Gold Nanoparticles with Asymmetric Polymerase Chain Reaction for

Article pubs.acs.org/ac

Gold Nanoparticles with Asymmetric Polymerase Chain Reaction for Colorimetric Detection of DNA Sequence Hua Deng,† Yi Xu,† Yanhua Liu,‡ Zhijun Che,‡ Huilin Guo,‡ Shuxian Shan,† Yun Sun,† Xiaofang Liu,† Keyang Huang,† Xiaowei Ma,† Yan Wu,† and Xing-Jie Liang*,† †

CAS Key Laboratory for Biomedical Effects of Nanomaterials and Nanosafety, National Center for Nanoscience and Technology of China, Beijing 100190, China ‡ Beijing Entry-Exit Inspection and Quarantine Bureau, Beijing 100026, China ABSTRACT: We developed a novel strategy for rapid colorimetric analysis of a specific DNA sequence by combining gold nanoparticles (AuNPs) with an asymmetric polymerase chain reaction (As-PCR). In the presence of the correct DNA template, the bound oligonucleotides on the surface of AuNPs selectively hybridized to form complementary sequences of single-stranded DNA (ssDNA) target generated from AsPCR. DNA hybridization resulted in self-assembly and aggregation of AuNPs, and a concomitant color change from ruby red to blue-purple occurred. This approach is simpler than previous methods, as it requires a simple mixture of the asymmetric PCR product with gold colloid conjugates. Thus, it is a convenient colorimetric method for specific nucleic acid sequence analysis with high specificity and sensitivity. Most importantly, the marked color change occurs at a picogram detection level after standing for several minutes at room temperature. Linear amplification minimizes the potential risk of PCR product cross-contamination. The efficiency to detect Bacillus anthracis in clinical samples clearly indicates the practical applicability of this approach.

T

the process fully. The hybridization procedure was complicated and lengthy, often taking several hours to complete.15,16 Further, the targets used in these experiments were synthetic oligonucleotides (oligos), while the genomic DNA (gDNA) of an organism is typically dsDNA and much longer. Thus the utility of the previous studies in clinical application for organisms is questionable. Other AuNPs-based methods have been proposed for DNA detection.17−20 These label-free assays seem to be easily executable because there is no requirement of covalent modification of DNA and AuNPs surfaces. However, the seeming simplicity belies further complication: during noncross-linking of AuNPs, a balance between the amount of probes and the target DNA in the PCR product must be carefully maintained. If this balance is lost, the colorimetric analysis may become uncontrollable. Recently, a method called Nano-PCR was developed for colorimetric detection of a DNA sequence.21 In spite of its simplicity, PCR amplification with nanoprimers was limited by the steric crowding of oligos on the surface of AuNPs. This often resulted in a weak color change that was difficult to perceive without visual aid. In this system, the feasible size of the target fragment was very short (typically

he molecular diagnosis of nucleic acid has a wide variety of applications, and as a result many different molecular diagnostic methods have been proposed in recent decades. Restriction fragment length polymorphism (RFLP), real-time PCR, and DNA sequencing are important existing approaches.1−4 These techniques are time-consuming and often require expensive and complicated instruments for implementation. The practical limitations are clear. For example, it is difficult to quickly detect microbial pathogens like Bacillus anthracis using these methods. In terms of the utility of molecular diagnosis and the limitations of existing methods, it is of great importance to consider alternative methods that may successfully identify a target gene or fragment more rapidly and more simply. Advances in nanotechnology have greatly impacted biodiagnostics and have been widely applied in the biomedical field.5−8 Gold nanoparticles (AuNPs) have attracted tremendous interest because of their unique optical properties, their robust nature, and their large surface areas. AuNPs can consequently be useful as biosensors in molecular recognition, cancer detection, and clinical therapy.9−13 These features provide clear advantages over other methods of nucleic acid analysis, as shown in certain pioneer studies.14 DNA targetinduced aggregation resulted in a color change of AuNPs because of its close proximity with changed surface plasmon resonance (SPR). A small amount of DNA could be identified, but additional instruments or devices were necessary to execute © 2012 American Chemical Society

Received: July 3, 2011 Accepted: January 13, 2012 Published: January 13, 2012 1253

dx.doi.org/10.1021/ac201713t | Anal. Chem. 2012, 84, 1253−1258

Analytical Chemistry

Article

Table 1. DNA Fragments, Primers, and Probes Used in This Study actin-F actin-R actin-probe-1 actin-probe-2 target DNA random DNA B. anthracis-F B. anthracis-R B. anthracis-probe-1 B. anthracis-probe-2

sequence (5′−3′)

length (nucleotides (nt))

