Glycerol Monooleate-Based Nanocarriers for siRNA Delivery in Vitro

Jul 16, 2012 - Epidermal growth factor receptor-targeted lipid nanoparticles retain self-assembled nanostructures and provide high specificity. Jiali ...
0 downloads 9 Views 1MB Size
Download PDF
Article pubs.acs.org/molecularpharmaceutics

Glycerol Monooleate-Based Nanocarriers for siRNA Delivery in Vitro Guoliang Zhen,*,† Tracey M. Hinton,*,‡ Benjamin W. Muir,† Shuning Shi,‡ Mark Tizard,‡ Keith M. McLean,† Patrick G. Hartley,† and Pathiraja Gunatillake† †

CSIRO Materials Science and Engineering, Bayview Avenue, Clayton, Victoria 3168, Australia CSIRO Livestock Industries, 5 Portarlington Road, East Geelong Victoria 3219, Australia

‡

S Supporting Information *

ABSTRACT: We present studies of the delivery of short interfering ribonucleic acid (siRNA) into a green fluorescent protein (GFP) expressing cell line, using lipid nanocarriers in cubic lyotropic liquid crystal form. These carriers are based on glycerol monooleate (GMO) and employ the use of varying concentrations of cationic siRNA binding lipids. The essential physicochemical parameters of the cationic lipid/GMO/ siRNA complexes such as particle size, ζ otential, siRNA uptake stability, lyotropic mesophase behavior, cytotoxicity,and gene silencing efficiency were systematically assessed. We find that the lipid nanocarriers were effectively taken up by mammalian cells and that their siRNA payload was able to induce gene silencing in vitro. More importantly, it was found that the nonlamellar structure of some of the lipid nanocarrier formulations were more effective at gene silencing than their lamellar structured counterparts. The development of cationic lipid functionalized nonlamellar GMO-based nanostructured nanoparticles may lead to improved siRNA delivery vehicles. KEYWORDS: siRNA, lipid nanocarriers, green fluorescent protein, delivery

■

INTRODUCTION RNA interference (RNAi) is a rapidly growing field that has the potential to revolutionize the treatment of viral infections, cancer,and genetic disorders.1 It relies on blocking the expression of specific disease related proteins through the inactivation of mRNA (mRNA) with specific short interfering RNA fragments (siRNA), which is introduced into the cell as a therapeutic agent. A major obstacle to the successful application of RNAi therapies is the requirement for intracellular delivery of therapeutic siRNA in vivo. This requires the development of safe and effective in vivo delivery systems2 which overcome a number of complex challenges, including the protection of the siRNA during circulation, effective intracellular uptake of siRNA into the cytoplasm, and safe clearance of residual delivery vehicle components. Biomimetic, lipid-based nanocarriers such as liposomes for gene therapy have been extensively investigated.3 The most common mechanism of cell entry for liposomal siRNA complexes is via endocytosis,4 where subsequent endosomal escape of siRNA is necessary for effective silencing. The precise mechanism of endosomal escape of siRNA into the cytoplasm is not well understood, but several hypotheses have been proposed. Koynova et al.5 concluded that higher transfection efficiency of lipid nanoparticles is modulated by nonlamellar phase conversions in membrane lipids inducing nonlamellar phases upon mixing with the membrane lipids. In biological systems, cubic phase membrane structures have been observed in numerous cell types and under different pathophysiological conditions.6 Complexes of “natural” cubic phase membranes and 18-mer oligodeoxynucleotide (ODN) Published 2012 by the American Chemical Society

are readily internalized within the cytoplasm of cultured mammalian cells.7 Cubic phase lipid−siRNA complexes are also proposed to possess efficient fusogenic properties independent of membrane charge density.6,7b,8 An extensively studied lipid that readily forms lyotropic mesophases, in particular cubic and hexagonal phases, is the monoglyceride, glycerol monooleate (GMO). GMO forms both bicontinuous cubic and hexagonal phases in excess water over a wide temperature range. GMO has also been shown to have low cytotoxicity and to improve the chemical and physical stability of incorporated drugs including biomacromolecules such as proteins, peptides, and nucleic acids.9 Additionally, GMO itself can be enzymatically broken down and cleared in vivo via esterase mediated lipolysis. Hence, lipid nanoparticles made from GMO are prospective candidates for use in drug delivery systems.10 Synthetic cationic lipids such as 1,2dioleoyl-3-trimethylammoniumpropane (DOTAP) and didodecyldimethylammonium bromide (DDAB) have been used for DNA complexation and gene delivery in vitro.11 In this study, we demonstrate that coformulation of a cubic phase forming lipid and cationic (siRNA binding) lipids with a suitable biocompatible emulsifier/stabilizer such as Pluronic F127 yields colloidally stable lipidic nanoparticles which can be used for siRNA delivery. DOTAP-GMO/siRNA and DDABGMO/siRNA complexes were prepared at different cationic Received: Revised: Accepted: Published: 2450

December 21, 2011 June 12, 2012 July 15, 2012 July 16, 2012 dx.doi.org/10.1021/mp200662f | Mol. Pharmaceutics 2012, 9, 2450−2457

