Graphene-Based Materials Functionalized with Elastin-like

Feb 10, 2014 - Eddie Wang, Malav S. Desai, Kwang Heo, and Seung-Wuk Lee* ... Physical Biosciences Division, Lawrence Berkeley National Laboratory, ...
0 downloads 0 Views 929KB Size
Download PDF
Article pubs.acs.org/Langmuir

Graphene-Based Materials Functionalized with Elastin-like Polypeptides Eddie Wang, Malav S. Desai, Kwang Heo, and Seung-Wuk Lee* Department of Bioengineering, University of California, Berkeley, Berkeley, California 94720, United States Physical Biosciences Division, Lawrence Berkeley National Laboratory, Berkeley, California 94720, United States S Supporting Information *

ABSTRACT: Graphene-based materials commonly require functionalization for biological applications in order to control their physical/colloidal properties and to introduce additional capabilities, such as stimuli-responsiveness and affinity to specific biomolecules. Here, we functionalized CVD-grown graphene and graphene oxide with a genetically engineered elastin-like polypeptide fused to a graphene binding peptide and then showed that the resulting hybrid materials exhibit thermoand photoresponsive behaviors. Furthermore, we demonstrate that our genetic engineering strategy allows for the facile introduction of bioactivity to reduced graphene oxide. The stimuli-responsiveness and genetic tunability of our graphene− protein nanocomposites are attractive for addressing future biomedical applications.

■

as aptamers17 and peptides.8,18 How the GBMs are modified is also likely to play an important role in their biocompatibility.19,20 Our strategy for functionalizing GBMs is to use recombinant protein-based polymers (PBPs). PBPs are built from repeating peptide sequences derived from natural structural proteins such as elastin, resilin, and silk.21 They are attractive because genetic engineering allows for precise control over their primary sequence and for the modular incorporation of functional motifs. As a result, tunable biological and physical properties can be achieved (e.g., self-assembly,22,23 mechanical properties,24 and interactions with target molecules/surfaces25−28). The class of PBP we utilized are known as elastin-like polypeptides (ELPs). ELPs are built from repeats of the pentapeptide Val-Pro-Gly-Val-Gly, a sequence found in mammalian tropoelastin.29 An important feature of ELPs is their inverse temperature transition (ITT): they are soluble in aqueous solutions below a transition temperature, and above it

INTRODUCTION Graphene is a two-dimensional sheet of sp2-hybridized carbons that exhibits valuable mechanical, thermal, electronic, and optical properties.1,2 Because of these properties, graphene and its derivatives are being utilized in diverse fields,1,2 including biomedicine and biotechnology.3 For example, graphene-based materials (GBMs) have been incorporated into drug/gene delivery vehicles,4,5 biosensors,6,7 bioimaging agents,8,9 and biomaterials.10,11 Functionalizing GBMs to control how they interface with their environment is critical for most biorelated applications. For instance, GBMs such as graphene oxide (GO)formed by the oxidation and exfoliation of graphiteand reduced graphene oxide (rGO)formed by the reduction of GO are typically not colloidally stable in aqueous solutions without modification.12,13 Therefore, chemical derivatization14 or functionalization with small molecules15 or polymers4,16 (covalently or noncovalently) is required to introduce ionic and/or steric barriers to aggregation. In addition, unmodified GBMs lack inherent biological functions, making them ill-suited for engaging in specific interactions with biomolecules or cells. This can be addressed by modification with biomolecules, such © 2014 American Chemical Society