CTTCTCTTTGATGTCACGCA GATGCCACAGGATTCCATA thiol-C6-TGCGTGACATCAAAGAGAAG thiol-C6-GATGCCACAGGATTCCATA CTTCTCTTTGATGTCACGCATATGGAATCCTGTGGCATC ACGGTGCTCTGAGTTCAACCTGGCCTACGAGCCGGATCA AGATAAATGCGTAAGGACAA ACATAGAAGGACGATACAGAC thiol-C6- CATTTATTGGGAACTACACAT thiol-C6- ACATAGAAGGACGATACAGA

20 19 20 19 39 39 20 21 21 20

Figure 1. Synthesis and characterization of AuNPs by TEM, DLS, and UV−visible spectrophotometry. (A) Scheme of preparation of AuNPs. (B) TEM image of ∼13 nm diameter AuNPs. (C) DLS analysis of AuNPs. (D) UV−visible spectra of AuNPs.

solution quickly. After several minutes, the solution changed from a pale yellow to a deep red color. The solution was then refluxed for 15 min to ensure complete reduction. The colloidal solution was then slowly cooled to room temperature and could be stored for further use. Functionalization of AuNPs. By mixing AuNPs and DNA, the conjugation of nanoparticles and thiolated-oligos was induced. When AuNPs and DNA are mixed, a strong covalent Au−S bond spontaneously forms between the two components. Details of this procedure have been described in other research, albeit with slight modifications from the present study.23,24 In this study, 1.5 OD synthesized oligos was dissolved in 100 μL of freshly prepared 0.1 M dithiothreitol (DTT) in disulfide cleavage buffer (170 mM phosphate buffer, pH 8.0). Disulfide cleavage took place at room temperature for 1 h, and after completion, the DNA was loaded onto a Nap-5 column for purification. The reduced thiolated-oligos was then mixed with AuNPs (50 nM), wrapped in foil, and placed in an orbital shaker at a low speed for 16 h at room temperature. The solution was then brought to 0.1 M NaCl and allowed to stand for 40 h. Particles were centrifuged for 30 min at 13 500 rpm, and to remove unbound ssDNA from the mixture, the red oily precipitate was washed with 5 mL of washing buffer (0.1 M NaCl, 10 mM phosphate buffer, pH 7.0). The pellets were then collected and resuspended in 0.3 M NaCl 10 mM phosphate buffer (pH 7.0), 0.01% azide. Asymmetric PCR. The asymmetric PCR reaction was performed in a volume of 50 μL. The mixture contained Promega PCR Master Mix buffer, excess forward primer,

about 40 base pairs (bp)). This could have posed a problem in ensuring target gene specificity. In this study, we demonstrate a novel colorimetric method to detect a DNA sequence: employment of asymmetric polymerase chain reaction (As-PCR) to generate a target ssDNA. The DNA hybridization was conducted by mixing amplified product with AuNP-probe conjugates. When the target fragment was present in the reaction mixture, a distinct ruby red to bluepurple color change occurred after a few minutes at room temperature.

■

EXPERIMENTAL SECTION Chemicals and Reagents. Hydrogen tetrachloroaurate and sodium citrate were purchased from Sigma-Aldrich. Transmission electron microscopy (TEM) images were captured on a Tecnai G2 20 S-Twin TEM. Particle size was measured by Malvern Zetasizer Nano-ZS. UV−visible spectra were recorded on a Perkin-Elmer UV−vis spectrophotometer Lamda 950. Nanopure water (18.2 MΩ) was used in all solutions, unless otherwise stated. PCR primers and 5′disulfide-containing oligos were synthesized by Invitrogen Co., Ltd. PCR kits were purchased from Promega Co., Ltd. The DNA target, probes, and primer set designed for mouseactin or B. anthracis sequence analysis are listed in Table 1. Preparation of AuNPs. The 13 nm AuNPs were synthesized using a standard citrate method.22 A 40 mL solution containing 0.4 mL of 1% HAuCl4·3H2O was constantly stirred and heated to its boiling point. After its boiling point was reached, 1.2 mL of 1% trisodium citrate was added to the 1254