Molecular Pharmaceutics

Article

standard disposable ζ potential flow cells after diluting the particles in 10 mM HEPES buffer. Small Angle X-ray Scattering. Small angle X-ray scattering (SAXS) experiments were performed at 37 °C in 1.0 mm quartz capillaries using the SAXS/WAXS beamline at the Australian Synchrotron. A wavelength of 1.24 Å was employed to record 2D SAXS image patterns using a Pilatus-1 M CCD camera. A measurement time of 1 s was employed to minimize beam damage. A silver behenate standard was used to calibrate the reciprocal space vector. Sample temperature was controlled using a recirculating bath (Julabo, Gemany) with a range of accessible temperatures. Two-dimensional diffraction images were recorded on a Mar CX165 detector with analysis in the q range 0.017−0.645 Å−1. Data reduction (calibration and integration) was performed using AXcess, a customdesigned SAXS analysis program written by Dr. Andrew Heron from Imperial College, London. Agarose Gel Electrophoresis. Samples containing 50 pmol of siRNA were electrophoresed on a 2% agarose gel in 1× TBE (89 mM Tris base, 89 mM boric acid, 2 mM EDTA) at 100 V for 40 min. siRNA was visualized by gel red (Jomar Bioscience) on a UV transilluminator with camera, the image was recorded by the GeneSnap program (Syngene, USA). siRNA Particle Visualization. Samples were prepeared as described above with either unlabeled siRNA or siRNA labeled with Pacific Blue dye (Invitrogen). Samples were mounted in Prolong Gold on microscope slides and covered with coverslips (Invitrogen). Slides were imaged with a Leica SP5 confocal microscope. GMO/siRNA compleses were also subjected to flow cytometry on a Becton Dickenson LSR11. Results were analyzed in BD FACS Diva software, and the incorporation of labeled siRNA into complexes was measured by an increase in Pacific Blue wavelength fluorescence. Cells. Chinese hamster ovary cells constitutively expressing green fluorescent protein (CHO-GFP) (kindly received from K. Wark; CSIRO Australia) were grown in MEMα modification supplemented with 10% fetal bovine serum, 10 mM HEPES, 0.01% penicillin, and 0.01% streptomycin at 37 °C with 5% CO2 and subcultured twice weekly. Human embryonic kidney cells (HEK293) cells were grown in RPMI1640 supplemented with 10% fetal bovine serum, 10 mM HEPES, 2 mM glutamine, 0.01% penicillin, and 0.01% streptomycin at 37 °C with 5% CO2 and subcultured twice weekly. Toxicity Assay. CHO-GFP and HEK293 cells were seeded at 1 × 104 cells in 96-well tissue culture plates in triplicate and grown overnight at 37 °C with 5% CO2. GMO−siRNA complexes were added to cells and incubated for 72 h in 200 μL standard media. Toxicity was measured using the Alamar Blue reagent (Invitrogen USA) according to manufacturer’s instructions. Briefly, 20 μL of Alamar Blue was added to each well and incubated for 4 h at 37 °C with 5% CO2. The assay was read on a EL808 absorbance microplate reader (BIOTEK, USA) at 540 and 620 nm. Cell viability was determined by subtracting the 620 nm measurement from the 540 nm measurement. Results are presented as a percentage of untreated cells. Silencing Assay. CHO-GFP cells were seeded at 1 × 104 cells in 96-well tissue culture plates in triplicate and grown overnight at 37 °C with 5% CO2. For positive and negative controls, siRNAs were transfected into cells using Lipofectamine 2000 (Invitrogen, USA) as per manufacturer’s instructions. Briefly, 50 pmol of the relevant siRNA were mixed with 1 μL of Lipofectamine 2000 both diluted in 50 μL

lipid/siRNA weight ratios to characterize the interaction of cationic and cubic phase lipids with siRNA. The phase behavior of the cationic lipid/GMO-siRNA formulations principally depends on cationic lipid weight percentage. The siRNA complexes were systematically designed with low and high membrane charge densities and their sizes, ζ potential, lyotropic mesophase behavior, cell viability, and gene silencing efficiency were characterized and discussed.