Received: November 24, 2013 Revised: February 4, 2014 Published: February 10, 2014 2223

dx.doi.org/10.1021/la404333b | Langmuir 2014, 30, 2223−2229

Langmuir

Article

Figure 1. (a) Schematic of ELPs immobilized on a GBM surface via the graphene binding peptide and the temperature and nIR light-responsive shift in surface hydrophobicity due to the ELPs’ phase transition. (b) Schematic of cell binding promoted by introduction of the RGD motif. product. Graphene films were grown by chemical vapor deposition on nickel-coated silicon as described previously.39 Contact Angle Characterization of ELP−Graphene Binding. Stubs of G-CVD (∼1.5 cm × 1.5 cm) were cleaned by sonication in water and then ethanol and blown dry in a stream of nitrogen. The substrates were then immersed in V50GB or V50 (0.5 mg/mL in H2O) or H2O only for 30 min followed by rinsing with water and drying in a stream of nitrogen. The stubs were then taped to glass slides and placed into a bath of phosphate-buffered saline (PBS). The bath was cycled between 10 and 37 °C. The substrates were held in PBS at the desired temperatures for 10 min prior to contact angle measurements. Air bubbles were released from below the substrate by a syringe pump through a 23-gauge needle and imaged by a digital microscope (Celestron 44302). Contact angles were determined from the images using the DropSnake plugin for ImageJ.40 Three stubs were used for each condition (no ELP, V50, and V50GB), and three measurements were made on each stub at each temperature condition. ELP−GO Binding. Atomic force microscopy (AFM) imaging of GO treated with ELPs, and saturation binding of GO treated with the ELP, V50GB, was performed as previously described for rGO,35 but 4 μg/mL solutions of GO were used for AFM studies and 100 μg/mL solutions were used for binding studies. ELP−GO Solution Characterization. Colloidal stability of GO was measured by adding 25 μL of 4.8 mg/mL V50, 4.8 mg/mL V50GB, or water to 100 μL of 0.2 mg/mL GO on ice. 75 μL of cold NaCl of varying concentrations was then added to adjust the ionic strength to the desired values. The solutions were kept at 4 °C and visibly monitored for signs of aggregation for 1 day. For imaging, the volume of each component was quadrupled. The dispersibility of V50GB-modified GO in dimethyl sulfoxide (DMSO), N,N-dimethylformamide (DMF), and N-methyl-2-pyrrolidone (NMP) was carried out as described for rGO,35 but using a 5:1 ELP-to-GO mass ratio. ELP−GO Stimuli Response. Thermoresponsive aggregation/ dispersion and nIR-light responsiveness of ELP−GO mixtures were tested as described previously.35 Briefly, 0.1 mg/mL GO, 0.6 mg/mL ELP, and 25 mM NaCl solutions were used for testing. For thermoresponsive characterization the solutions were cycled between heating to ∼45 °C then vortexing and cooling on ice then vortexing. To test nIR response, the solutions were placed in 10 mM path length glass cuvettes and irradiated by an 808 nm laser set at a power of 0.4 W (Lazerer Electronics). Cell Spreading Assays Using ELP-Functionalized rGO. Mouse preosteoblastic cells (MC3T3-E1 subclone 4) were obtained from ATCC and cultured in α-MEM supplemented with 10% fetal bovine serum (FBS), penicillin, and streptomycin at 37 °C, 5% CO2, >95% relative humidity. The media was changed every 2 days. Cells were grown in 24-well tissue culture plates for cell adhesion assays. Wells were treated with 500 μL of 0.55 mg/mL poly(diallyldimethylammonium chloride) (100−200 kDa molecular weight, 45 min, room temperature), then 0.5 mg/mL rGO (45 min, room temperature), and then 0.5 mg/mL of ELP (V40GB or RGDV40GB, overnight, 4 °C). The wells were rinsed gently three times with water after each incubation step. The wells were then blocked

they become hydrophobic and aggregate.29 The same transition can be triggered isothermally by engineering ELPs that are responsive to other factors (e.g., ligands30 or pH31). This stimuli-responsiveness as well as their excellent biocompatibility32,33 has spurred the use of ELPs for applications ranging from drug delivery22 to protein purification.34 In previous work, we created an ELP that was able to noncovalently functionalize rGO surfaces.35 To do so, we fused a nine amino acid “graphene-binding” peptide, which was originally identified by phage display against carbon nanotubes,36 to an ELP composed of 50 pentapeptide repeats. Compared to past protein immobilization studies, our strategy requires no covalent modification steps, allows binding to occur through a specific portion of the protein, and requires only a short motif.37 The resulting ELP−rGO composite nanoparticles aggregated in response to heating due to the ITT and also in response to near-infrared (nIR) light due to photothermal heating of rGO.38 Meanwhile, ELP−rGO hydrogels actuated in response to nIR light and temperature. To expand upon these promising results, in this work we investigated the interaction of our ELPs with other GBMs graphene synthesized by chemical vapor deposition (G-CVD) and GOand then characterized their stimuli-responsive properties. We also introduced bioactivity into our GBMbinding ELPs by genetically encoding an integrin-binding peptide motif (Arg-Gly-Asp) (Figure 1).