dx.doi.org/10.1021/ac201713t | Anal. Chem. 2012, 84, 1253−1258

Analytical Chemistry

Article

Figure 2. (A) Asymmetric and symmetric PCR products were analyzed by 3% agarose gel electrophoresis. A series of primer ratios were optimized to produce ssDNA. The final concentrations (μM) of sense primer to antisense primer were 0.6/0.02 for lane 1, 0.6/0.01 for lane 2, 0.6/0.005 for lane 3, 0.6/0.0025 for lane 4, 1/0.01 for lane 5, 0.2/0.2 for lane 7, 0.02/0.6 for lane 8, and there was no template for lane 6. dsDNA from conventional PCR was shown in lane 7 and acted as a control, and asDNA with the reverse primer ratio was in lane 8. (B) For hybridization, 5 μL of PCR products for ssDNA, NC, dsDNA, and asDNA from lanes 3, 6, 7, and 8 were directly mixed with 10 μL of 10 nM gold colloid conjugates plus 4 μL of 4 M NaCl and incubated at room temperature. Color change was observed without visual aid or equipment. (C) UV−visible spectra analysis of these reaction mixtures.

Figure 3. Schematic diagram of the detection strategy reliant on AuNP-oligos aggregation upon hybridization with target DNA. (A) On the basis of the mouse-actin sequence, the AuNP-bound oligos with thiol-modification were denoted as probe 1 and probe 2. A DNA fragment containing 39 nt, complementary to probe 1 and probe 2, tethered AuNPs closely together and triggered the SPR effect with a visible color change. In contrast, the random sequence failed to induce self-assembly of AuNPs, and the gold colloid maintained its ruby red color. Note that this is a simplified drawing of the process. The dense oligos layer formed in these conjugates with approximately 100 copies of DNA per nanoparticle. (B) The synthetic 39 nt target and the random sequence with the same size acted as template DNA in the As-PCR process. DNase-free water, instead of DNA template, denoted NC. PCR products were employed for DNA hybridization as mentioned before. (C) UV−visible spectra photograph of the hybridization mixtures.

limiting reverse primer, and DNA template. The cycling procedure for the mouse-actin amplification was as follows: 2 min at 94 °C, 35 cycles of 20 s at 94 °C, 20 s at 55 °C, and 20 s at 70 °C, with a final 3 min at 70 °C. The cycling procedure for the B. anthracis amplification was as follows: 3 min at 94 °C, 40 cycles of 30 s at 94 °C, 25 s at 53 °C, and 25 s at 72 °C, with a final 5 min at 72 °C. In symmetric PCR, the reaction conditions were the same as the conditions for As-PCR, with the exception that the same concentrations of up and down primers were used for symmetric PCR. PCR products were then separated by electrophoresis on a 3% or 2% agarose gel. The DNA hybridization assay was carried out by mixing PCR product with AuNP-probe conjugates at room temperature. The mixture’s color change was observed without any visual aid.

■

desired size, we used the simplest and most common method (Figure 1A). In this method, citrate acts as both a reducing agent and a capping agent, which may be readily modified for further biological application. Particle diameter and size distribution were determined by TEM and dynamic light scattering (DLS) (Figure 1B,C). The resulting AuNPs exhibit an almost round shape, similar sizes, and good monodispersity. A typical solution containing AuNPs with 13 nm diameters exhibits maximum absorbance at wavelength 520 nm, as demonstrated by spectrophotometry (Figure 1D). After conjugation with thiol-modified DNA, well-functionalized AuNPs maintain the same color as plain AuNPs and do not have visible aggregates. Conjugates exhibit a surface plasmon band centered at 524 nm, which is a slight shift from that of the plain AuNPs. The bound oligos on AuNPs surfaces hybridize selectively to cDNA sequences. Further, the bound oligos can effectively protect AuNPs from agglomeration in high salt solutions of up to 2 M NaCl. These features are critical for our downstream hybridization assays.

RESULTS AND DISCUSSION

Synthesis and Characterization of AuNPs and AuNPDNA Conjugates. To prepare spherical AuNPs with the 1255

dx.doi.org/10.1021/ac201713t | Anal. Chem. 2012, 84, 1253−1258

Analytical Chemistry

Article

Figure 4. Sensitivity tests of detection system: (A) 10-fold serial dilutions of target DNA from 100 ng to 10 pg as PCR starting templates; amplified product was used for DNA hybridization and concomitant color change. (B) Correlation of PCR product loading volume and maximum absorbance shift by UV−vis spectra analysis. Starting template DNA (1 ng) was used, and the data shows the average value of three independent experiments.