■

EXPERIMENTAL SECTION Materials. 1-(cis-9-Octadecenoyl)-rac-glycerol (monoolein, glyceryl monooleate, GMO content >99%), Pluronic F127 (poly(ethylene oxide)-poly(propyleneoxide)-poly (ethylene oxide) (PEO-PPO-PEO)) and didodecyldimethylammonium bromide (DDAB) was purchased from Sigma. 1,2-Dioleoyl-3trimethylammonium-propane (chloride salt) (DOTAP) was purchased from Avanti Polar Lipids, Inc. 4-(2-Hydroxyethyl)-1piperazineethanesulfonic acid (HEPES) was purchased from Fluka. These chemicals were used as received without further purification. Preparation of the Formulations. GMO and cationic lipid-containing dispersions were prepared by cosolubilizing 50 mg of GMO with a calculated set amount of cationic lipid (DOTAP or DDAB) and pluronic F127 dispersant (20 mg/ mL) in chloroform. The mixtures were vortex-mixed thoroughly and then placed in a rotary evaporator for 2 h to remove chloroform. The mixtures were freeze-dried overnight to complete chloroform removal. The glass vials were heated at 50 °C to melt the lipid pluronic mixtures, and 1 mL of Milli-Q water at 50 °C was added prior to dispersion by ultrasonication (MisonixXL2000, Misonix Incorporated) for 1 min in pulse mode (5 s pulses interrupted by 5 s breaks) at 50% of maximum power, resulting in a homogeneous transparent dispersion with high viscosity. The final concentrations were 7.5, 15, 30, and 50 wt % DOTAP or DDAB and 10 wt % pluronic F127 of total lipid material. Dispersions were stored at 25 °C for at least 24 h prior to further experimentation to enable equilibration of lipid, Pluronic F127, and water. Preparation of siRNA. Anti-GFP and negative control siRNAs were obtained from QIAGEN (USA). The anti-GFP siRNA sequence is sense 5′ GCAAGCUGACCCUGAAGUUCAU 3′ and antisense 5′GAACUUCAGGGUCAGCUUGCCG 3′. The nonsilencing control siRNA sense sequence 5′ UUCUCCGAACGUGUCACGUDTDT 3′ and antisense is 5′ ACGUGACACGUUCGGAGAADTDT 3′. This is a validated negative control with no homology to any known mammalian gene. Preparation of Lipid−siRNA Complexes. Cationic lipid/ GMO-siRNA complexes were prepared with varying charge ratios (N/P) at 25 °C, which was calculated based on the ratio of siRNA (N) to cationic lipid (P) charged groups. In a typical preparation, 20 μL of siRNA (1.5 μg/mL in water) was added to 80 μL of lipid-surfactant formulation in milli Q water, with the total lipid concentration adjusted to achieve the desired siRNA:cationic lipid charge ratio (N/P). Solutions were immediately vortexed following addition of siRNA to allow for homogeneous mixing. Charge ratios of 1 and 4 were used in this study. Dynamic Light Scattering and ζ Potential. Particle size measurements were performed at 25 °C in standard disposable cuvettes using a Zetasizer-Nano instrument (Malvern, UK) after diluting the lipid particle dispersions in PBS (phosphate buffered saline) buffer. ζ potentials were measured using 2451

dx.doi.org/10.1021/mp200662f | Mol. Pharmaceutics 2012, 9, 2450−2457

Molecular Pharmaceutics

Article

Table 1. Particle Size, ζ Potential, and SAXS Data for DDAB/GMO-siRNA and GMO/DOTAP-siRNA Complexes formulation ID

cationic lipid (wt %)/bulk lipida formulation

N/P ratiob

sizec (nm)

PDI

± ± ± ± ± ± ±

ζ potential (mV)

7.5DD-1 7.5DD-4 15DD-1 15DD-4 30DD-1 30DD-4 50DD-1

7.5% DDAB/GMO-siRNA 7.5% DDAB/GMO-siRNA 15% DDAB/GMO-siRNA 15% DDAB/GMO-siRNA 30% DDAB/GMO-siRNA 30% DDAB/GMO-siRNA 50%DDAB/GMO-siRNA

1 4 1 4 1 4 1

102 104 113 115 178 185 325

6 2 4 7 3 2 35

0.18 0.14 0.21 0.23 0.15 0.13 0.23

−0.4 40.5 0.3 33.6 0.5 31.3 8.5

50DD-4

50% DDAB/GMO-siRNA

4

432 ± 52

0.24

35.3 ± 2.5

7.5DOT-1 7.5DOT-4 15DOT-1 15DOT-4 30DOT-1 30DOT-4 50DOT-1

7.5% DOTAP/GMO-siRNA 7.5% DOTAP/GMO-siRNA 15% DOTAP/GMO-siRNA 15% DOTAP/GMO-siRNA 30% DOTAP/GMO-siRNA 30% DOTAP/GMO-siRNA 50% DOTAP/GMO-siRNA

1 4 1 4 1 4 1

107 108 122 99 126 112 208

± ± ± ± ± ± ±

0.21 0.15 0.25 0.23 0.14 0.18 0.13

50DOT-4

50% DOTAP/GMO-siRNA

4

200 ± 5

3 6 19 2 8 3 10

0.14

−0.36 26.2 1.5 32 10.3 36.2 −1.3

± ± ± ± ± ± ±

± ± ± ± ± ± ±

0.1 3.1 0.1 2.7 0.2 0.3 1.3

0.04 3.6 0.8 2.5 0.2 0.8 0.5

48.2 ± 1.1

SAXSd

D-spacinge (Å)

HII +? H2 H2 H2 H2 H2 Lα+H2

53.1 51 52.7 50.8 48.8 48.7 55.7 (L) 48.6 (H) 57.2 (L) 48.3 (H) 52.6 51.9 53.4 52.0 50.7 50.7 57.7 (L) 50.7 (H) 57.6 (L) 50.6 (H)

L+H2 H2 H2 H2 H2 H2 H2 L+H2 L+H2

a

The weight percent of each cationic lipid in GMO was formulated at concentrations of 7.5, 15, 30, and 50 wt % of the total bulk lipid, respectively. N/P ratio is the molar ratio of the cationic lipid nitrogen (N) to siRNA phosphate (P) (N/P ratio) of the lipid nanocarrier formulations . cSize measurement of average and standard deviation based on three measurements. dLyotropic mesophase (Lα = lamellar phase, H = hexagonal phase). e D-Spacing measured via synchrotron SAXS analysis. b