■

EXPERIMENTAL SECTION

ELP Synthesis and Characterization. The sequences of ELPs used in this study are shown in Table 1. ELP gene construction,

Table 1. ELP Names and Sequences Used in This Study ELP name

N-terminal

backbone

C-terminal

V50 V50GB V40GB RGD-V40GB

MSGVG MSGVG MSGVG MSGRGDSG

(VPGVG)50 (VPGVG)50 (VPGVG)40 (VPGVG)40

VPG VPGHNWYHWWPH VPGHNWYHWWPH VPGHNWYHWWPH

expression, purification, and characterization (mass spectrometry and transition temperature measurements) were performed as previously described.26,35 The forward and reverse oligonucleotides used to introduce the N-terminal RGD sequence were, from 5′ to 3′, CATGAGCGGCCGTGGCGACTCCGGTGTCCTGAGACC and GTGACCAGTGGGTCTCAGGACACCGGAGTCGCCACGGCCGCT, respectively. GBM Synthesis. GO and rGO were synthesized as described previously.35 The change in mass due to reduction of GO to rGO was measured by filtering the reduced solution and weighing the dried 2224

dx.doi.org/10.1021/la404333b | Langmuir 2014, 30, 2223−2229

Langmuir

Article

with 7.5 mg/mL of heat-denatured bovine serum albumin (BSA) fraction V in Dulbecco’s phosphate buffered saline (dPBS) to prevent nonspecific adhesion. Three replicate wells were used for each substrate treatment. When the cells reached ≥95% confluency, they were washed once with PBS. Cells were detached with trypsin (0.05% in 2 mM EDTA, 3 min, 37 °C). Trypsin was neutralized with 4 vol equiv of α-MEM, 10% FBS. The suspension was pelleted at 2000 rpm for 5 min, and the pellet was resuspended in 2 mM EDTA in dPBS. The cells were pelleted again and resuspended in dPBS. The cells were pelleted a third time and resuspended in α-MEM (no FBS) at a density of 1.2 million cells/mL. This suspension was incubated at 37 °C for 30 min. During the 30 min incubation, excess BSA was washed out of the wells of the 24-well plate three times with dPBS. The cells were diluted to 120 000 cells/mL with α-MEM, and 500 μL was seeded into each well. The plate was incubated at 37 °C for 45 min, after which the cells were washed three times with dPBS with calcium and magnesium (Corning cellgro) and fixed with 4% formaldehyde in dPBS for 10 min at room temperature. The cells were washed three times with dPBS, permeabilized with 0.2% Triton X-100 in dPBS, and then washed three more times with dPBS. Fluorescent staining was performed by 30 min incubation at room temperature in a solution containing a 1:320 dilution of 5 mg/mL 4′,6-diamidino-2-phenylindole (DAPI) and a 1:1000 dilution of 8.7 μg/mL fluorescein−phalloidin. The plates were washed three final times with dPBS prior to imaging. We imaged six locations near the center of each well for DAPI and fluorescein signals at 100× magnification. Care was taken such that the images did not overlap with each other. The number of cells per image and cell areas in each image were calculated with CellProfiler.41 The total number of cells in each well (summed from the six images/well) were averaged for comparison of cell adhesion. Because only one of three V40GB-treated wells had attached cells, average cell area was calculated as the total area of cells imaged in all wells divided by the total number of cells.

