Glutathione Conjugation and DNA Adduct Formation of Dibenzo[a,l

170

Chem. Res. Toxicol. 2002, 15, 170-179

Glutathione Conjugation and DNA Adduct Formation of Dibenzo[a,l]pyrene and Benzo[a]pyrene Diol Epoxides in V79 Cells Stably Expressing Different Human Glutathione Transferases Kathrin Sundberg,† Kristian Dreij,† Albrecht Seidel,‡ and Bengt Jernstro¨m*,† Institute of Environmental Medicine, Division of Biochemical Toxicology and Experimental Carcinogenesis, Karolinska Institutet, Box 210, S-17177 Stockholm, Sweden, Biochemical Institute for Environmental Carcinogens, Prof. Dr. Gernot Grimmer-Foundation, Lurup 4, D-22927 Grosshansdorf, Germany Received July 30, 2001

Mammalian V79 cells stably expressing human glutathione transferase (GST) A1-1, M1-1, and P1-1 (the allelic variant with Val105 and Ala114) have been constructed and characterized. The cells have been used to study the capacity of individual GST isoenzymes in conjunction with GSH to detoxify diol epoxides from dibenzo[a,l]pyrene (DBPDE), the most carcinogenic polycyclic aromatic hydrocarbon (PAH) identified so far, and diol epoxides from benzo[a]pyrene (BPDE). The relationship between GSH-conjugation and DNA adduct-formation has been investigated as well as factors governing the accessibility of lipophilic diol epoxide substrates for the soluble GSTs in the cells. Relative to control cells, those expressing GSTA1-1 showed the highest rate (about 50-fold increase) to perform GSH-conjugation of (-)-anti-DBPDE (Rabsolute configuration at the benzylic oxirane carbon in the fjord-region) followed by GSTM1-1 (25-fold increase) and GSTP1-1 (10-fold increase). GSTA1-1 was found to be strongly inhibited when expressed in cells (10% of fully functional protein). Taking this factor into account, the rates of conjugation found in the cells fairly well reflected the order of catalytic efficiencies (kcat/Km) obtained with the pure enzymes. Increased GSH conjugation of (-)-anti-DBPDE was associated with a reduction in DNA adduct formation. GSTA1-1 inhibited the formation of adducts more than 6-fold and GSTM1-1 and GSTP1-1 about 2-fold. With (+)-anti-BPDE, GSTP1-1-expressing cells demonstrated a substantially higher rate of GSH-conjugate formation than cells with GSTA1-1 and GSTM1-1 cells (33- and 10-fold increase, respectively). Relative to control cells, GSTM1-1 was found to inhibit DNA adduct formation of (+)-anti-BPDE most effectively followed by GSTP1-1 and GSTA1-1 (12-, 4-, and 3-fold, respectively). Values of kcat/ Km and estimated oil/water partition coefficients of DBPDE and BPDE were used to calculate the concentration of free diol epoxides in solution and expected rates of GSH conjugate formation in cells, and these theoretical results were compared with the observed ones. With the highly reactive (+)-anti-BPDE, 1-2% of the expected activity was observed, whereas the corresponding values for the less reactive (-)-anti-DBPDE were up to 13%. The most obvious explanations for the low observed rate with (+)-anti-BPDE are rapid and competing reactions such as hydrolysis and/or more unspecific chemical and physical reactions with cellular constituents (proteins, lipids, nucleic acids, etc.). In addition, the difference between the theoretical and observed rates may also reflect participation of factors such as macromolecular crowding and reduced rates of diffusion, factors expected to further restrict the accessibility of GST and the diol epoxides in the intact cell.

Introduction Polycyclic aromatic hydrocarbons (PAHs)1 are widespread environmental pollutants and most probably * To whom correspondence should be addressed. Phone: ++46-87287576. Fax: ++46-8-334467. E-mail: [email protected]. † Karolinska Institutet. ‡ Prof. Dr. Gernot Grimmer-Foundation. 1 Abbreviations: PAH, polycyclic aromatic hydrocarbon; GST, glutathione transferase; B[a]P, benzo[a]pyrene; DBP, dibenzo[a,l]pyrene, (-)-anti-DBPDE, (11R,12S)-dihydroxy-(13S,14R)-epoxy-11,12,13,14tetrahydrodibenzo[a,l]pyrene; (+)-anti-DBPDE, (11S,12R)-dihydroxy(13R,14S)-epoxy-11,12,13,14-tetrahydrodibenzo[a,l]pyrene; (+)-antiBPDE, (7R,8S)-dihydroxy-(9S,10R)-epoxy-7,8,9,10-tetrahydrodibenzo[a]pyrene; DE, diol epoxide; DMEM, Dulbecco’s Modified Eagle Medium; CDNB, 1-chloro-2,4-dinitrobenzene; DMSO, dimethyl sulfoxide.

carcinogenic to humans (1-4). Most carcinogenic PAHs possess a bay- or a fjord-region, the latter which induces distortion of the otherwise planar molecules. A great body of experimental results shows that PAH-induced mutagenicity and carcinogenicity requires metabolic activation and subsequent DNA adduct-formation (2, 5, 6). Ultimate carcinogenic intermediates have been identified as both bay- and fjord-region diol epoxides (DEs) (3, 5). Available evidence shows that fjord-region DEs are generally more biologically active than bay-region DEs (7, 8). The most carcinogenic PAH identified so far is dibenzo[a,l]pyrene which is several orders of magnitude more potent in experimental animals than, for instance, the prototype mutagen and carcinogen benzo[a]pyrene

10.1021/tx015546t CCC: $22.00 © 2002 American Chemical Society Published on Web 01/16/2002

Dibenzo[a,l]pyrene and Benzo[a]pyrene Diol Epoxides

Chem. Res. Toxicol., Vol. 15, No. 2, 2002 171 Table 1. Sequences of Primers Used for PCR and Sequence Analysis

Figure 1. Structure and numbering system of dibenzo[a,l]pyrene and benzo[a]pyrene from which the DEs used in this study are derived. The absolute stereochemistry of the anti-DEs is shown. Arrows indicate the fjord and the bay region, respectively. a

(9-11). In contrast to the bay-region DEs, those of the fjord-region category are expected to be distorted due to the inherent steric crowding of the molecule (12). In addition to this factor, the basis for the greater potency of the fjord-region DEs may include (i) more efficient DNA adduct formation in conjunction with less efficient adduct recognition and adduct removal by DNA-repair processes, (ii) different base and reaction site preferences, and (iii) less efficient glutathione transferase (GST)mediated detoxification. Although the information from experiments with cells expressing GSTs is limited, evidence points to a key role in DE-detoxification and, thus, protection against DNAadduct-formation (13-17). The GSTs belong to a superfamily of phase II enzymes with broad and overlapping substrate specificity (18). The GST distribution and expression pattern is complex and different cell types within the same tissue often have their own distinct isoenzyme pattern, also the interindividual distribution pattern may vary, e.g., the human lung has variable expression of GST due to genetic polymorphism (19). From previous studies (20-24) with purified human GSTs and DEs, it can be concluded that fjord-region DEs are poorer substrates for GSTP1-1 and M1-1 than most of the bay-region DEs studied. In contrast, GSTA1-1 seems to conjugate fjord-region DEs, such as those derived from dibenzo[a,l]pyrene very efficiently.2 To study individual human GSTs and their role in DNA protection in a biologically relevant system, V79 cells stably expressing human GSTs A1-1, M1-1, and the P1-1Val105,Ala114 variant have been constructed. The cells were incubated with DEs of dibenzo[a,l]pyrene and, for comparison, with DEs of benzo[a]pyrene (for structures see Figure 1) and GSH conjugate- and DNA adductformation was determined. In addition, theoretical parameters relating to the intracellular accessibility of lipophilic compounds to soluble GSTs could be compared to the experimental data allowing for estimates of intracellular substrate distribution.