size from 102 nm (7.5% DDAB, charge ratio 1) to 432 nm (50% DDAB, charge ratio 4), and DOTAP/GMO-siRNA complexes ranged from 99 to 208 nm (Table 1). Thus, the larger particles were seen to correlate with an appearance of lamellar phases from SAXS analysis. For ζ potential measurements, at a N/P charge ratio of 1, both of the DDAB and DOTAP/GMO-siRNA complexes were essentially neutral as one would expect. At a charge ratio of 4, the complexes were positively charged with ζ potentials between +30 and +50 mV. The phase behavior of DDAB and DOTAP/GMO-siRNA complexes was analyzed by synchrotron SAXS. In Figure 1A, the SAXS spectrum of 7.5% DDAB/GMO without siRNA shows diffuse scattering and the absence of well-defined peaks which are characteristic of vesicle systems. Analogous data for siRNA containing samples for different loadings of DDAB are also shown in Figure 1A. For all concentrations of cationic lipid, the introduction of siRNA results in the appearance of peaks in the scattering data consistent with the formation of liquid crystalline structures. At the lowest DDAB content (7.5%), a hexagonal phase was observed with additional peaks, presumably indicating coexistence with other phase(s). For 15% and 30% DDAB, only the hexagonal phase was observed, with peak positions shifting to higher Q with increasing DDAB concentration, indicating a decrease in lattice parameter. At 50% DDAB, the hexagonal phase disappears and was replaced by a single peak at lower Q, possibly the result of the appearance of a lamellar phase, and this suggests a reorganization of liquid crystalline order at this higher lipid concentration. For a N/P ratio of 4, with loadings of DDAB of 7.5%, 15%, and 30%, the SAXS data also shows peaks consistent with hexagonal phases. Again, peaks shift to higher q with DDAB concentration, indicating a decrease in lattice parameter. At 50% DDAB, the hexagonal phase becomes weaker with appearance of a new peak at q = 0.1127, indicating the

of OPTI-MEM (Invitrogen, USA) and incubated at room temperature for 20 min. The siRNA:lipofectamine mix was added to cells and incubated for 4 h. Cell media was replaced and incubated for 72 h. For cationic lipid/GMO-siRNA complexes, cell media was removed and replaced with 100 μL of OPTI-MEM. Cationic lipid/GMO-siRNA complexes formulations were added to cells and incubated for 4 h. Media was replaced to standard growth media and incubated for a further 72 h. Cells were washed twice with PBS, trypsinized, and washed once with FACS wash (PBS with 1% FBS). Cells were subjected to flow cytometry, and EGFP silencing was analyzed as a percentage of the nonsilencing siRNA or cubosome mixture without siRNA mean EGFP (measured on FITC wavelength) fluorescence.

■

RESULTS Table 1 displays detailed results of the size, charge, and liquid crystal mesophase characterization of the GMO cationic lipid formulations studied in this work. The measurements were obtained from dynamic light scattering, ζ potential, and synchrotron SAXS analysis. In general, the SAXS analysis indicated that a lower loading of cationic lipids permitted the formation of inverse phases, most notably the inverse hexagonal (HII) phase. The lattice spacings for these inverse hexagonal phases were found to decrease with increased lipid loading, presumably due to the increased volume occupied by the double chained lipids relative to the single chain monoglyceride (GMO). At higher cationic lipid loadings, however, an increased tendency for lamellar phases was observed. This is rationalized by the repulsion between charged lipid headgroups at higher loadings, resulting in eventual reduction of negative curvature of the lipid−water interface and a more planar (lamellar) structure resulting. At the same time, lower cationic lipid loadings resulted in lower particle sizes. DDAB/GMO-siRNA particles ranged in 2452

dx.doi.org/10.1021/mp200662f | Mol. Pharmaceutics 2012, 9, 2450−2457

Molecular Pharmaceutics

Article

phase. For a N/P ratio of 4, the trends with DOTAP concentration were qualitatively similar to a N/P ratio of 1. The binding strength of siRNA with DDAB/GMO complexes was qualitatively evaluated using gel electrophoresis stained with a nucleic acid specific dye. Naked siRNA as seen in Figure 2B, lane 2, easily migrates through the gel due to the small size and negative charge of the molecules and is observed toward the bottom of the gel. Because of the size and positive charge of the cationic lipid/GMO-siRNA complexes, the siRNA is retarded and no longer able to migrate through the gel. The extent of siRNA binding can therefore be approximated by the amount of free siRNA versus the amount retained at the top of the gel, as shown in lanes 2−8 in Figure 2A and lanes 4, 5, 6, 8, and 10 in Figure 2B. Among the different DDAB/GMO formulations tested, only the 50% DDAB/GMO NP = 4 (lane 9 Figure 2A) showed complete siRNA binding. Conversely, DOTAP/GMO-siRNA complexes with 15%, 30%, and 50% DOTAP (15DOT-4, 30DOT-4, 50DOT-4; lanes 7, 9, and 11) at a N/P ratio of 4 showed complete siRNA binding. At a N/P ratio of 1, less free siRNA was observed compared to the DDAB equivalents (Figure 2B, lanes 4, 6, and 10). These results indicated that the amount of free or loosely bound siRNA decreases as the ratio of lipid to nucleic acid increases. At a N/P ratio of 1, the complex has virtually a neutral surface ζ potential, therefore it is difficult to bind siRNA strongly via electrostatic interactions. DOTAP lipid formulations showed overall increased siRNA binding compared to the equivalent DDAB formulations, indicating DOTAP is preferable for siRNA delivery. Minimal binding was observed with Lipofectamine 2000 (Figure 2C). Flow cytometry was used to measure the fluorescence of labeled siRNA in the complexes. The minimum particle size detected on a flow cytometer is approximately 100 nm, therefore free siRNA at 9 nm is unable to be detected. An example of this is shown in Figure 3A, where flow cytometry analysis indicates that a 50% DDAB/GMO complex has a low mean fluorescence as expected. The addition of labeled siRNA dramatically increases the mean fluorescence, indicating incorporation of the siRNA into the nanoparticles (Figure 3B). Figure 3C shows a confocal microscope image of 50% DDAB/GMO fluorescently labeled siRNA complexes. No particles are observed when a solution of siRNA alone is imaged (Data not shown). This confirms the presence of discrete siRNA containing complexes after mixing with the lipid formulation (50%DDAB/GMO) which formed dispersed nanoparticles and supports the electrophoresis results where siRNA was strongly associated with the hexagonal and lamellar complexes. The size of the particles is consistent with the result from DLS (see Table 1). Lipid-based carriers of siRNA often show undesired toxicity, predominantly due to the cationic lipids used. An assay based on Alamar Blue reagent was set up to monitor cell viability in the presence of various nonlamellar and lamellar phase cationic lipid/GMO-siRNA complexes. The toxicity of the formulations was compared to a commercially available cationic lipid-based transfection reagent Lipofectamine 2000 (L2000). At a N/P ratio of 1, there is no significant cytotoxicity of DDAB/GMOsiRNA or DOTAP/GMO-siRNA complexes (Figure 4A,B). At N/P ratios of 4, toxicity is observed for the 7.5%, 15%, and 50% DDAB containing complexes. The concentration of GMO in the 7.5% and 15% complexes is 1 and 0.5 mM, respectively. As the toxicity threshold of GMO alone is at 0.3 mM (data not shown), it is therefore not surprising that these formulations are

