAAGGGACTTCCTGT3′ NF-κB2 5′ATGAGAATGGATGGCAGGCCTTTG3′ 5′CTCGCTTGCGTTTCAGTTGCAGAA3′ PKC 5′TTTCGGAGTAATCCTGCCTGGGAA3′ 5′AGGGAGGCACTGGTGGAACTTAAA3′ CDC25 5′TCAGGTGCTGTCCATGGGAAAGAT3′ 5′AACTCAACAGACTGGGCTCTTCCA3′ CDC42 5′AAGCCTATCACTCCAGAGACTGCT3′ 5′GGGCAGCCAATATTGCTTCGTCAA3′ Semiquantitative PCR was performed for NFkB, CDC42, PKC, and CDC25 using standard PCR primers. Quantification of the gel was performed by densitometric analysis with ImageJ software using standard techniques. Statistics. Student’s t test was used to statistically analyze the data. Biological Tests on Cancer Stem Cells. Colonosphere cultivation: HCT15 CRC cells were grown in Dulbecco’s Modified Eagle’s Medium (DMEM-high glucose; Gibco, Carlsbad, CA, U.S.A.) supplemented with 10% fetal bovine serum (FBS, Gibco). For cancer sphere culture, all cells were cultured in serum-free defined medium medium consisting of DMEM-F12 (Gibco) with N2 Plus Supplement (R&D, Minneapolis, MN, U.S.A.), 10 ng/mL recombinant bFGF (PeproTech Asia, Rehovot, Israel), 10 ng/mL EGF (PeproTech Asia, Rehovot, Israel), and 1% penicillin-streptomycin (Gibco). Medium was changed every 3 days. Spheres formed on day 14 were used for assays as described.31

■

ASSOCIATED CONTENT

S Supporting Information *

Supplemental 1H NMR spectra for selected compounds, protocol for chromotography, chromatograms for selected compounds. This material is available free of charge via the Internet at http://pubs.acs.org. 8290