Materials and Methods Caution. Diol epoxides from polycyclic aromatic hydrocarbons are carcinogens, and thus experimental handling must be carried out under special safety conditions, e.g., those outlined in the NCI guidelines. Chemicals. Synthesis of the optically active anti-DEs of dibenzo[a,l]pyrene and benzo[a]pyrene has been performed according to literature methods (25, 26). The purity of the 2 Dreij, K., Sundberg, K., Johansson, A.-S., Seidel, A., Mannervik, B., Jernstro¨m, B. Manuscript in preparation.

primer

sequencea

U-GSTA L-GSTA U-GSTM L-GSTM U-GSTP L-GSTP GSTA-US GSTA-LS2 GSTM-US GSTM-LS GSTP-US GSTP-LS2

aaaaaaggtaccatatggcagag cctaggatgactgcgttattaaaa ttccgcagcaacaagcttcatgcc atggatcctgtaaaccagtcaatgctgctcc aattcaaagcttgacaaaatgccg aaaaggatcctcactgtttcccgtt tggttgagattgatgggatga acatacgggcagaaggaggat ctgccctacttgattgatggg ctggattgtagcagatcatgc cctgtaccagtccaataccat ttcacatagtcatccttgccc

Restriction enzyme sites used for cloning are underlined.

compounds used was in general >95% as determined by HPLC. Chromatographic standards of various DE derivatives were obtained as described previously (26). Construction of Expression Vectors. The mammalian expression vector pCEP4 (Invitrogen, Inc.) was modified to remove the sequence required for episomal replication in mammalian cells as previously described (27). Human GSTA1-1 and M1-1 cDNA subcloned into pGEM-3Zf vector and P11Val105,Ala114 cDNA subcloned into pKK∆Acc vector were used as templates for PCR reactions using following primers: U-GSTA and L-GSTA for GSTA1-1, U-GSTM and L-GSTM for GSTM11, and U-GSTP and L-GSTP for GSTP1-1Val105,Ala114 (Table 1). PCR reactions were performed in 1.5 mM MgCl, 0.15 mM dNTP, 10% DMSO, and 0.5 units of Taq Polymerase (Sigma-Aldrich) and were carried out in 30 cycles, each involving denaturation at 94 °C, 45 s, annealing at 60 °C, 45 s, elongation at 72 °C, 75 s, followed by a final 6 min elongation at 72 °C. The PCR products were isolated by low-melting agarose electrophoresis and subsequently purified from the gel using GFX PCR DNA and Gel Band Purification Kit (Amersham Pharmacia Biotech Inc.). The full-length GSTs were subcloned into the modified pCEP4 vector (∆pCEP4), which had been linearized with BamHI and HindIII or KPNI, and for GSTA1-1 the vector had been dephosphorylated with shrimp alkaline phosphatase. Correct base sequence in the resulting constructs (∆pCEP4GSTA1-1, ∆pCEP4GSTM1-1, and ∆pCEP4GSTP1-1Val105,Ala114) were verified by DNA sequence analysis using the following primers: GSTA-US and GSTLS2 for GSTA1-1, GSTM-US and GSTMLS for GSTM1-1, and GSTP-US and GSTP-LS2 for GSTP11Val105,Ala114 (Table 1), and BigDye Terminator cycle sequencing ready reaction kit (Perkin-Elmer) and an ABI model 373 DNA Sequencer. Transfection of V79MZ Cells. The V79MZ clone of the V79 Chinese hamster lung fibroblastoid cell line was cultivated as described (28) except that the cells were maintained in a humidified 5% CO2 atmosphere. Transfection was carried out using FuGENE6 reagent (Boehringer-Mannheim) according to manufacture instructions. Hygromycin B was added 72 h after transfection (0.7 mg/mL of growth medium). Resistant cell clones were isolated 3 weeks after transfection. In Situ Immunofluorescence. Cells were plated (1 × 105 cells/plate) in a 4-well tissue chamber (Nuc) and cultivated and treated as described (28). The fixed cells were incubated overnight at 4 °C with the immunoglobulin (IgG) anti-human GST (1:1000) from rabbit, followed by three washing cycles with PBS/1% TritonX-100 (v/v). As secondarary antibody, fluoresceinisothiocyanate (FITC)-conjugated anti-rabbit IgG from swine (DAKO) was used. Plates were mounted with Fluoromount (Southern Biotechnology Association, Inc.), covered with a glass slip and analyzed with a fluorescence microscope. Selected expressing clones were cultured and periodically checked for expression of human GST by this method. GST Activity Determination. GST activity in cytosolic fractions, obtained by brief sonication and subsequent centrifugation at 105.000g of the cell homogenate, was determined with

172

Chem. Res. Toxicol., Vol. 15, No. 2, 2002

1-chloro-2,4-dinitrobenzene (CDNB) (29). The known specific activity of each GST toward CDNB (18, 22, 30) was used to calculate the amount of active protein. The GSH and the protein content was determined by the method described in refs 31 and 32, respectively. Glutathione Transferases. Recombinant GSTA1-1, GSTM11, and GSTP1-1Val105,Ala114 were produced and treated as described (21, 23). Incubations. Enzymes and cytosolic fractions derived from V79MZ GST overexpressing cells corresponding to 5-100 µg of active protein/mL, were incubated with 2.5-40 µM anti-DBPDE for 30 s and analyzed for GSH conjugates as previously described (20, 22). Estimation of Solvolytic Reactivity and Cellular Uptake of Diol Epoxide. Rate of Solvolysis. The rate of DE solvolysis was determined by incubating DEs at 37 °C in PBS (containing 1 mg/mL glucose), pH 7.5, for various times (antiBPDE; 0, 15, 30, 45, 60 and 120 s, anti-DBPDE; 0, 15, 30 and 60 min) followed by addition of alkaline 2-mercaptoethanol cf. (33). The remaining DE was quantitated as the reaction product of 2-mercaptoethanol by HPLC (vide supra). Rate of Cellular Uptake. V79MZ cells cultured for 48 h (in 6 well plates) were washed twice with PBS following addition of 2 mL PBS (containing 1 mg/mL glucose), pH 7.5, prewarmed to 37 °C. The cells were exposed to 1 µM DE for various times (0, 15, 30, 45, 60, 120, and 300 s). The incubation medium was removed and added to alkaline 2-mercaptoethanol. The reaction mixture was concentrated using Sep-Pak Vac cartridges (C18, 3 cm3, 200 mg, Waters Inc.) and analyzed for DE derivatives by HPLC (vide supra). The difference between the amount of DE initially added and the DE and tetraols recovered in the incubation medium at each time point was assumed to reflect the intracellular concentration. Pseudo-first-order rate constants for hydrolysis and rates of cellular uptake were determined by plotting the logarithm of residual DE versus time and using the relationship

-ln(Dt/D0) ) kobs × t where the Dt/D0 is the fraction of DE remaining at time t and kobs is the observed rate constant (34). Exposure of Cells to Diol Epoxides. Cells were plated [(6 × 106/dish (φ ) 10 cm)] and cultured at 37 °C for 48 h in a humidified 5% CO2 atmosphere. Following replacement of the cell medium with 10 mL of PBS (containing 1 mg/mL glucose), pH 7.5, the cells [(14.3 ( 2.31) × 106 cells/dish] were incubated with 1 µM DE (added in 5 µL of DMSO) for different times. Following addition of alkaline 2-mercaptoethanol to trap unreacted DE the incubation medium was removed and concentrated using Sep-Pak Vac cartridges (C18, 3 cm3, 200 mg, Waters Inc.). GSH conjugates were estimated as described above. The cells were recovered and processed for DNA adduct estimation (vide infra). In some experiments, 1% SDS/Triton (1:1, v/v) was added in order to lyse the cells and allow calculation of total recovery of DE derivatives. Estimation of Cell Volume. Following trypsination V79 cells were counted and allowed to sediment in small conical tubes with known volume. Assuming that optimally packed spherical cells will occupy 52% of the volume, five independent measurements yielded 2.98 ( 0.83 µL/106 cells. Determination of DNA Adducts. Adducts Derived from BPDE. The cells were harvested in trypsin/EDTA and resuspended in PBS. DNA was isolated using GenomicPrep Cells and Tissue DNA Isolation Kit (Amersham Pharmacia) according to the manual. DNA adducts were analyzed as tetraols released following hydrolysis in dilute HCl as described (35, 36). The tetraols were analyzed by HPLC using a Nova Pak 4 µm C18 (3.9 × 150 mm analytical column, Waters Inc.) and an elution system composed of 55% methanol in water. The tetraols were identified and quantitated by comparison with authentic standards obtained by acidic hydrolysis of pure DE enantiomers. This method is not applicable for analysis of DNA adducts