Figure 1. Synchrotron small-angle X-ray scattering (SAXS) data obtained for (A) DDAB/GMO-siRNA and (B) DOTAP/GMOsiRNA complexes with different charge ratios (N/P). The percentages refer to the weight fraction of cationic lipids relative to total lipids. The arrows indicate small peaks that are poorly resolved.

appearance of a possible lamellar phase. In Figure 1B, the SAXS spectrum of 7.5% DOTAP/GMO without siRNA shows diffuse scattering and the absence of well-defined peaks which are characteristic of vesicle systems. Analogous data for siRNA containing samples for different loadings of DOTAP are shown in Figure 1B. For all concentrations of DOTAP less than 50%, the introduction of siRNA results in the appearance of peaks in the scattering data consistent with hexagonal phases (peak spacing ratios 1:√3:√4). These peaks shift to higher Q with increasing DOTAP concentration, indicating a decrease in lattice parameter. At 50% DOTAP, the scattering intensity due to the hexagonal phase reduces significantly and a large peak at q = 0.1093 appears, possibly indicating the appearance of a lamellar 2453

dx.doi.org/10.1021/mp200662f | Mol. Pharmaceutics 2012, 9, 2450−2457

Molecular Pharmaceutics

Article

Figure 2. Gel electrophoresis of GMO/siRNA complexes with the cationic lipids (A) DDAB, (B) DOTAP, and (C) Lipofectamine 2000. DDAB/ GMO-siRNA and DOTAP/GMO-siRNA complex formed at N/P ratios of 1 and 4, and the weight percent cationic lipid in each sample was varied from 7.5%, 15%, 30%, and 50 wt %. Lipofectamine 2000 complex was formulated with 1 μL of reagent plus 50 pmol si22 in 10 μL of OPTIMEM for 20 m at RT. Gel electrophoresis was performed through a 2% agarose gel at 100 mV for 40 min.

cytotoxic. This is also true for the 7.5% DOTAP/GMO N/P = 4 sample. GMO-based cubic phase nanoparticles exhibit very fast and effective lipid mixing with phospholipid bilayers, both with model and cell membranes, resulting in massive hemolysis when mixed with red blood cells.12 Therefore, over a certain concentration limit of GMO, those doses are expected to cause cell death by membrane disturbance. Combined toxicity from both GMO and DDAB could contribute to the cytotoxic effect observed with the 50% DDAB/GMO-siRNA complex at a N/P ratio 4. This could be related to (1) cytotoxicity from synthetic DDAB cationic lipid and (2) lamellar phase structure of this complex (SAXS data) maximizing the exposure of the cell membrane to the DDAB component. For the DOTAP/GMOsiRNA complexes (Figure 4B), no cytotoxicity can be observed for the 15%, 30%, and 50% DOTAP even at a N/P ratio 4. These results indicated that the DOTAP lipid appears to be less toxic when combined with GMO, making DOTAP a more favorable choice for siRNA delivery than DDAB. Gene-silencing experiments were performed to determine whether the pure hexagonal or a mixture of hexagonal and lamellar phases were more efficient at delivering siRNA to cells and therefore inducing silencing of the reporter gene enhanced green fluorescent protein (GFP). GFP when excited by a blue 408 nm laser emits a green signal at approximately 518 nm. This is readily detected by both fluorescence microscopy and flow cytometry. CHO-GFP cells ubiquitously express GFP, and successful delivery of a siRNA targeting GFP to these cells can, therefore, be easily determined by a shift in the cell population on a flow cytometry plot and by a decrease in mean GFP fluorescence. This can then be analyzed as a percentage knockdown compared to untreated control cells (Figure 4C,D). In the case of the DOTAP formulations (Figure 4D), the most dramatic difference in knock down efficiency is observed with a lower percentage of DOTAP and higher GMO content. This finding indicates that the inverted hexagonal phase obtained with GMO appears to be far superior at siRNA delivery than the mixture of lamellar and inverted hexagonal phases. For example, 70% gene knockdown was observed with the 7.5% DOTAP N/P = 1 formulation, while the 50% DOTAP N/P = 1 formulation resulted in only 18% knockdown. Interestingly, although GMO-containing complexes with different percentages of DOTAP formed similar inverted hexagonal

Figure 3. (A) Flow cytometry histogram for 50% DDAB GMO/ unlabeled siRNA complexes, mean fluorescence intensity detected for Pacific Blue dye is indicated (B). Flow cytometry histogram for 50% DDAB GMO/Pacific Blue labeled siRNA complexes, mean fluorescence intensity detected for pacific blue dye is indicated. (C) Fluorescent microscopy image of 50% DDAB/GMO-siRNA (Pacific Blue labeled) complexes (N/P charge ratio of 4).