■

RESULTS AND DISCUSSION Interaction of ELPs with Graphene. The “graphenebinding” (GB) peptide, His-Asn-Trp-Tyr-His-Trp-Trp-Pro-His, is enriched in hydrophobic, aromatic amino acid residues which gives it affinity toward the hydrophobic, conjugated surfaces of carbon nanotubes and rGO sheets. This is similar to binding mediated by small aromatic molecules (e.g., pyrene).42 Therefore, we hypothesized that the GB-peptide would also promote binding to G-CVD. The captive-bubble contact angles of G-CVD samples exposed to an ELP with a GB-peptide (V50-GB) or without a GB-peptide (V50) were 147° and 125°, respectively (Figure 2a). By comparison, the untreated G-CVD contact angle was 103°, meaning both ELPs appeared to bind and increase the hydrophilicity of the G-CVD surface. We cycled the temperature of the bath between 10 and 37 °C to test whether the bound ELPs remained thermoresponsive. The increased hydrophilicity due to V50GB-binding was mostly retained during temperature cycling; the contact angle at 10 °C was 141° after one and two rounds of cycling. The surfaces became more hydrophobic (contact angle decreased) every time the bath was changed to 37 °C (Figure 2a,b), showing that the ELPs were able to undergo their ITT on the surface. Our previous AFM imaging suggested that V50 also had some ability to bind to rGO surfaces.35 However, during cyclic exposure to 37 and 10 °C PBS, the contact angles for V50treated G-CVD returned to those of untreated G-CVD (Figure 2a,b), suggesting that the binding of V50 was nonspecific and weak. These results demonstrate that stable binding of ELPs to G-CVD surfaces can be mediated by the GB-peptide and that the immobilized ELPs maintain their stimuli-responsiveness. Future ELP designs may, therefore, serve as effective coatings

Figure 2. (a), Captive bubble contact angle measurements of untreated G-CVD, V50-treated G-CVD, and V50GB-treated G-CVD surfaces during cycling between 10 and 37 °C. V50GB-treated surfaces become more hydrophobic at 37 °C due to the ITT behavior. The initial increase in hydrophilicity upon V50 treatment is lost after one round of heating and cooling. Error bars represent one standard deviation from the mean. (b) Representative captive bubble images from the last round of temperature cycling. The contour of the V50GB-treated surface at 10 °C is traced onto the other images for comparison.

for sensitive G-CVD sensors by selectively undergoing their conformational transition at the graphene surface in response to their target stimuli. Characterization of ELP-Treated GO. We tested the binding of ELPs with or without the GB-peptide to GO sheets. AFM images of GO immobilized on silicon substrates confirmed that GO sheets had been exfoliated to single- or few-layer sheets (Figure 3a). When treated with V50GB, the height profiles increased by ∼0.8 nm across all of the sheets (Figure 3b). The AFM images and height profiles of GO sheets treated with V50 were indistinguishable from untreated GO, which implies that little or no binding occurred (Figure 3b). We went on to characterize V50GB binding with GO in solution. Excess amounts of V50GB were mixed with GO (8, 9, or 10 to 1 mass ratio); the concentration of V50GB in the unbound fraction was used to determine that GO could bind ∼5 times its mass in V50GB (Supporting Information Figure 1). Previously, we measured that rGO could bind V50GB at a 2225

dx.doi.org/10.1021/la404333b | Langmuir 2014, 30, 2223−2229

Langmuir

Article

Figure 3. (a) AFM images of untreated GO, V50-treated GO, and V50GB-treated GO sheets on silicon substrates. (b) Height traces corresponding to the lines in (a). V50GB-treated GO sheets were ∼0.8 nm higher than untreated or V50-treated GO. (c) Uniform dispersion of GO in H2O at 0.1 mg/mL and in DMSO, DMF, or NMP at 1.0 mg/mL.