Sundberg et al. derived from DBPDE since released tetraols are sensitive to acidic conditions and decompose (unpublished observations). Adducts Derived from DBPDE. DNA from cells exposed to DBPDE was isolated as described above and subjected to enzymatic hydrolysis as follows: DNA (about 0.7-1.0 mg) was incubated for at least 10 h with 250 units of bovine DNase I at 37 °C in 10 mM Tris-HCl buffer, pH 7.0 containing 10 mM MgCl2. The pH was subsequently adjusted to 8.5 by addition of Tris-HCl/MgCl2 (final concentration of 100 and 5 mM, respectively) and incubation continued for additional 24 h at 37 °C with 0.05 units of alkaline phosphodiesterase I and 5 units of alkaline phosphatase. All enzymes were supplied by SigmaAldrich. DNA adduct standards were prepared by incubating oligonucleotides, 5′-[d(CG)]6 or 5′-[d(AT)]6 in water with a 5-fold excess of (-)-anti-DBPDE (added in a small volume of tetrahydrofuran and triethylamine) overnight at 5 °C. Hydrolysis products were removed by extractions with water-saturated ethyl acetate (four times) and water-saturated diethyl ether (two times). Extent of modification was estimated by UV-spectroscopy using a molar extinction at 260 nm of 43 000 cm-1 for dAadducts and 42 000 cm-1 for dG-adducts, respectively. Following evaporation of the diethyl ether by N2, the DBPDE-modified oligonucleotides were hydrolyzed using the procedure described above for cellular DNA but omitting DNase I. Oligonucleotide and DNA adducts were analyzed by HPLC using a Dynamax RPC 5 µm, C18, 300 Å pore size 4.6 × 250 mm (Varian Associates, Inc.). The column was kept at 37 °C. The solvent system used was 0.1 M triethylammoniumacetate, pH 7.0 (solvent A) and acetonitrile (solvent B) delivered at 1.5 mL/min. The samples were eluted with linear gradients (10-29.5% B for 15 min and 29.5-40% B for 25 min). The effluent was monitored by UV at 260 nm and by fluorescence (λexcitation ) 340 nm, λemssion ) 400 nm).

Results Expression and Characterization of GST in Stably Transfected V79MZ Cells. Several hygromycin B resistant clones were selected corresponding to each of the three human GST isoenzymes (GSTA1-1, GSTM1-1, and GSTP1-1Val105,Ala114), by in situ immunofluoroscence using specific antibodies. The clones with highest expression were maintained and repeatedly checked for expression with in situ immunofluoroscence and CDNB over a period of 3 months, ensuring stable transfection. The three GST overexpressing clones used in this study were denoted V79MZhA1-1, M1-1, and P1-1, respectively. These cell lines were characterized with respect to total and cytosolic protein contents, and amounts and concentrations of GSH and active GST (Table 2). The intracellular concentrations of GST was 11, 6, and 27 times higher for the V79MZhA1-1, MZhM1-1, and MZhP1-1 clones respectively, compared to the control cell line. A slightly higher concentration of GSH was usually observed in V79MZhA1-1 cells relative to the other clones. The calculations are based on the observation that 106 V79 cells correspond to a volume of about 3 µL (see Materials and Methods). In practice, the intracellular concentrations of GSH and GST are expected to be higher since the polar compartment constitutes only one fraction of the total cell volume. The V79MZhA1-1, M1-1, and P1-1 clones were further characterized by estimating the cytosolic GST activity toward (+)-and (-)-anti-DBPDE. As shown in Table 3, the cytosolic fractions obtained from the V79MZhA1-1 and V79MZhM1-1 cells catalyzed GSH conjugation of both enantiomers, whereas cytosol from the V79MZhP1-1 cells was only active toward (-)-antiDBDPE, the enantiomer with R-absolute configuration at the benzylic oxirane carbon. The exclusive preference


Chem. Res. Toxicol., Vol. 15, No. 2, 2002 173

Table 2. Some Characteristics of V79MZ Cells Constitutively Expressing GSTPi or Overexpressing Different Human GSTs

type of cells

protein (µg/106 cells)

cytosolic protein (µg/106 cells)

GSH (nmol/mg of total protein)

[GSH]a (mM)

GST (µg/mg of cytosolic protein)

[GST]a (µM)

V79MZ V79MZhA1-1 V79MZhM1-1 V79MZhP1-1

290 350 320 420

150 160 140 210

16.9 23.3 21.8 12.7

1.6 2.7 2.3 1.7

3.2 32 21 63

3.2 34 20 88

a

Intracellular concentration based on a cell volume of 3 µL/106 cells. Table 3. Catalytic Efficiencies toward DBPDE in Cytosolic Fractions and Human GSTs Isolated from V79MZ Transfectants GST activitya (+)-anti-DBPDE V79MZhA1-1 V79MZhM1-1 V79MZhP1-1

(mM-1s-1)

(-)-anti-DBPDE (mM-1s-1)

cytosolic fraction

pure enzyme

cytosolic fraction

pure enzyme

1.12 ( 0.13 1.40 ( 0.22 (0.93) ndc

10.57 ( 1.28 (7.05) 2.29 ( 0.40 (1.53) nd

6.14 ( 0.51 (4.09) 3.98 ( 0.18 (2.65) 1.62 ( 0.05 (1.08)

66.3 ( 13 (44.2) 5.91 ( 0.63 (3.94) 1.54 ( 0.44 (1.03)

(0.75)b

a Catalytic efficiency (k /K ) was calculated as previously described (21). b Rate enhancement (×10-4) obtained by dividing k /K by cat m cat m the rate of nonenzymatic reaction of the diol epoxide with GSH (k2). c nd ) not detectable.

Table 4. Oil/Water Distribution Coefficient (Kow), Rate of Uptake (kuptake), Rate of Solvolysis (ksolvolysis), and Calculated Intracellular Distribution of BPDE and DBPDE in V79MZ Cells compd

Kowa

kuptake (s-1) (× 104)

ksolvolysis (s-1) (× 104)b

intracellular (%)c

polar phase (µM)d

nonpolar phase (µM)d

(+)-anti-BPDE (-)-anti-DBPDE

200 3200

110 (1.03)e 120 (0.98)

43 (2.7)f,g 3.6 (32)f

60 75

3.0 0.23

590 750

a Calculated using ChemDraw Ultra 6.0.1 (CLogP). b Estimated from the rate of disappearance of diol epoxide at 37 °C in PBS containing glucose 1 mg/mL, pH 7.0. c Percent of initially added substrate (10 nmol) and following 2 min of incubation. d Expected concentration after 2 min of incubation and assuming a total cell volume of 40 µL and a nonpolar/polar ratio of 1/4. e t1/2 of uptake. f t1/2 of solvolysis.g See ref 20.

observed with GSTP1-1 is fully consistent with previous results using the pure enzyme (22). For comparison, the results from experiments using pure enzymes are included in Table 3. Comparison of the catalytic efficiencies, show that cytosolic constituents have no effect on the activity of GSTP1-1 but a minor inhibitory effect on that of GSTM1-1. Surprisingly, the apparent kcat/Km observed in the GSTA1-1 cytosol was substantially reduced. In fact, a 10-fold suppression in activity was observed with both anti-DBPDE enantiomers. To ensure that the enzyme per se is functional, GSTA1-1 was purified from cytosol as previously described (37) and the activity toward (-)-antiDBPDE was measured. The enzyme was found to be fully active indicating that factors present in the V79MZhA1-1 cytosol are responsible for the suppressed activity rather than a defective protein. In agreement with previous results with other fjordregion DEs (21, 22, 26), the activity of human GSTs A1-1 and M1-1 toward the anti-DBPDE enantiomers was substantially higher than that of GSTP1-1Val105,Ala114 (Table 3). In particular, the unexpected high activity observed with (-)-anti-DBPDE was remarkable. Exposing Cells to Diol Epoxides. Addition of lipophilic and chemically reactive compounds such as BPDE and DBPDE to cultured cells results in several processes acting in concert: a rapid uptake into the cells concomitant with solvolysis in the incubation medium. Furthermore, the extent of cellular uptake is governed by the oil/water distribution coefficient. We have calculated the distribution coefficients (Kow) of the anti-enantiomers of BPDE and DBPDE and determined their rates of solvolysis and cellular uptake. The values obtained are compiled in Table 4. Using the rates of solvolysis and