■

Article

(11) Krosl, G.; Korbelik, M. Potentiation of photodynamic therapy by immunotherapy: the effect of schizophylalan (SPG). Cancer Lett. 1994, 84, 43−49. (12) Paunesku, T.; Mittal, S.; Proctic, M.; Oryhon, J.; Korolev, S. V.; Joachimiak, A.; Woloschak, G. E. Proliferating cell nuclear antigen (PCNA) ringmaster of the genome. Int. J. Radiat. Biol. 2001, 77, 1007−1021. (13) Saraswat-Ohri, S.; Vashishta, A.; Vetvicka, V.; Descroix, K.; Jamois, F.; Yvin, J.-C.; Ferrières, V. Biological properties of (1→3)-βD-glucan-based synthetic oligosaccharides. J. Med. Food 2011, 14, 369−376. (14) Vetvicka, V.; Saraswat-Ohri, S.; Vashishta, A.; Descroix, K.; Jamois, F.; Yvin, J.-C.; Ferrières, V. New 4-deoxy-(1→3)-β-D-glucanbased oligosaccharides and their immunostimulating potential. Carbohydr. Res. 2011, 346, 2213−2221. (15) Descroix, K.; Větvička, V.; Laurent, I.; Jamois, F.; Yvin, J.-C.; Ferrières, V. New oligo-β-(1→3)-glucan derivatives as immunostimulating agents. Bioorg. Med. Chem. 2010, 18, 348−357. (16) Jamois, F.; Ferrières, V.; Guégan, J.-P.; Yvin, J.-C.; Plusquellec, D.; Vetvicka, V. Glucan-like synthetic oligosaccharides: Iterative synthesis of linear oligo-β-(1→3)-glucans and immunostimulatory effects. Glycobiology 2005, 15, 393−407. (17) Pachamuthu, K.; Schmidt, R. R. Synthetic routes to thiooligosaccharides and thioglycopeptides. Chem. Rev. 2006, 106, 160−187. (18) Witczak, Z. J. Thio sugars: Biological relevance as potential new therapeutics. Curr. Med. Chem. 1999, 6, 165−178. (19) Contour-Galcera, M.-O.; Guillot, J.-M.; Ortiz-Mellet, C.; Pflieger-Carrara, F.; Defaye, J.; Gelas, J. Synthesis of sulfur-linked analogues of nigerose, laminarabiose, laminaratriose, gentiobiose, gentiotriose, and laminaran trisaccharide Y. Carbohydr. Res. 1996, 281, 99−118. (20) Novak, M.; Vetvicka, V. β-Glucans as biological response modifiers. Endocr., Metab. Immune Disord.: Drug Targets 2009, 9, 67− 95. (21) Lin, R.; Bagrodia, S.; Cerione, R.; Manor, D. A novel Cdc42Hs mutant induces cellular transformation. Curr. Biol. 1997, 7, 794−797. (22) Pan, Y.; Bi, F.; Liu, N.; Xue, Y.; Yao, X.; Zheng, Y.; Fan, D. Expression of seven main Rho family members in gastric. Biochem. Biophys. Res. Commun. 2004, 315, 686−691. (23) Tam, W. L.; Lu, H.; Buikhuisen, J.; Soh, B. S.; Lim, E.; Reinhard, F.; Wu, Z. J.; Krall, J. A.; Beirie, B.; Guo, W.; Chen, X.; Liu, X. S.; Brown, M.; Lim, B.; Weinberg, R. A. Protein kinase C a is a central signaling node and therapeutic target for breast cancer stem cells. Cancer Cell 2013, 24, 347−364. (24) Kristjansdottir, K.; Rudolph, J. Cdc25 phosphatases and cancer. Chem. Biol. 2004, 11, 1043−1051. (25) Lou, Z.; Meng, R. G.; Zhang, W.; Yu, E. D.; Fu, C. G. Preoperative carcinoembryonic antibody is predictive of distant metastasis in pathologically T1 colorectal cancer after radical surgery. World J. Gastroenterol. 2013, 19, 389−393. (26) Ben-Porath, I.; Thomson, M. W.; Carey, V. J.; Ge, R.; Bell, G. W.; Regev, A.; Weinberg, R. A. An embryonic stem cell-like gene expression signature in poorly differentiated aggressive human tumors. Nat. Genet. 2008, 40, 499−507. (27) Dallas, N. A.; Xia, L.; Fan, F.; Gray, M. J.; Gaur, P.; van Buren, G.; Samuel, S.; Kim, M. P.; Lim, S. J.; Ellis, L. M. Chemoresistant colorectal cancer cells, the cancer stem cell phenotype, and increased sensitivity to insulin-like growth factor-I receptor inhibition. Cancer Res. 2009, 69, 1951−1957. (28) Moreau, V.; Viladot, J.-L.; Samain, E.; Planas, A.; Driguez, H. Design and chemoenzymatic synthesis of thiooligosaccharide inhibitors of (1→3):(1→4)-β-glucanases. Bioorg. Med. Chem. 1996, 4, 1849−1855. (29) Vetvicka, V.; Dvorak, M.; Vetvickova, J.; Richter, J.; Krizan, J.; Sima, P.; Yvin, J. C. Orally-administered marine β-(1→3)-glucan Phycarine stimulates both humoral and cellular immunity. Int. J. Biol. Macromol. 2007, 40, 291−298.

AUTHOR INFORMATION

Corresponding Authors

*E-mail: [email protected]. Phone: (+33)2 23 23 80 58. *E-mail: [email protected]. Phone: (502) 8521612. Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS B.S. is grateful to the Région Bretagne for a grant. Authors thank La Ligue Contre le Cancer and Canceropole Grand Ouest (Axis Marine Products in Cancerology and MabImpact network) for financial supports. J. P. Guégan (Ecole Nationale Supérieure de Chimie de Rennes) and Arnanud Bondon (Université de Rennes 1) are sincerely acknowledged for helpful assistance in recording NMR data. We are most grateful to the PRISM core facility (Biogenouest, UMS Biosit, Université de Rennes 1, Campus de Villejean, 35043 RENNES Cedex, FRANCE) for its technical support.