2454

dx.doi.org/10.1021/mp200662f | Mol. Pharmaceutics 2012, 9, 2450−2457

Molecular Pharmaceutics

Article

Figure 4. Cell viability results for CHO-GFP cells incubated with (A) DDAB/GMO-siRNA complexes and (B) DOTAP/GMO-siRNA complexes with the concentration of cationic lipid at 7.5%, 15%, 30%, and 50 wt % and the N/P ratio being either 1 or 4. Results are presented as a percentage of viable cells compared to untreated cells. (C,D) GFP silencing in CHO cells constitutively expressing GFP DDAB/GMO-siRNA and DOTAP/ GMO-siRNA complexes, respectively. Results are presented as a percentage of GFP knockdown compared to untreated cells.

associated with large positively charged polymers. In this instance, DOTAP appears to be the preferred cationic lipid as it has a higher siRNA binding affinity and appears less toxic than DDAB. Cubic phase nanoparticles have previously been reported to mediate enhanced fusion between the membranes of the nanoparticle complex and the endosomal membrane, resulting in higher silencing efficiency.8 In our study, we have found that hexagonal phase complexes can efficiently knock down gene expression in vitro without the need for cubic phase complexes to be present. Koynova et al.5b,c,e,13 found that high transfection efficiency cationic lipids promote the formation of inverted cubic phases when they interact with membrane lipids. Koltover et al.14 used DOPE as a helper lipid with DOTAP to form a hexagonal phase DNA complex which was capable of rapid fusion and release of DNA upon adherence to anionic vesicles.14 We hypothesize that an intracellular nonlamellar phase transition from hexagonal to cubic phase of our cationic lipid/GMO nanoparticles after interacting with the endosomal membrane may possibly explain their mode of entry into the cell, resulting in effective silencing. Our data showed that hexagonal GMO−siRNA complexes with virtually neutral charge resulted in higher knockdown efficiency, indicating that greater silencing efficiency involves more than merely electrostatic interactions and the phase of the lipid nanoparticle complex is important. On the basis of these theories and experimental findings, the following hypothesis may be drawn.

phase particles, a general trend of increasing knockdown efficiency with decreasing DOTAP concentration was observed. It was also observed that better silencing and therefore siRNA delivery was achieved with the lower charge ratio samples (NP = 1) for both the DDAB and DOTAP complexes despite less efficient binding of the siRNA observed in the electrophoresis gels and lower ζ potentials (Figure 2, Table 1). This is similar to the results observed with Lipofectamine 2000, where minimal binding but highly efficient silencing was observed (Figure 3C; Figure 4C,D). The most efficient silencing was observed with the 7.5% and 15% DOTAP/ GMO siRNA complexes (Figure 4D). This correlates well with the higher binding capacity of these complexes over the equivalent DDAB/GMO siRNA complexes (Figure 2) and the majority of the particles forming inverted hexagonal phase.

■

DISCUSSION Usually, efficient delivery of siRNAs to cells in culture requires a higher N/P ratio to give enough positive charge to both bind the siRNA and promote fusion of the membrane. However, polymers with a high positive charge tend to be cytotoxic. Our data showed that in this system the ideal siRNA delivery vehicle appears to require a low concentration of the cationic lipid sufficient to bind the siRNA, allowing delivery and higher concentrations of GMO to produce hexagonal phase particles to allow efficient cell membrane fusion. A low overall positive charge of the particle helps overcome the toxicity problem 2455