uptake it can be estimated that the cells take up about 60% of the reactive BPDE added following 2 min of incubation. The remaining part constitutes hydrolysis products and intact extracellular DE. With the less reactive DBPDE, about 75% of the DE added initially is expected to be present in the cells following 2 min of incubation. Assuming a nonpolar/polar cell compartment ratio of 1/4 and using the distribution coefficients, the expected intracellular concentration of BPDE and DBPDE can be calculated. These values are also included in Table 4. Formation of GSH Conjugates in Control and GST Overexpressing Cells. The formation of GSH conjugates of (-)-anti-DBPDE and (+)-anti-BPDE as a function of incubation time in control cells, V79MZhA11, M1-1, and P1-1 transfectants was determined. Examples of the results obtained with (-)-anti-DBPDE and V79MZhA1-1 and (+)-anti-BPDE and V79MZhP1-1 cells, respectively are depicted in Figure 2. The linear or near linear part of the curves obtained was used to calculate the rates of conjugate formation. The results are compiled in Table 5. The extent of activities observed and the activities with different cell clones poorly reflect the activities anticipated from data obtained with pure GSTs (see Discussion). On the basis of experiments with subcellular fractions and liposomes, it has been concluded that soluble GSTs only have access to the fraction of lipophilic substrate free in solution (38, 39). Whether this is true or not in the intact cell could be tested here using our GST overexpressing cell lines. Taking into account the compartmental distribution of DE in conjunction with the intracellular concentrations of GST and GSH and the

174


Sundberg et al.

Table 5. Rates of GSH Conjugate Formation in Control V79MZ Cells and Cells Overexpressing Human GSTs GSH conjugate formation (pmol/min)a

a

compd

V79MZ

V79MZhA1-1

V79MZhM1-1

V79MZhP1-1


1.6 0.4

8 19

27 10

262 4

Estimated following 2 min of incubation.

Table 6. Comparison of Expected and Observed Rates of Conjugate Formation in GST Overexpressing V79MZ Cells Incubated with (+)-anti-BPDE or (-)-anti-DBPDE V79MZhA1-1

V79MZhM1-1

V79MZhP1-1

compd

vexpected (µM/min)

vobserved (µM/min)

ratio (obs/exp)

vexpected (µM/min)

vobserved (µM/min)

ratio (obs/exp)

vexpected (µM/min)

vobserved (µM/min)

ratio (obs/exp)


19.6 31.1

0.16 0.37

0.01 0.01

37.8 1.63

0.59 0.22

0.02 0.13

317 1.9

7.5 0.11

0.02 0.06

Table 7. GSH Conjugation and DNA Adduct Formation in Control and Human GST Overexpressing V79MZ Cells Incubated with (+)-anti-BPDE (+)-anti-BPDE cell lines

conjugatesa (pmol/106 cells)

adductsa (pmol/106 cells)


2.46 ( 1.19 11.6 ( 2.99 18.7 ( 3.68 78.3 ( 19.0

0.82 ( 0.13 0.31 ( 0.04 0.07 ( 0.01 0.20 ( 0.05

a

Figure 2. Formation of GSH conjugates as a function of time in V79 cells. V79MZhP1-1Val105,Ala114 cells incubated with 1 µM (+)-anti-BPDE (9). V79MZhA1-1 incubated with 1 µM (-)-antiDBPDE (2).

observed rate of conjugate formation, the ratio between observed and expected rates could be estimated. Using the relationship v ) kcat/Km[E0][S] (v ) the reaction rate, kcat/Km ) catalytic efficiency, [E0] ) concentration of enzyme, [S] ) concentration of substrate), the expected rates of conjugate formation can be calculated. For instance, with (+)-anti-BPDE and V79MZhGSTP1-1 cells, the calculation yields: v ) 20 000 M-1s-1 × 88 × 10-6 M × 3.0 × 10-6 M ) 5.3 µM s-1 or 317 µM/min. The value of kcat/Km for GSTP1-1Val105,Ala114 is from Sundberg et al. (23) and [GST] and [S] from Tables 2 and 4 in this study. Further, we assume that the intracellular concentration of GSH >1.5 mM (Table 2 in this study) is saturating. This seems to be justified since Km values for GSH and human GSTs are in the range of 80-160 µM (40). Comparing the observed rate, 7.5 µM/min (Table 6), with that expected (317 µM/min) reveals that the actual fraction undergoing conjugation is only 2%. The results from similar calculations with other GSTs and BPDE or DBPDE are summarized in Table 6. The results clearly indicate that in addition to the concentration of free substrate in solution, other factors restrict the rate of GSH conjugation in the intact cell (see Discussion). Formation of DNA Adducts in Control and GST Overexpressing Cells. Cells were incubated with (-)anti-DBPDE and (+)-anti-BPDE for 20 min and formation of DNA damage/adducts was determined. Two alternative procedures were employed. The method involving acidic hydrolysis of modified DNA and subsequent HPLC analysis of released tetraols was used with

The results are expressed as the mean ( SE (n ) 3).

BPDE. This method was not applicable to DBPDEmodified DNA due to decomposition of both adducts and the released tetraols during the treatment with acid and elevated temperatures (unpublished observation). Alternatively, the modified DNA was enzymatically digested to nucleosides and those modified with DBPDE were analyzed by HPLC. DNA Adducts of BPDE. The results on adduct formation of BPDE and the effect of GST expression are shown in Table 7. The corresponding formation of GSHconjugates is included for comparison. In control cells, about 0.8 pmol of adducts/106 cells was observed. This level is reduced about 12- and 4-fold in cells overexpressing GSTM1-1 and GSTP1-1Val105,Ala114, respectively. As expected from in vitro experiments with pure enzymes (23), the effect of GSTA1-1 on DNA adduct formation was less pronounced (about 2.5-fold reduction). It should be noted that the differences in GSH-conjugate formation poorly reflect the differences in adduct levels (see Discussion). DNA Adducts of DBPDE. Prior to analyzing adducts derived from DBPDE in cells, adducts for use as standards were prepared. Short oligonucleotides, 5′-[d(AT)]6 and 5′-[d(CG)]6 were incubated with the (-)-anti-DBPDE and, following purification and enzymatic hydrolysis (see Materials and Methods), the digests were subjected to HPLC and fluorescence detection. Figure 3, panels A and B, shows the elution pattern of adducts derived from the AT- and CG-oligonucleotide, respectively. Since the exocyclic aminogroups of dA and dG are the principal targets for DBPDE, we assume that the peaks in the chromatograms correspond to such adducts. Products corresponding to the major peaks in Figure 3, panels A and B, were collected and quantitated by UV spectroscopy and relative fluorescence intensity per picomole (RI/pmol) of adduct was determined (quantum yield: dA-adduct/dGadduct ) 0.7). Figure 3C shows a representative chromatogram obtained from control cells incubated with (-)-


Chem. Res. Toxicol., Vol. 15, No. 2, 2002 175

Figure 3. HPLC elution profiles of reaction products from (-)-anti-DBPDE reacted with the olgonucleotides 5′-[d(AT)]6 (A) or 5′-[d(CG)]6 (B). Panel C represents the elution profile of enzymatically digested DNA isolated from V79MZ cells following incubation with (-)-anti-DBPDE. The effluent was monitored by fluorescence emission at 400 nm (λexcitaion ) 340 nm). Table 8. GSH Conjugation and DNA Adduct Formation in Control and Human GST Overexpressing V79MZ Cells Incubated with (-)-anti-DBPDE (-)-anti-DBPDE cell lines

conjugatesa (pmol/106 cells)

adductsa (pmol/106 cells)


0.57b 21.6 ( 0.29 13.7 ( 1.09 7.0 ( 0.97

8.35 ( 1.11 1.28 ( 0.15 3.82 ( 0.54 3.80 ( 0.27

a The results are expressed as the mean ( SE (n ) 3). b Result from a single experiment

anti-DBPDE. The most retarded peak corresponds to the major tetraol, whereas the 2 peaks eluting prior to the tetraol show the same relative retention time as the dAderived adducts. Similarly, the peaks eluting at 19.7 and 18.1 show the same relative retention time as the major dG-adducts. To determine the extent of overall adduct formation, the total fluorescence intensity of the effluent eluting between 6 and 22 min was integrated and, for simplicity, divided by the mean of RIdA-adduct + RIdG-adduct. This procedure is expected to yield sufficient precision in adduct quantification and thus, allows accurate comparisons. The results on adduct formation of (-)-antiDBPDE in control cells and GST overexpressing cells are compiled in Table 8. The extent of GSH conjugate formation is also included. With control cells, DBPDE adduct-formation was about 10-fold higher than with BPDE under the same experimental conditions. GSTA1-1 offered the most efficient protection and reduced DNA modification about 6.5-fold with a corresponding 40-fold increase in GSH conjugate formation. Both GSTM1-1 and P1-1Val105,Ala114 offered a 2-fold protection against DNA modification. The reduction in binding was associated with a corresponding increase in GSH conjugate formation (Table 8).