Generating ssDNA Target from As-PCR and DNA Hybridization. We initially selected the mouse-actin sequence as a model to establish our system. A 39 nt/bp fragment was amplified and then separated using 3% agarose gel electrophoresis. Compared to the double-stranded DNA (dsDNA) band in lane 7 (generated from symmetric PCR), specific bands in lanes 1−5 and lane 8 shifted more rapidly (Figure 2A). Presumably, these six bands were a product of ssDNA. This was further confirmed by the following DNA hybridization assays. As expected, the negative control (NC) without template DNA showed no bands. Unlike conventional PCR, asymmetric PCR generates one of the strands by linear amplification, and a fraction of its total product as dsDNA is limited by the concentration ratio of the primers used. To produce a greater amount of available single-stranded target in the amplification reaction, we worked with different ratios of forward primer and reverse primer. The optimal ratio of sense to antisense primer was 30:1, and the final concentration of limiting primer in this As-PCR was fixed at 0.02 μM. This was found to have a stronger band using electrophoresis analysis. After mixing the PCR product with gold colloid conjugating probes, a marked shift from a ruby red to a blue-purple color occurred for the ssDNA amplicon within 3 min at room temperature. NC, dsDNA, and antisense-DNA (asDNA) showed no color change under the same conditions (Figure 2B). There was no color change that occurred when either probe 1 or probe 2 was used for hybridization. To confirm this colorimetric change, UV−visible spectrophotometry was used and a spectral shift from 524 to 531 nm was recorded (Figure 2C). The fundamental principle is depicted in Figure 3A. In the presence of the complementary sequence, nanoparticles bearing hundreds of oligo strands assemble into polymeric macrostructures. ssDNA hybridization by base pairing creates a DNAguided self-assembly process of AuNPs and causes a concomitant color change due to a red-shift of the particle plasmon peak. Decreased interparticle distance results from particle aggregation. When the distance falls below the average approximate particle diameter (∼13 nm), the gold colloids change from a ruby red to a blue-purple color.25 The aggregated particles were visible soon after. A pinkish-gray precipitate settled to the bottom of the tube, and the solution became clear over the course of several hours (Figure 3B). There was a significant red-shift of the SPR peak from 524 to 575 nm (Figure 3C). The optical changes of AuNPs associated with this polymeric assembly make this system particularly effective for use as a biosensor.

The sensitivity of this approach was also investigated. The 10-fold serial dilutions of starting template from 100 ng, 10 ng, 1 ng, 100 pg, and 10 pg were used to perform asymmetric PCR. An immediate color change from red to purple was observed for the 100 ng, 10 ng, 1 ng, and 100 pg starting samples. A color change from red to pinkish occurred within 20 min for the 10 pg starting DNA (Figure 4A). As little as 10 pg of DNA are identifiable without the use of visual aids. It may be speculated that further PCR optimization may help to enhance this sensitivity. For most experiments, 5 μL of amplified product was used to run the hybridization assay. As little loading volume as 1 μL of PCR product created an average red-shift of 4.6 nm, and 0.5 μL created an average red-shift of 2.3 nm recorded using a UV−vis spectrophotometer (Figure 4B).The absorbance peak of AuNPs shifts to longer wavelength (red-shift) with increased aggregate size. The AuNPs aggregate size is dependent on the concentration of the target for DNA hybridization. The absorbance peak shows an increased redshift with a distinct color change as the PCR product volume increases up to 5 μL. A decreased red-shift occurs because there are less DNA-linked AuNPs aggregates when the volume used is less than 5 μL. Asymmetrical PCR is an economical and simply executable way to produce the partial ssDNA target, and it often requires much more of one of the primer pairs than the other in the mixture.26 It is believed that a single-stranded molecule can hybridize with a complementary sequence more efficiently due to no competitive pressure.27,28 As-PCR targets can obviously increase hybridization efficiency and detection sensitivity in comparison to conventional PCR amplicons. This system does not require As-PCR to be particularly or carefully optimized. Similar results were obtained for the nonoptimal ssDNA product, indicating that the introduced As-PCR was a major contributor. The final concentration of NaCl was approximately 1 M in this system. Compared to a previous study using 0.3 M NaCl in a reaction mixture, the use of 1 M NaCl in a reaction mixture dramatically facilitated DNA hybridization.18 We can obviate the denaturation-annealing or freezing-thawing steps used elsewhere and instead use incubation at room temperature for a short period of time (several minutes).25 B. anthracis Identification. In the mouse-actin model, the target size was equal to the size of probe 1 and probe 2 combined: 39 nt. In many PCR-based diagnostic protocols, however, larger amplicons with sizes of several hundred base pairs are routinely used. To further demonstrate the practical application of this process, we tested the ability of the system to identify real B. anthracis samples. On the basis of previous 1256