dx.doi.org/10.1021/mp200662f | Mol. Pharmaceutics 2012, 9, 2450−2457

Molecular Pharmaceutics

Article

(3) (a) Zimmermann, T. S.; Lee, A. C. H.; Akinc, A.; Bramlage, B.; Bumcrot, D.; Fedoruk, M. N.; Harborth, J.; Heyes, J. A.; Jeffs, L. B.; John, M.; Judge, A. D.; Lam, K.; McClintock, K.; Nechev, L. V.; Palmer, L. R.; Racie, T.; Rohl, I.; Seiffert, S.; Shanmugam, S.; Sood, V.; Soutschek, J.; Toudjarska, I.; Wheat, A. J.; Yaworski, E.; Zedalis, W.; Koteliansky, V.; Manoharan, M.; Vornlocher, H. P.; MacLachlan, I. RNAi-mediated gene silencing in non-human primates. Nature 2006, 441 (7089), 111−114. (b) Akinc, A.; Zumbuehl, A.; Goldberg, M.; Leshchiner, E. S.; Busini, V.; Hossain, N.; Bacallado, S. A.; Nguyen, D. N.; Fuller, J.; Alvarez, R.; Borodovsky, A.; Borland, T.; Constien, R.; de Fougerolles, A.; Dorkin, J. R.; Jayaprakash, K. N.; Jayaraman, M.; John, M.; Koteliansky, V.; Manoharan, M.; Nechev, L.; Qin, J.; Racie, T.; Raitcheva, D.; Rajeev, K. G.; Sah, D. W. Y.; Soutschek, J.; Toudjarska, I.; Vornlocher, H. P.; Zimmermann, T. S.; Langer, R.; Anderson, D. G. A combinatorial library of lipid-like materials for delivery of RNAi therapeutics. Nature Biotechnol. 2008, 26 (5), 561−569. (c) Schroeder, A.; Levins, C. G.; Cortez, C.; Langer, R.; Anderson, D. G. Lipid-based nanotherapeutics for siRNA delivery. J. Intern. Med. 2010, 267 (1), 9− 21. (d) Bouxsein, N. F.; McAllister, C. S.; Ewert, K. K.; Samuel, C. E.; Safinya, C. R. Structure and gene silencing activities of monovalent and pentavalent cationic lipid vectors complexed with siRNA. Biochemistry 2007, 46 (16), 4785−4792. (4) (a) Lu, J. J.; Langer, R.; Chen, J. Z. A Novel Mechanism Is Involved in Cationic Lipid-Mediated Functional siRNA Delivery. Mol. Pharmaceutics 2009, 6 (3), 763−771. (b) Martin-Herranz, A.; Ahmad, A.; Evans, H. M.; Ewert, K.; Schulze, U.; Safinya, C. R. Surface Functionalized Cationic Lipid−DNA Complexes for Gene Delivery: PEGylated Lamellar Complexes Exhibit Distinct DNA−DNA Interaction Regimes. Biophys. J. 2004, 86 (2), 1160−1168. (c) Ahmad, A.; Evans, H. M.; Ewert, K.; George, C. X.; Samuel, C. E.; Safinya, C. R. New multivalent cationic lipids reveal bell curve for transfection efficiency versus membrane charge density: lipid−DNA complexes for gene delivery. J. Gene Med. 2005, 7, 739−748. (5) (a) Tarahovsky, Y. S.; Koynova, R.; MacDonald, R. C. DNA release from lipoplexes by anionic lipids: correlation with lipid mesomorphism, interfacial curvature, and membrane fusion. Biophys. J. 2004, 87 (2), 1054−1064. (b) Koynova, R.; Wang, L.; MacDonald, R. C. An intracellular lamellar−nonlamellar phase transition rationalizes the superior performance of some cationic lipid transfection agents. Proc. Natl. Acad. Sci. U.S.A. 2006, 103 (39), 14373−14378. (c) Koynova, R.; Wang, L.; MacDonald, R. C. Cationic phospholipids forming cubic phases: lipoplex structure and transfection efficiency. Mol. Pharmaceutics 2008, 5 (5), 739−744. (d) Tenchov, B. G.; Wang, L.; Koynova, R.; MacDonald, R. C. Modulation of a membrane lipid lamellar−nonlamellar phase transition by cationic lipids: a measure for transfection efficiency. Biochim. Biophys. Acta, Biomembr. 2008, 1778 (10), 2405−2412. (e) Koynova, R.; Tenchov, B. Cationic phospholipids: structure−transfection activity relationships. Soft Matter 2009, 5 (17), 3187−3200. (6) Almsherqi, Z. A.; Kohlwein, S. D.; Deng, Y. Cubic membranes: a legend beyond the Flatland of cell membrane organization. J. Cell Biol. 2006, 173 (6), 839−844. (7) (a) Almsherqi, Z. A.; Landh, T.; Kohlwein, S. D.; Deng, Y.; Kwang, W. J., Cubic Membranes: The Missing Dimension of Cell Membrane Organization. In International Review of Cell and Molecular Biology; Academic Press: New York, 2009; Vol. 274, Chapter 6, pp 275−342; (b) Almsherqi, Z.; Hyde, S.; Ramachandran, M.; Deng, Y. Cubic membranes: a structure-based design for DNA uptake. J. R. Soc. Interface 2008, 5 (26), 1023−1029. (8) Leal, C.; Bouxsein, N. F.; Ewert, K. K.; Safinya, C. R. Highly Efficient Gene Silencing Activity of siRNA Embedded in a Nanostructured Gyroid Cubic Lipid Matrix. J. Am. Chem. Soc. 2010, 132 (47), 16841−16847. (9) (a) Angelova, A.; Angelov, B.; Mutafchieva, R.; Lesieur, S.; Couvreur, P. Self-Assembled Multicompartment Liquid Crystalline Lipid Carriers for Protein, Peptide, and Nucleic Acid Drug Delivery. Acc. Chem. Res. 2011, 44 (2), 147−156. (b) Clogston, J.; Caffrey, M. Controlling release from the lipidic cubic phase. Amino acids, peptides, proteins and nucleic acids. J. Controlled Release 2005, 107 (1), 97−111.

When hexagonal phase cationic lipid/cubic phase lipid (GMO)−siRNA complexes enter the endosome, anionic lipids on the endosome membrane will compensate the cationic lipid complex surface charge and eliminate the electrostatically driven siRNA binding to the membrane interface. These lipids may also disrupt the nanoparticle complex structure and facilitate siRNA escape into the cytoplasm by inducing cubic phases upon mixing with the lipids in the complex. This fusion process would allow the delivered siRNA to escape from endosomal vesicles and hence avoid degradation by endosomolytic enzymes.