Discussion Mammalian cells have been genetically engineered to stably express individual human GSTs representing class Alpha, Mu, and Pi. The cells have been used to study two interrelated issues of importance in PAH-induced carcinogenesis: first, the role of individual human GST

in the protection against DNA-adduct formation of DEs; second, elucidation of the factors governing the availability and accessibility of lipophilic compounds for GSTcatalyzed conjugation with GSH. 1. Effect of Indvidual Human GSTs on DNA Adduct Formation in Cultured Mammalian Cells. Previous work from our laboratory and by others has shown that GST and GSH are important factors in protecting cells against toxicity and insult to DNA by reactive electrophiles derived from PAH metabolism (1317). In more recent work, Fields et al. (41) demonstrated that GSTP1-1Ile105,Ala114 expressing human cells exhibited substantially less DNA adducts following exposure to (+)anti-BPDE than control cells and that the extent of protection was reflected by the GST content. Seidel et al. (42) studied the effect of GSTP1-1Ile105,Ala114 on mutagenicity in V79 cells exposed to DE isomers of BP, benzo[c]phenanthrene and DB[a,l]P. A decrease in mutation frequency was observed with all substrates although the effect was most pronounced (about 65%) with those exhibiting R-absolute configuration at the benzylic oxirane carbon. This preference has also been observed with purified human GSTP1-1 (21, 23, 43, 44). The marked effect of GSTP1-1Ile105,Ala114 on mutation frequency is interesting considering the low catalytic efficiencies observed with this isoenzyme and the DEs from benzo[c]phenanthrene and DB[a,l]P (21, 22, 45). This implies that there is no simple correlation between activities obtained from experiments with purified enzymes and the activities observed in complex cellular systems. In a more recent study, Hu et al. (46) transfected human HepG2 cells with three allelic GSTP1-1 variants (Ile-105, Ala-114; Val-105, Ala-114; and Val-105, Val-114, respectively) and studied the protection against DNA-adduct formation of (+)-anti-BPDE. Even though low levels of expression were obtained, all GSTP1-1 variants provided protection. GSTP1-1Val105,Val114 was the most effective and reduced adduct formation about 2-fold. Surprisingly, no significant difference in protection by GSTP1-1Ile105,Ala114 and GSTP1-1Val105,Ala114 was observed. Studies have shown that the purified allelic variants of GSTP1-1 clearly differ in their catalytic efficiencies toward (+)-anti-BPDE (GSTP1-1Val105,Val114 > GSTP1-1Val105,Ala114 > GSTP11Ile105,Ala114 ) (23, 44). This again illustrates the difficulty

176


in extrapolating catalytic information obtained with pure enzymes to the complex situation in the intact cell. In the present investigation we have extended our studies to the possible protective effect of GSTA1-1 and M1-1 against harmful effects of PAH DEs. Both Pi and Mu class GST have attracted a great interest with respect to human carcinogenesis owing to their polymorphic distribution in the population. About 50% of the Caucasian population lacks the GSTM1 gene, and it has been hypothesized that this lack is associated with an increased risk for tumor development in individuals exposed to PAH (47, 48). A number of epidemiological studies have been devoted to this issue and the results taken together indicate a moderate risk increase (49). One functional GSTP gene has been identified in humans and this gene has been shown to exist in four allelic variants (50). Results from epidemiological studies indicate that individuals expressing GSTP1-1Val105,Ala114 rather than GSTP1-1Ile105,Ala114 may be more sensitive to PAH exposure (51, 52). In contrast, a study by Whyatt et al. (53) suggested a protective role of GSTP1-1Val105,Val114 against PAH-induced damage. This study is more compatible with the results obtained with pure GSTP1-1 variants (23, 54) and the results discussed (vide supra) (46). Protection against BPDE-Induced DNA Adducts. Here we show that GSTM1-1, although present at the lowest intracellular concentration (comparing our engineered cells), offers the most effective protection against adduct formation by (+)-anti-BPDE followed by GSTP1-1Val105,Ala114 and GSTA1-1. The extent of conjugate formation after 20 min of reaction rather well reflect the order of the enzymes catalytic efficiencies (21). In contrast, this appears not to be the case for DNA adduct formation. The reason for this discrepancy is not known, but factors such as differences in compartmental GST/GSH distribution (cytosol vs nuclei) and/or ability to trap/transport (+)anti-BPDE by binding at other sites than the H-site may be involved. That GSTs physically bind various lipophilic compounds is well established and the protein’s possible role in intracellular transport has attracted considerable interest (55, 56). In a preliminary study using V79 cells expressing both CYP1A1 and GSTP1-1Ile105,Ala114, we observed a 20-fold reduction in DNA adduct level relative to cells solely expressing CYP1A1 (0.06 pmol vs 1.1 pmol adducts/106 cells) (57). This was accompanied by a corresponding increase in GSH-conjugate formation. Here, we only observed a 4-fold difference (0.20 pmol vs 0.82 pmol of adducts/106 cells) in DNA-binding in cells expressing GSTP1-1Val105,Ala114. Consistent with the results of Hu et al. (46), this observation suggests that the activity of GSTP1-1Val105,Ala114 in the intact cell is less than or at the most, equal to that of GSTP1-1Ile105,Ala114. This is in fact opposite to that observed with the pure isoenzymes (22, 54). Protection against DBPDE-Induced DNA Adducts. The effect of GST on adduct formation of (-)-anti-DBPDE reveals a different scenario relative to that with (+)-antiBPDE. First, the extent of adducts in control cells is about 10-fold higher. This observation is consistent with previous findings showing that fjord-region DEs bind more extensively to DNA than those of the bay-region category (58, 59). Second, GSTA1-1 is considerably more effective in protecting DNA than GSTM1-1 and GSTP11, which seem to offer equal protection. The relatively

Sundberg et al.