■

ABBREVIATIONS USED Ac, acetyl; calcd, calculated; equiv, equivalent; ESI, electrospray ionization mass spectrometry; Et, ethyl; h, hours; HRMS, highresolution mass spectrometry; min, minutes; NMR, nuclear magnetic resonance; RT, room temperature; TFA, trifluoroacetic acid; TLC, thin-layer chromatography

■

REFERENCES

(1) Brown, G. D.; Gordon, S. Fungal β-glucans and mammalian immunity. Immunity 2003, 19, 311−315. (2) Chan, G. C.-F.; Chan, W. K.; Sze, D. M.-Y. The effects of βglucan on human immune and cancer cells. J. Hematol. Oncol. 2009, 2, doi:10.1186/1756-8722-2-25. (3) Jozefowski, S.; Yang, Z.; Marcinkiewicz, J.; Kobzik, L. Scavenger receptors and β-glucan receptors participate in the recognition of yeasts by murine macrophages. Inflamm. Res. 2012, 61, 113−126. (4) Sylla, B.; Guégan, J.-P.; Wieruszeski, J.-M.; Legentil, L.; NugierChauvin, C.; Daniellou, R.; Ferrières, V. Probing β-(1→3)-D-glucans interactions with recombinant human receptors using high resolution NMR studies. Carbohydr. Res. 2011, 346, 1490−1494. (5) Tanaka, H.; Kawai, T.; Adachi, Y.; Hanashima, S.; Yamaguchi, Y.; Ohno, N.; Takahashi, T. Synthesis of β-(1→3) oligoglucans exhibiting a Dectin-1 binding affinity and their biological evaluation. Bioorg. Med. Chem. 2012, 20, 3898−3914. (6) Ina, K.; Furutam, R.; Kataoka, T.; Kayakawa, S.; Yoshida, T.; Miwa, T.; Yamamura, Y.; Takeuchi, Y. Lentinan prolonged survival in patients with gastric cancer receiving S-1-based chemotherapy. World J. Clin. Oncol. 2011, 2, 339−343. (7) Fujimoto, S. Clinical efficacies of schizophyllan (SPG) on advanced gastric cancer. Nippon Geka Gakkai Zasshi 1989, 90, 1447− 1450. (8) Descroix, K.; Ferrières, V.; Jamois, F.; Yvin, J.-C.; Plusquellec, D. Recent progress in the field of β-(1→3)-glucans and new applications. Mini-Rev. Med. Chem. 2006, 6, 1341−1349. (9) Xiang, D.; Sharma, V. R.; Freter, C. E.; Yan, J. Anti-tumor monoclonal antibodies in conjunction with β-glucans: A novel anticancer immunotherapy. Curr. Med. Chem. 2012, 19, 4298−4305. (10) Okamura, K.; Suzuki, M.; Yajima, A.; Chihara, T.; Fujiwara, A.; Fukuda, T.; Goto, S.; Ichinohe, K.; Jimi, S.; Kasamatsu, T.; Kawai, N.; Mizuguchi, K.; Mori, S.; Nakano, H.; Noda, K.; Sekiba, K.; Suzuki, K.; Suzuki, T.; Takahashi, K.; Takeuchi, K.; Takeuchi, S.; Ogawa, N. Clinical evaluation of schizophyllan combined with irradiation in patients with cervical cancer: A randomized controlled study. Cancer 1986, 58, 865−872. 8291



Article

(30) Vetvicka, V.; Terayama, K.; Mandeville, R.; Brousseau, P.; Kournikakis, B.; Ostroff, G. Pilot study: orally administered yeast β(1→3)-glucan prophylactically protects against anthrax infection and cancer in mice. JANA 2002, 5, 1−5. (31) Hwang, W.-L.; Yang, M.-H.; Tsai, M.-L.; Lan, H.-Y.; Su, S.-H.; Chang, S.-C.; Teng, H.-W.; Yang, S.-H.; Lan, Y.-T.; Chiou, S.-H.; Wang, H.-W. SNAIL regulates interleukin-8 expression, stem cell-like activity, and tumorigenicity of human colorectal carcinoma cells. Gastroenterology 2011, 141, 279−291.

8292


glucans: Impact of Thio-Bridges on Immunostimulating Activities and

Recommend Documents