dx.doi.org/10.1021/ac201713t | Anal. Chem. 2012, 84, 1253−1258

Analytical Chemistry

Article

Figure 5. B. anthracis identification using the established system. (A) A fragment with 116 nt of the B. anthracis genome was chosen, containing the target sequence (41 nt) highlighted in red and completely complementary to probe sequences. The underlined sequences denote the B. anthracis specific primers. (B) Different ratios of up primer to down primer (100:1, 50:1, 30:1, 10:1, 1:1 for lanes 1, 2, 3, 4, and 5; no template as NC for lane 6) were used to amplify the B. anthracis fragment. PCR products were separated by electrophoresis on a 2% agarose gel. (C) DNA hybridization was performed, and the color change was observed after approximately 5 min in the presence of clinical B. anthracis sample. (D) Comparison of spectra change for B. anthracis and NC by UV−vis spectrophotometry.

■

studies,29,30 a fragment of genome was selected to identify B. anthracis using Basic Local Alignment Search Tool (BLAST) analysis (Figure 5A). The 116 nt/bp sequence was able to distinguish B. anthracis from several closely related species of the Bacillus cereus group. Specific bands with the expected sizes were confirmed by agarose gel electrophoresis (Figure 5B). Hybridization assay and a concomitant color change after 5 min confirmed the sample identity (Figure 5C). Figure 5D shows the red-shift from 524 to 530 nm that occurred in this reaction. To avoid a false-negative result that often presents in clinical isolates (derived from PCR inhibitors), we spike an internal control as mouse-actin fragment in the same tube for the multiplex asymmetric PCR assay. So long as PCR operates correctly and there are no PCR inhibitors in the clinical samples, this internal control will be always positive. The unknown samples may only be genotyped if a color change is present in the internal control.

■

CONCLUSIONS

■

AUTHOR INFORMATION

ACKNOWLEDGMENTS The Bacillus anthracis gDNA was kindly given by Prof. Qing Duan (State Key Laboratory of Pathogen and Biosecurity). This work has been financially supported by the National Key Basic Research Program of China (MOST 973 Project 2009CB930200) and the National Natural Science Foundation of China (Grants 30970784 and 81171455). The authors are especially grateful for the support of the Chinese Academy of Sciences (CAS) “Hundred Talents Program” and the CAS Knowledge Innovation Program.