small difference in protection potency observed was surprising considering the different catalytic efficiencies; kcat/Km of GSTA1-1 is 66 mM-1 s-1 which is 10- and 40fold higher than for GSTM1-1 and GSTP1-1Val105,Ala114, respectively. The unexpected low protection by GSTA1-1 seems to be due to factors in the intact cell, which inhibit conjugate function. In fact, the activity with either enantiomer of anti-DBPDE is reduced about 10-fold in the cytosolic fraction compared to the purified enzyme. The inhibitory factor(s) has not been identified, but attempts to do so are in progress. It should be mentioned that GSTP constitutively expressed in V79 cells is actually nonfunctional with bulky substrates such as (+)-antiBPDE but active with CDNB (37, 60). Moreover, the factor responsible for the inhibition seems to be of nonproteinaceous origin and of low molecular weight, since the inhibitory effect is insensitive to heat and removed in part by dialysis (60). Previous studies and the results shown here demonstrate that human GSTA1-1 is generally more efficient in catalyzing conjugate formation of fjord-region DEs than the corresponding bay-region analogues (20, 21). Notably in this study is that DBPDE is by far the best DE substrate identified hitherto. As shown in a recent study,2 this is particularly true with (+)-syn-DBPDE. The reasons for the high catalytic efficiencies of human GSTA1-1 with DBPDE isomers will be discussed elsewhere.2 It is of interest to note that mouse GSTA1-1 shows a pronounced preference for (+)-anti-BPDE (61). With respect to formation of GSH conjugates in the V79 cells it should be mentioned that no significant difference in the amount recovered in the incubation medium with intact or lysed cells was observed. In contrast to the human cell lines recently used in similar studies (17), the conjugates are rapidly and efficiently removed from V79 cells, most likely by anion transporter systems such as MRP (62, 63). This reduces the risk for product inhibition of GST and thus, complications with respect to correctly interpreting the results. 2. Factors Influencing the Availability and Accessibility of Lipophilic Diol Epoxides in Intact Cells. It is not a trivial question to which extent highly lipophilic compounds, with their expected localization in cellular membranes, are accessible to soluble GST. The partition of a lipophilic compound between a polar and a nonpolar phase is determined by the distribution coefficient. Accordingly, the rate and efficiency of GSTcatalyzed conjugation in the cell is expected to depend on this factor. In fact, in a preliminary study comparing rates of conjugation of (+)-anti-BPDE and the corresponding DE of benzo[c]chrysene, we observed a much lower rate than expected with the latter substrate in accordance with its more lipophilic character (57). Here we have explored this issue more systematically and conclude that in addition to the partition coefficient, i.e., the concentration of free compound in solution, additional factors have to be considered. It is surprising that only about 1-2% of the rate expected for BPDE conjugation is observed in the cells, and this is independent of the GST expressed (see Tables 4 and 6). The most obvious explanation for the low vobserved/vexpected ratio is competing reactions such as hydrolysis and/or more unspecific reactions with cellular constituents which further reduce the concentration of substrate available for conjugation. Consistent with this interpretation is the results with the less reactive and more lipophilic DBPDE. With the


exception of cells expressing GSTA1-1, up to 13% of the expected rate is observed. The low ratio (0.01) observed with GSTA1-1 expressing cells most probably reflects that the enzyme only exhibits about 10% of its full activity. Other factors restricting the accessibility of lipohilic substances and soluble proteins also have to be considered. For instance, reduced rates of diffusion of substrates and enzymes due to the cytoarchitecture and associated macromolecular crowding (64, 65) may be one factor. Another factor is the distribution of GSH and GST in different cellular compartments (19, 66). With regard to GSTA isoenzymes, a recent study shows that GSTA4-4 is preferentially localized in human liver mitochondria (67). Whether GSTA1-1 is heterogeneously distributed in our expressing cells and contributes to the low conjugation capacity observed is not known. This possibility, however, seems to warrant further investigation. In conclusion, GSTA1-1 is most efficient in protecting DNA from modification by (-)-anti-DBPDE, whereas GSTM1-1 is most efficient with (+)-anti-BPDE. Values of kcat/Km and estimated oil/water partition coefficients of DBPDE and BPDE were used to calculate the concentration of free DE in solution and expected rates of GSH conjugate formation in cells. Comparing the theoretical results with those observed reveal that no more than 2% of the expected activity of the highly reactive (+)-antiBPDE is observed, whereas the corresponding value for the less reactive (-)-anti-DBPDE is 13%. The low observed rate with (+)-anti-BPDE is partially due to competing reactions such as hydrolysis and/or more unspecific reactions with cellular constituents. Other factors likely to restrict the accessibility of GST and lipophilic substrates in the intact cells is macromolecular crowding and associated reduced rates of diffusion.

Acknowledgment. This study was supported by grants from the National Board for Laboratory Animals, Swedish Fund for Research without Animal Experiments and Swedish Match AB. Professor Ralf Morgenstern is greatly acknowledged for his valuable comments on the manuscript. The helpful assistance of Ann-Sofie Johansson and Dr. Lena Forsberg is also greatly appreciated. Professor Johannes Doehmer kindly provided the V79MZ cells and professor Bengt Mannervik the human GST c-DNA clones. We appreciate professor Nicholas Geacintov comments on DNA adduct analysis.

References (1) Sims, P., and Grover P. L. (1974) Epoxides in polycyclic aromatic hydrocarbon metabolism and carcinogenesis. Adv. Cancer Res. 20, 165-274. (2) Thakker, D. R., Yagi, H., Levin, W., Wood, A. W., Conney, A. H., and Jerina, D. M. (1985) Polycyclic aromatic hydrocarbons: Metabolic activation to ultimate carcinogens. In Bioactivation of Foreign Compounds (Anders, M. W., Ed.) pp 177-242, Academic Press, London. (3) Dipple, A. (1985) Polycyclic aromatic hydrocarbons: an introduction. In Polycyclic Hydrocarbons and Carcinogenesis (Harvey, R. G., Ed.) ACS Symposium Series 283, pp 1-17, American Chemical Society, Washington, DC. (4) IARC (1986) Monographs on the Evaluation of the Carcinogenic Risk of Chemicals to Humans. In Tobacco smoking Vol. 38, Lyon, France. (5) Jerina, D. M., Chadha, A., Cheh, A. M., Schurdak, M. E., Wood, A. W., and Sayer, J. M. (1991). In Biological Reactive Intermediates (Withmer, C. M., Snyder, R., Jollow, D. J., Kalf, G. S., Kocsis, J. J., and Sipes, I. G., Eds.) pp 533-553, Plenum Press. (6) Harvey, R. G. (1991) Chemistry and Carcinogenicity. In Polycyclic Aromatic Hydrocarbons, Cambridge University Press, Cambridge.