6:1 V50GB to GO precursor mass ratio.35 We found that 35% of the initial GO mass is lost during reduction to rGO. Therefore, V50GB binds to rGO at an approximately 9:1 V50GB to rGO mass ratio, 80% more V50GB adsorbed per unit mass than GO. Based on these observations, the GBpeptide appears to mediate binding of ELPs to GO surfaces. Binding via the aromatic-rich peptide is consistent with the ability of GO to adsorb aromatic drug molecules4 and structural studies that show graphene-like domains persisting even after graphite is oxidized during GO synthesis.43 We investigated the colloidal stability of ELP-treated GO. All GO solutions (0.1 mg/mL) held at 4 °C were stable in the absence of NaCl (Supporting Information Figure 2a). However, in 50 mM NaCl solutions, both untreated GO and V50-treated GO visibly began aggregating and sedimenting (Supporting Information Figure 2b). In contrast, V50GBtreated GO solutions did not aggregate until the NaCl concentration exceeded 1 M (Supporting Information Figure 2c). This suggests that the bound V50GB chains provide good steric protection against GO aggregation, which is important for stability in biologically relevant solutions. We also found that dried V50GB−GO hybrid particles could be redispersed in good organic solvents for ELPs (i.e., DMSO, DMF, and NMP), which are poor solvents for unmodified GO (Figure 3c).44 Dispersion in organic solvents is often important for the preparation of composites that cannot be fabricated in water.35,45

Stimuli-Responsiveness of ELP-Treated GO. We investigated the effect of temperature on aqueous solutions of ELPtreated GO. Heating then vortexing of V50-treated GO solutions caused the solution to become visibly cloudy, indicating transition of the protein. However, the GO itself did not aggregate (Figure 4a). In contrast, heating and then vortexing of V50GB-treated GO solutions caused rapid aggregation of both the ELP and the GO as indicated by the clearing of the solution (Figure 4b). This behavior is qualitatively similar to the aggregation of GO particles that have been conjugated to chemically synthesized, thermoresponsive polymers.46 We also tested the effect of nIR light exposure on solutions of V50GB-treated GO. GO generates heat when it absorbs nIR light, but with lower efficiency than rGO.38 Regardless, when we exposed V50GB-rGO solutions, aggregation occurred at the site of exposure and above it due to convection (Figure 4c). Therefore, photothermal heating of GO was sufficient to induce the ELP’s transition. Remotely triggerable nanomaterial systems such as ours are attractive for noninvasive imaging and delivery.38 Especially, targetable aggregation can improve nanoparticle retention and cellular uptake for theranostic applications.47 Cellular Bioactivity of ELP-Treated GO. We introduced the integrin binding peptide motif, Arg-Gly-Asp (RGD), to the N-terminus of a graphene binding ELP. The resulting ELP, RGD-V40GB, and a control ELP without RGD motif, V40GB (Table 1), were tested for their ability to promote murine 2226

dx.doi.org/10.1021/la404333b | Langmuir 2014, 30, 2223−2229

Langmuir

Article

Figure 5. Fluorescent images of cells remaining on RGD-V40GBtreated rGO (a) and V40GB-treated rGO (b). Actin filaments (green) and nuclei (blue) are labeled. (c) Average cell number and area of cells on RGD-V40GB and V40GB-treated rGO. We washed away nonadhered cells 45 min after seeding on the ELP-treated surfaces, and the remaining cells were fixed and stained immediately afterward.

Figure 4. (a) Images of V50-treated GO solutions before and after the ITT. The solution becomes cloudy, but no GO aggregation is observed. (b) Image of dramatic, but reversible, aggregation of V50GB-treated GO after the ITT. (c) Sequential images over the course of 4 min showing the nIR-induced aggregation of V50GBtreated GO. The arrow indicates the position of the nIR beam.