■

REFERENCES

(1) Bidwell, J. L. Immunol. Today 1988, 9, 18−23. (2) Farcas, G. A.; Zhong, K. J.; Mazzulli, T.; Kain, K. C. J. Clin. Microbiol. 2004, 42, 636−638. (3) Umetani, N.; Kim, J.; Hiramatsu, S.; Reber, H. A.; Hines, O. J.; Bilchik, A. J.; Hoon, D. S. Clin. Chem. 2006, 52, 1062−1069. (4) Trama, J. P.; Adelson, M. E.; Mordechai, E. J. Clin. Virol. 2007, 40, 325−329. (5) Rosi, N. L.; Mirkin, C. A. Chem. Rev. 2005, 105, 1547−1562. (6) Liao, H. W.; Nehl, C. L.; Hafner, J. H. Nanomedicine 2006, 1, 201−208. (7) Jun, Y. W.; Seo, J. W.; Cheon, J. W. Acc. Chem. Res. 2008, 41, 179−189. (8) Ma, H. L.; Wang, P. C.; Qian, F.; Liang, X. J. Acta Biophys. Sin. 2010, 26, 691−701. (9) Liu, T.; Zhao, J.; Zhang, D. M.; Li, G. X. Anal. Chem. 2010, 82, 229−233. (10) Baptista, P.; Pereira, E.; Eaton, P.; Doria, G.; Miranda, A.; Gomes, I.; Quaresma, P.; Franco, R. Anal. Bioanal. Chem. 2008, 391, 943−950. (11) Gaspar, J. F.; Baptista, P. V.; Rueff, J. Curr. Pharmacogenomics 2007, 5, 39−47. (12) Prashant, K. J.; Ivan, H.; Mostafa, A. Nano Today 2007, 2, 18− 29. (13) Butron, A. S.; Mirkin, C. A.; Stoeva, S. I.; Lee, J. S. Nanoscape 2007, 4, 1−9. (14) Elghanian, R.; Storhoff, J. J.; Mucic, R. C.; Letsinger, R. L.; Mirkin, C. A. Science 1997, 277, 1078−1081. (15) Storhoff, J. J.; Lucas, A. D.; Garimella, V.; Bao, Y. P.; Müller, U. R. Nat. Biotechnol. 2004, 22, 883−887. (16) Javier, D. J.; Castellanos, G. A.; Weigum, S. E.; White, A. C. Jr.; Richards, K. R. J. Clin. Microbiol. 2009, 47, 4060−4066. (17) Li, H.; Rothberg, L. J. Proc. Natl. Acad. Sci. U.S.A. 2004, 101, 14036−14039. (18) Sato, K.; Hosokawa, K.; Maeda, M. J. Am. Chem. Soc. 2003, 125, 8102−8103. (19) Sato, K.; Hosokawa, K.; Maeda, M. Nucleic Acids Res. 2005, 33, 1−5.

In this study, we developed a novel strategy for rapid colorimetric detection of specific DNA sequences. Two key elements distinguish this system: ssDNA generation from AsPCR and the final 1 M NaCl in the reaction mixture. Advantages of this approach include (1) no need for PCR product purification, mixing alone is required; (2) denaturation is not required; several minutes of incubation at room temperature achieve the same results as denaturation-annealing in other methods; (3) observation of the color change is possible without visual aids; (4) this method is applicable to other DNA sequence analyses with high specificity and sensitivity; (5) linear amplification of As-PCR minimizes the potential carry-over of PCR amplicons. Our studies may enable the transfer of this approach from basic research into clinical application.

Corresponding Author

*Address: Prof. Xing-Jie Liang, Chinese Academy of Sciences Key Laboratory for Biomedical Effects of Nanomaterials and Nanosafety, National Center for Nanoscience and Technology of China, No. 11, First North Road, Zhongguancun, Beijing. P. R. China. 100190. Phone: 86-10-82545569 (office). Fax: 86-1062656765. E-mail: [email protected]. 1257

dx.doi.org/10.1021/ac201713t | Anal. Chem. 2012, 84, 1253−1258

Analytical Chemistry

Article

(20) Li, H.; Rothberg, L. J. J. Am. Chem. Soc. 2004, 126, 10958− 10961. (21) Cai, M.; Li, F.; Zhang, Y.; Wang, Q. B. Nano Res. 2010, 3, 557− 563. (22) Frens, G. Nat. Phys. Sci. 1973, 241, 20−22. (23) Liu, J. W.; Lu, Y. Nat. Protoc. 2006, 1, 246−252. (24) Hill, H. D.; Mirkin, C. A. Nat. Protoc. 2006, 1, 324−336. (25) Storhoff, J. J.; Elghanian, R.; Mucic, R. C.; Mirkin, C. A.; Letsinger, R. L. J. Am. Chem. Soc. 1998, 120, 1959−1964. (26) Mao, H.; Rosenthal, K. S. Biotechniques 1999, 27, 674−678. (27) Wei, Q.; Liu, S.; Huang, J.; Mao, X.; Chu, X.; Wang, Y.; Qiu, M.; Mao, Y.; Xie, Y.; Li, Y. J. Biochem. Mol. Biol. 2004, 37, 439−444. (28) Poddar, S. K. Mol. Cell. Probes 2000, 14, 25−32. (29) Radnedge, L.; Agron, P. G.; Hill, K. K.; Jackson, P. J.; Ticknor, L. O.; Keim, P.; Andersen, G. L. Appl. Environ. Microbiol. 2003, 69, 2755−2764. (30) Antwerpen, M. H.; Zimmermann, P.; Bewley, K.; Frangoulidis, D.; Meyer, H. Mol. Cell. Probes 2008, 22, 313−315.

1258

dx.doi.org/10.1021/ac201713t | Anal. Chem. 2012, 84, 1253−1258