Chem. Res. Toxicol., Vol. 15, No. 2, 2002 177 (7) Amin, S., Krzeminski, J., Rivenson, A., Kurtzke, C., Hecht, S. S., and el-Bayoumy, K. (1995) Mammary carcinogenicity in female CD rats of fjord region diol epoxides of benzo[c]phenanthrene, benzo[g]chrysene and dibenzo[a,l]pyrene. Carcinogenesis 16, 19711974. (8) Jerina, D. M., Sayer, J. M., Agarwal, S. K., Yagi, H., Levin, W., Wood, A. W., Conney, A. H., Pruess-Schwartz, D., Baird, W. M., and Pigott, M. A., et al. (1986) Reactivity and tumorigenicity of bay-region diol epoxides derived from polycyclic aromatic hydrocarbons. Adv. Exp. Med Biol. 197, 11-30. (9) Cavalieri, E. L., Higginbotham, S., RamaKrishna, N. V., Devanesan, P. D., Todorovic, R., Rogan, E. G., and Salmasi, S. (1991) Comparative dose-response tumorigenicity studies of dibenzo[a,l]pyrene versus 7,12-dimethylbenz[a]anthracene, benzo[a]pyrene and two dibenzo[a,l]pyrene dihydrodiols in mouse skin and rat mammary gland. Carcinogenesis 12, 1939-1944. (10) Higginbotham, S., RamaKrishna, N. V., Johansson, S. L., Rogan, E. G., and Cavalieri, E. L. (1993) Tumor-initiating activity and carcinogenicity of dibenzo[a,l]pyrene versus 7,12-dimethylbenz[a]anthracene and benzo[a]pyrene at low doses in mouse skin. Carcinogenesis 14, 875-878. (11) LaVoie, E. J., He, Z. M., Meegalla, R. L., and Weyand, E. H. (1993) Exceptional tumor-initiating activity of 4-fluorobenzo[j]-fluoranthene on mouse skin: comparison with benzo[j]-fluoranthene, 10fluoro-benzo[j]fluoranthene, benzo[a]pyrene, dibenzo[a,l]pyrene and 7,12- dimethylbenz[a]anthracene. Cancer Lett. 70, 7-14. (12) Katz, A. K., Carrell, H. L., Glusker, J. P. (1998) Dibenzo[a,l]pyrene (dibenzo[def,p]chrysene): fjord-region distortions. Carcinogenesis 19, 1641-1648. (13) Romert, L., Dock, L., Jenssen, D., and Jernstro¨m, B. (1989) Effects of glutathione transferase activity on benzo[a]pyrene 7,8-dihydrodiol metabolism and mutagenesis studied in a mammalian cell co- cultivation assay. Carcinogenesis 10, 1701-1707. (14) Hesse, S., Cumpelik, O., Mezger, M., Kiefer, F., and Wiebel, F. J. (1990) Glutathione conjugation protects some, but not all, cell lines against DNA binding of benzo[a]pyrene metabolites. Carcinogenesis 11, 485-487. (15) Burke, M. D., Vadi, H., Jernstro¨m, B., and Orrenius, S. (1977) Metabolism of benzo[a]pyrene with isolated hepatocytes and the formation and degradation of DNA-binding derivatives. J. Biol. Chem. 252, 6424-6431. (16) Puchalski, R. B., and Fahl, W. E. (1990) Expression of recombinant glutathione S-transferase pi, Ya, or Yb1 confers resistance to alkylating agents. Proc. Natl. Acad. Sci. U.S.A. 87, 2443-2447. (17) Fields, W. R., Li, Y., and Townsend, A. J. (1994) Protection by transfected glutathione S-transferase isozymes against carcinogeninduced alkylation of cellular macromolecules in human MCF-7 cells. Carcinogenesis 15, 1155-1160. (18) Mannervik, B., and Widersten, M. (1995) Human glutathione transferases: classification, tissue distribution, structure and functional properties. In Advances in Drug Metabolism in Man (Pacifici, G. M., and Francchia, G. M., Eds.) pp 408-459, European Commission. (19) Sherratt, P. J., Pulford, D. J., Harrison, D. J., Green, T., and Hayes, J. D. (1997) Evidence that human class Theta glutathione S-transferase T1-1 can catalyse the activation of dichloromethane, a liver and lung carcinogen in the mouse. Comparison of the tissue distribution of GST T1-1 with that of classes Alpha, Mu and Pi GST in human. Biochem. J. 326, 837-846. (20) Jernstro¨m, B., Funk, M., Frank, H., Mannervik, B., and Seidel, A. (1996) Glutathione S-transferase A1-1-catalysed conjugation of bay and fjord region diol epoxides or polycyclic aromatic hydrocarbons with glutathione. Carcinogenesis 17, 1491-1498. (21) Sundberg, K., Widersten, M., Seidel, A., Mannervik, B., and Jernstro¨m, B. (1997) Glutathione conjugation of bay- and fjordregion diol epoxides of polycyclic aromatic hydrocarbons by glutathione transferases M1-1 and P1-1. Chem. Res. Toxicol. 10, 1221-1227. (22) Sundberg, K., Seidel, A., Mannervik, B., and Jernstro¨m, B. (1998) Detoxication of carcinogenic fjord-region diol epoxides of polycyclic aromatic hydrocarbons by glutathione transferase P1-1 variants and glutathione. FEBS Lett. 438, 206-210. (23) Sundberg, K., Johansson, A. S., Stenberg, G., Widersten, M., Seidel, A., Mannervik, B., and Jernstro¨m, B. (1998) Differences in the catalytic efficiencies of allelic variants of glutathione transferase P1-1 towards carcinogenic diol epoxides of polycyclic aromatic hydrocarbons. Carcinogenesis 19, 433-436. (24) Hu, X., Xia, H., Srivastava, S. K., Pal, A., Awasthi, Y. C., Zimniak, P., and Singh, S. V. (1998) Catalytic efficiencies of allelic variants of human glutathione S-transferase P1-1 toward carcinogenic anti-diol epoxides of benzo[c]phenanthrene and benzo[g]chrysene. Cancer Res. 58, 5340-5343.

178


(25) Luch, A., Glatt, H., Platt, K. L., Oesch, F., and Seidel, A. (1994) Synthesis and mutagenicity of the diastereomeric fjord-region 11,12-dihydrodiol 13,14-epoxides of dibenzo[a,l]pyrene. Carcinogenesis 15, 2507-2516. (26) Jernstro¨m, B., Seidel, A., Funk, M., Oesch, F., and Mannervik, B. (1992) Glutathione conjugation of trans-3,4-dihydroxy 1,2-epoxy 1,2,3,4-tetrahydrobenzo[c]phenanthrene isomers by human glutathione transferases. Carcinogenesis 13, 1549-1555. (27) Bunting, K. D., and Townsend, A. J. (1996) De novo expression of transfected human class 1 aldehyde dehydrogenase (ALDH) causes resistance to oxazaphosphorine anti-cancer alkylating agents in hamster V79 cell lines. Elevated class 1 ALDH activity is closely correlated with reduction in DNA interstrand crosslinking and lethality. J. Biol. Chem. 271, 11884-11890. (28) Luch, A., Coffing, S. L., Tang, Y. M., Schneider, A., Soballa, V., Greim, H., Jefcoate, C. R., Seidel, A., Greenlee, W. F., Baird, W. M., and Doehmer, J. (1998) Chem. Res. Toxicol. 11, 686-695. (29) Habig, W. H., and Jakoby, W. B. (1981) Assays for differentiation of glutathione S-transferases. Methods Enzymol. 77, 398-405. (30) Mannervik, B., and Danielson, U. H. (1988) Glutathione transferases-structure and catalytic activity. C. R. C. Crit. Rev. Biochem. 23, 283-337. (31) Ellman, G. L. (1959) Tissue sulfhydryl groups. Arch. Biochem. Biophys. 82, 70-74. (32) Peterson, G. L. (1977) A simplification of the protein assay method of Lowry et al. which is more generally applicable. Anal. Biochem. 83, 346-356. (33) Michaud, D. P., Gupta, S. C., Whalen, D. L., Sayer, J. M., and Jerina, D. M. (1983) Effects of pH and salt concentration on the hydrolysis of a benzo[a]pyrene 7,8-diol-9,10-epoxide catalyzed by DNA and polyadenylic acid. Chem. Biol. Interact. 44, 41-52. (34) Dock, L., Martinez, M., and Jernstro¨m, B. (1987) Increased stability of (()-7β,8R-dihydroxy-9R,10R-epoxy-7,8,9,10-tetrahydrobenzo[a]pyrene through interaction with subcellular fractions of rat liver. Chem.-Biol. Interact. 61, 31-44. (35) Rahn, R. O., Chang, S. S., Holland, J. M., and Shugart, L. R. (1982) A fluorometric-HPLC assay for quantitating the binding of benzo[a]pyrene metabolites to DNA. Biochem. Biophys. Res. Commun. 109, 262-268. (36) Alexandrov, K., Rojas, M., Geneste, O., Castegnaro, M., Camus, A. M., Petruzzelli, S., Giuntini, C., and Bartsch H. (1992) An improved fluorometric assay for dosimetry of benzo[a]pyrene diolepoxide-DNA adducts in smokers’ lung: comparisons with total bulky adducts and aryl hydrocarbon hydroxylase activity. Cancer Res. 52, 6248-6253. (37) Swedmark, S., Jernstro¨m, B., and Jenssen, D. (1996) Comparison of the mRNA sequences for Pi class glutathione transferases in different hamster species and the corresponding enzyme activities with anti-benzo[a]pyrene-7,8-dihydrodiol 9,10-epoxide. Biochem. J. 533-538. (38) Ooi, S. G., Jernstro¨m, B., and Ahokas, J. (1994) Effects of microsomes and liposomes on glutathione transferase catalysed conjugation of benzo[a]pyrene diol epoxide with glutathione. Chem.-Biol. Interact. 91, 15-27. (39) Boyer, T. D., Zakim, D., and Vessey, D. A. (1983) Do the soluble glutathione S-transferases have direct access to membrane-bound substrates? Biochem. Pharmacol. 32, 29-35. (40) Meyer, D. J. (1993) Significance of an unusually low Km for glutathione in glutathione transferases of the alpha, mu and pi classes. Xenobiotica 23, 823-834. (41) Fields, W. R., Morrow, C. S., Doss, A. J., Sundberg, K., Jernstro¨m, B., and Townsend, A. J. (1998) Overexpression of stably transfected human glutathione S-transferase P1-1 protects against DNA damage by benzo[a]pyrene diol-epoxide in human T47D cells. Mol. Pharmacol. 54, 298-304. (42) Seidel, A., Friedberg, T., Lollmann, B., Schwierzok, A., Funk, M., Frank, H., Holler, R., Oesch, F., and Glatt, H. (1998) Detoxification of optically active bay- and fjord-region polycyclic aromatic hydrocarbon dihydrodiol epoxides by human glutathione transferase P1-1 expressed in Chinese hamster V79 cells. Carcinogenesis 19, 1975-1981. (43) Robertson, I. G., Guthenberg, C., Mannervik, B., and Jernstro¨m, B. (1986) Differences in stereoselectivity and catalytic efficiency of three human glutathione transferases in the conjugation of glutathione with 7β,8R-dihydroxy-9R,10R-oxy-7,8,9,10-tetrahydrobenzo[a]pyrene. Cancer Res. 46, 2220-2224. (44) Hu, X., O’Donnell, R., Srivastava, S. K., Xia, H., Zimniak, P., Nanduri, B., Bleicher, R. J., Awasthi, S., Awasthi, Y. C., Ji, X., and Singh, S. V. (1997) Active site architecture of polymorphic forms of human glutathione S- transferase P1-1 accounts for their enantioselectivity and disparate activity in the glutathione conjugation of 7β,8R-dihydroxy-9R,10v-oxy-7,8,9,10-tetrahydrobenzo[a]pyrene. Biochem. Biophys. Res. Commun. 235, 424-428.