■

CONCLUSIONS We showed that a recombinant ELP fused to a short graphenebinding peptide, which was previously shown to bind to rGO, can also be used to stably and noncovalently bind to the surfaces of both G-CVD and GO. The thermoresponsiveness of the bound ELPs are maintained and can be used to dynamically modulate the hydrophobicity of the G-CVD surface and the aggregation state of GO dispersions. Aggregation could also be remotely induced with nIR light by coupling the ELP’s thermoresponse to the photothermal heating ability of GO sheets. In addition, the ELP coating on GO nanosheets prevented aggregation at high ionic strength and allowed for dispersion in certain organic solvents. Finally, to demonstrate the utility of using genetically encoded polymers, we fused an RGD peptide motif to a GBM-binding ELP and showed that it greatly increased cell binding and spreading on rGO surfaces. As a whole, this study begins to establish that PBPs are versatile materials for interfacing GBMs with biological systems. We envision that our stimuli-responsive graphene-protein nanocomposite materials will be useful for various biomedical applications including drug delivery vehicles, biosensors, bioimaging, and regenerative biomaterials in the future.

preosteoblast cell attachment and spreading on rGO modified surfaces in serum-free media (characterization of ELPs in Supporting Information Figures 3 and 4). Cell attachment was greatly improved by the presence of the RGD motif; almost no cells attached in the control V40GB wells (Figure 5). The average area of the few cells attached on V40GB-treated surfaces was significantly smaller than that of RGD-V40GBtreated surfaces. Despite these results, we would not describe the V40GB treatment as cell-repellant because adhered cells were found if they were allowed to settle for longer times. Therefore, we conclude that the addition of the RGD motif increases the rate of cell adhesion and spreading. These results show that our designed ELP acts as an effective bifunctional linker between rGO and cells. This strategy can be used in lieu of or in conjunction with chemical conjugation of peptides to polymers38 or chemical synthesis of bifunctional peptides.48 In future designs, modular addition to or replacement of the RGD group with other functional peptides can be carried out by further genetic engineering to control the interactions of GBMs with cells, molecules, or surfaces. Such control is critical for targeted theranostics,4 sensing,48 and materials synthesis.49 For example, we believe that a potential application of cell-binding ELP−GO materials will be to target tumors. After initial binding to tumor sites, subsequent photothermal heating of the GO to induce the ELP’s phase transition would promote the capture of additional circulating ELP-bound GO or ELPtherapeutic conjugates. This could increase local heating efficiency or locally concentrate drugs to cause tumor cell death.

■

ASSOCIATED CONTENT

S Supporting Information *

V50GB-GO binding analysis, V50GB-GO colloidal stability images, and V40GB and RGD-V40GB mass and transition temperature measurements; video of nIR-induced V50GB-GO aggregation. This material is available free of charge via the Internet at http://pubs.acs.org.