■

CONCLUSION This study demonstrated that GMO-based nanocarriers could be formulated for efficient siRNA delivery and gene silencing in vitro in CHO and HEK cells. Among the different formulations investigated in this study, DOTAP/GMO-siRNA complexes having a low percentage of DOTAP at a neutral charge ratio exhibited the highest degree of silencing with virtually no negative implications for cell viability. This study showed that the relative amounts of cationic lipid and GMO in a formulation can be used to control the DOTAP/GMOsiRNA complex phase, thus helping efficient delivery of siRNA and endosomal escape.

■

ASSOCIATED CONTENT

S Supporting Information *

This material is available free of charge via the Internet at http://pubs.acs.org.

■

AUTHOR INFORMATION

Corresponding Author

*For G.Z.: [email protected]. For T.M.H.: phone, +61 3 52275746; fax, +61 3 5227 5555; E-mail, Tracey. [email protected]; address, Private Bag 24, 5 Portarlington Road, Geelong, Victoria 3220, Australia. Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS This research was undertaken in part on the Small-Angle X-ray Scattering beamline at the Australian Synchrotron, Victoria State, Australia. We thank Dr. Nigel Kirby of the Australian Synchrotron for his assistance in the setup of the SAXS beamline.

■

REFERENCES

(1) (a) Morrissey, D. V.; Lockridge, J. A.; Shaw, L.; Blanchard, K.; Jensen, K.; Breen, W.; Hartsough, K.; Machemer, L.; Radka, S.; Jadhav, V.; Vaish, N.; Zinnen, S.; Vargeese, C.; Bowman, K.; Shaffer, C. S.; Jeffs, L. B.; Judge, A.; MacLachlan, I.; Polisky, B. Potent and persistent in vivo anti-HBV activity of chemically modified siRNAs. Nature Biotechnol. 2005, 23 (8), 1002−1007. (b) Takeshita, F.; Ochiya, T. Therapeutic potential of RNA interference against cancer. Cancer Sci. 2006, 97 (8), 689−696. (c) Morrissey, D. V.; Lockridge, J. A.; Shaw, L.; Blanchard, K.; Jensen, K.; Breen, W.; Hartsough, K.; Machemer, L.; Radka, S.; Jadhav, V.; Vaish, N.; Zinnen, S.; Vargeese, C.; Bowman, K.; Shaffer, C. S.; Jeffs, L. B.; Judge, A.; MacLachlan, I.; Polisky, B. Potent and persistent in vivo anti-HBV activity of chemically modified siRNAs. Nature Biotechnol. 2005, 23 (8), 1002−1007. (2) Whitehead, K. A.; Langer, R.; Anderson, D. G. Knocking down barriers: advances in siRNA delivery. Nature Rev. Drug Discovery 2009, 8 (2), 129−138. 2456

dx.doi.org/10.1021/mp200662f | Mol. Pharmaceutics 2012, 9, 2450−2457

Molecular Pharmaceutics

Article

(c) Angelova, A.; Angelov, B.; Papahadjopoulos-Sternberg, B.; Ollivon, M.; Bourgaux, C. Proteocubosomes: Nanoporous Vehicles with Tertiary Organized Fluid Interfaces. Langmuir 2005, 21 (9), 4138− 4143. (10) (a) Drummond, C. J.; Fong, C. Surfactant self-assembly objects as novel drug delivery vehicles. Curr. Opin. Colloid Interface Sci. 1999, 4 (6), 449−456. (b) Yang, D.; Armitage, B.; Marder, S. R. Cubic liquidcrystalline nanoparticles. Angew. Chem. Int. Ed. 2004, 43 (34), 4402− 4409. (c) Shah, J. C.; Sadhale, Y.; Chilukuri, D. M. Cubic phase gels as drug delivery systems. Adv. Drug Delivery Rev. 2001, 47 (2−3), 229− 250. (11) Campbell, R. B.; Fukumura, D.; Brown, E. B.; Mazzola, L. M.; Izumi, Y.; Jain, R. K.; Torchilin, V. P.; Munn, L. L. Cationic charge determines the distribution of liposomes between the vascular and extravascular compartments of tumors. Cancer Res. 2002, 62 (23), 6831−6836. (12) (a) Ericsson, E. M.; Faxälv, L.; Weissenrieder, A.; Askendal, A.; Lindahl, T. L.; Tengvall, P. Glycerol monooleate−blood interactions. Colloids Surf., B 2009, 68 (1), 20−26. (b) Barauskas, J.; Cervin, C.; Jankunec, M.; Spandyreva, M.; Ribokaite, K.; Tiberg, F.; Johnsson, M. Interactions of lipid-based liquid crystalline nanoparticles with model and cell membranes. Int. J. Pharm. 2010, 391 (1−2), 284−291. (13) Koynova, R.; Wang, L.; Tarahovsky, Y.; MacDonald, R. C. Lipid phase control of DNA delivery. Bioconjugate Chem. 2005, 16 (6), 1335−1339. (14) Koltover, I.; Salditt, T.; Radler, J. O.; Safinya, C. R. An inverted hexagonal phase of cationic liposome−DNA complexes related to DNA release and delivery. Science 1998, 281 (5373), 78−81.

2457

dx.doi.org/10.1021/mp200662f | Mol. Pharmaceutics 2012, 9, 2450−2457