Sundberg et al. (45) Sundberg, K., Seidel, A., Mannervik, B., and Jernstro¨m, B. (1999) Catalytic efficiency of glutathione transferase P1-1 variants towards bay- and fjord-region diol epoxides of polycyclic aromatic hydrocarbons. Polycyclic Aromat. Compd. 17, 43-51. (46) Hu, X., Herzog, C., Zimniak, P., and Singh, S. V. (1999) Differential protection against benzo[a]pyrene-7,8-dihydrodiol-9,10epoxide-induced DNA damage in HepG2 cells stably transfected with allelic variants of pi class human glutathione S-transferase. Cancer Res. 59, 2358-2362. (47) Rojas, M., Alexandrov, K., Cascorbi, I., Brockmoller, J., Likhachev, A., Pozharisski, K., Bouvier, G., Auburtin, G., Mayer, L., KoppSchneider, A., Roots, I., and Bartsch, H. (1998) High benzo[a]pyrene diol-epoxide DNA adduct levels in lung and blood cells from individuals with combined CYP1A1 MspI/Msp-GSTM1*0/ *0 genotypes. Pharmacogenetics 8, 109-118. (48) Rojas, M., Cascorbi, I., Alexandrov, K., Kriek, E., Auburtin, G., Mayer, L., Kopp-Schneider, A., Roots, I., and Bartsch, H. (2000) Modulation of benzo[a]pyrene diolepoxide-DNA adduct levels in human white blood cells by CYP1A1, GSTM1 and GSTT1 polymorphism. Carcinogenesis 21, 35-41. (49) Hayes, J. D., and Strange, R. C. (2000) Glutathione S-transferase polymorphisms and their biological consequences. Pharmacology 61, 154-166. (50) Ali-Osman, F., Akande, O., Antoun, G., Mao, J. X., and Buolamwini, J. (1997) Molecular cloning, characterization, and expression in Escherichia coli of full-length cDNAs of three human glutathione S-transferase Pi gene variants. Evidence for differential catalytic activity of the encoded proteins. J. Biol. Chem. 272, 10004-10012. (51) Harries, L. W., Stubbins, M. J., Forman, D., Howard, G. C., and Wolf, C. R. (1997) Identification of genetic polymorphisms at the glutathione S-transferase Pi locus and association with susceptibility to bladder, testicular and prostate cancer. Carcinogenesis 18, 641-644. (52) Ryberg, D., Skaug, V., Hewer, A., Phillips, D. H., Harries, L. W., Wolf, C. R., Ogreid, D., Ulvik, A., Vu, P., and Haugen, A. (1997) Genotypes of glutathione transferase M1 and P1 and their significance for lung DNA adduct levels and cancer risk. Carcinogenesis 18, 1285-1289. (53) Whyatt, R. M., Perera, F. P., Jedrychowski, W., Santella, R. M., Garte, S., and Bell, D. A. (2000) Association between polycyclic aromatic hydrocarbon-DNA adduct levels in maternal and newborn white blood cells and glutathione S-transferase P1 and CYP1A1 polymorphisms. Cancer Epidemiol. Biomarkers Prev. 9, 207-212. (54) Hu, X., Ji, X., Srivastava, S. K., Xia, H., Awasthi, S., Nanduri, B., Awasthi, Y. C., Zimniak, P., and Singh, S. V. (1997) Mechanism of differential catalytic efficiency of two polymorphic forms of human glutathione S-transferase P1-1 in the glutathione conjugation of carcinogenic diol epoxide of chrysene. Arch. Biochem. Biophys. 345, 32-38. (55) Tipping, E., and Ketterer, B. (1981) The influence of soluble binding proteins on lipophile transport and metabolism in hepatocytes. Biochem. J. 195, 441-452. (56) Listowsky, I., Abramovitz, M., Homma, H., and Niitsu Y. (1988) Intracellular binding and transport of hormones and xenobiotics by glutathione-S-transferases. Drug Metab. Rev. 19, 305-318. (57) Sundberg, K., Townsend, A. J., Seidel, A., and Jernstro¨m, B. (2000) Glutathione conjugation and DNA adduct formation of diol epoxides in V79 cells expressing human glutathione transferase P1-1. Polycyclic Aromat. Compd. 21, 123-133. (58) Dipple, A. (1994) Reactions of polycyclic aromatic hydrocarbons with DNA. IARC Sci. Publ. 125, 107-129. (59) Ralston, S. L., Seidel, A., Luch, A., Platt, K. L., and Baird, W. M. (1995) Stereoselective activation of dibenzo[a,l]pyrene to (-)-anti (11R,12S,13S,14R)- and (+)-syn(11S,12R,13S,14R)-11,12-diol13,14-epoxides which bind extensively to deoxyadenosine residues of DNA in the human mammary carcinoma cell line MCF-7. Carcinogenesis 16, 2899-2907. (60) Sundberg, K., Jernstro¨m, B., and Swedmark S. (2000) Studies on the differential inhibition of glutathione conjugate formation of (+)-anti-benzo[a]pyrene 7,8-dihydrodiol 9,10-epoxide and 1-chloro-2,4-dinitrobenzene in V79 Chinese hamster cells. Biochem. J. 349, 693-696. (61) Hu, X., Srivastava, S. K., Xia, H., Awasthi, Y. C., and Singh, S. V. (1996) An alpha class mouse glutathione S-transferase with exceptional catalytic efficiency in the conjugation of glutathione with 7β,8R-dihydroxy-9R,10R-oxy-7,8,9,10-tetrahydrobenzo[a]pyrene. J. Biol. Chem. 271, 32684-32688.

Dibenzo[a,l]pyrene and Benzo[a]pyrene Diol Epoxides (62) Morrow, C. S., Diah, S., Smitherman, P. K., Schneider, E., and Townsend, A. J. (1998) Multidrug resistance protein and glutathione S-transferase P1-1 act in synergy to confer protection from 4-nitroquinoline 1-oxide toxicity. Carcinogenesis 19, 109115. (63) Cuff, R. L., Wade, L. T., Rychlik, B., Jedlitschky, G. A., and Burchell, B. (2001) Characterisation glucuronidation and transport in V79 cells co-expressing UGT1A1 and MRP1. Toxicol. Lett. 120, 43-49. (64) Ellis, R. J. (2001) Macromolecular crowding: an important but neglected aspect of the intracellular environment. Curr. Opin. Struct. Biol. 11, 114-119.

Chem. Res. Toxicol., Vol. 15, No. 2, 2002 179 (65) Luby-Phelps, K. (2000) Cytoarchitecture and physical properties of cytoplasm: volume, viscosity, diffusion, intracellular surface area. Int. Rev. Cytol. 192, 189-221. (66) Ketterer, B., and Meyer, D. J. (1989) Glutathione transferases: a possible role in the detoxication and repair of DNA and lipid hydroperoxides. Mutat. Res. 214, 33-40. (67) Gardner, J. L., and Gallagher, E. P. (2001) Development of a peptide antibody specific to human glutathione S-transferase alpha 4-4 (hGSTA4-4) reveals preferential localization in human liver mitochondria. Arch. Biochem. Biophys. 390, 19-27.

TX015546T

Glutathione Conjugation and DNA Adduct Formation of Dibenzo[a,l

Recommend Documents