■

AUTHOR INFORMATION

Corresponding Author

*E-mail [email protected]; Ph +1 510-486-4628 (S.-W.L.). 2227

dx.doi.org/10.1021/la404333b | Langmuir 2014, 30, 2223−2229

Langmuir

Article

Notes

(15) Xu, Y.; Bai, H.; Lu, G.; Li, C.; Shi, G. Flexible Graphene Films via the Filtration of Water-Soluble Noncovalent Functionalized Graphene Sheets. J. Am. Chem. Soc. 2008, 130, 5856. (16) Laaksonen, P.; Kainlauri, M.; Laaksonen, T.; Shchepetov, A.; Jiang, H.; Ahopelto, J.; Linder, M. B. Interfacial Engineering by Proteins: Exfoliation and Functionalization of Graphene by Hydrophobins. Angew. Chem., Int. Ed. 2010, 49, 4946−4949. (17) Wang, Y.; Li, Z.; Hu, D.; Lin, C.-T.; Li, J.; Lin, Y. Aptamer/ Graphene Oxide Nanocomplex for in Situ Molecular Probing in Living Cells. J. Am. Chem. Soc. 2010, 132, 9274−9276. (18) Wang, Z.; Huang, P.; Bhirde, A.; Jin, A.; Ma, Y.; Niu, G.; Neamati, N.; Chen, X. A Nanoscale Graphene Oxide-Peptide Biosensor for Real-Time Specific Biomarker Detection on the Cell Surface. Chem. Commun. 2012, 48, 9768−9770. (19) Hu, W.; Peng, C.; Lv, M.; Li, X.; Zhang, Y.; Chen, N.; Fan, C.; Huang, Q. Protein Corona-Mediated Mitigation of Cytotoxicity of Graphene Oxide. ACS Nano 2011, 5, 3693−3700. (20) Mao, H. Y.; Chen, W.; Laurent, S.; Thirifays, C.; Burtea, C.; Rezaee, F.; Mahmoudi, M. Hard Corona Composition and Cellular Toxicities of the Graphene Sheets. Colloids Surf., B 2013, 109, 212− 218. (21) DiMarco, R. L.; Heilshorn, S. C. Multifunctional Materials through Modular Protein Engineering. Adv. Mater. 2012, 24, 3923− 3940. (22) MacKay, A. J.; Chen, M.; McDaniel, J. R.; Liu, W.; Simnick, A. J.; Chilkoti, A. Self-Assembling Chimeric Polypeptide-Doxorubicin Conjugate Nanoparticles That Abolish Tumours after a Single Injection. Nat. Mater. 2009, 8, 993−999. (23) Yu, S. M.; Conticello, V. P.; Zhang, G.; Kayser, C.; Fournier, M. J.; Mason, T. L.; Tirrell, D. A. Smectic Ordering in Solutions and Films of a Rod-like Polymer Owing to Monodispersity of Chain Length. Nature 1997, 389, 167−170. (24) Trabbic-Carlson, K.; Setton, L. A.; Chilkoti, A. Swelling and Mechanical Behaviors of Chemically Cross-Linked Hydrogels of Elastin-like Polypeptides. Biomacromolecules 2003, 4, 572−580. (25) Currie, H. A.; Deschaume, O.; Naik, R. R.; Perry, C. C.; Kaplan, D. L. Genetically Engineered Chimeric Silk−Silver Binding Proteins. Adv. Funct. Mater. 2011, 21, 2889−2895. (26) Wang, E.; Lee, S.-H.; Lee, S.-W. Elastin-Like Polypeptide Based Hydroxyapatite Bionanocomposites. Biomacromolecules 2011, 12, 672−680. (27) Girotti, A.; Reguera, J.; Rodríguez-Cabello, J.; Arias, F.; Alonso, M.; Testera, A. Design and Bioproduction of a Recombinant Multi(bio)functional Elastin-like Protein Polymer Containing Cell Adhesion Sequences for Tissue Engineering Purposes. J. Mater. Sci.: Mater. Med. 2004, 15, 479−484. (28) Charati, M. B.; Ifkovits, J. L.; Burdick, J. A.; Linhardt, J. G.; Kiick, K. L. Hydrophilic Elastomeric Biomaterials Based on Resilin-like Polypeptides. Soft Matter 2009, 5, 3412−3416. (29) Urry, D. W. Physical Chemistry of Biological Free Energy Transduction As Demonstrated by Elastic Protein-Based Polymers. J. Phys. Chem. B 1997, 101, 11007−11028. (30) Kim, B.; Chilkoti, A. Allosteric Actuation of Inverse Phase Transition of a Stimulus-Responsive Fusion Polypeptide by Ligand Binding. J. Am. Chem. Soc. 2008, 130, 17867−17873. (31) Mackay, J. A.; Callahan, D. J.; Fitzgerald, K. N.; Chilkoti, A. Quantitative Model of the Phase Behavior of Recombinant pHResponsive Elastin-Like Polypeptides. Biomacromolecules 2010, 11, 2873−2879. (32) Urry, D. W.; Parker, T. M.; Reid, M. C.; Gowda, D. C. Biocompatibility of the Bioelastic Materials, Poly(GVGVP) and Its gamma-Irradiation Cross-Linked Matrix: Summary of Generic Biological Test Results. J. Bioact. Compat. Polym. 1991, 6, 263−282. (33) Sallach, R. E.; Cui, W. X.; Balderrama, F.; Martinez, A. W.; Wen, J.; Haller, C. A.; Taylor, J. V.; Wright, E. R.; Long, R. C.; Chaikof, E. L. Long-Term Biostability of Self-Assembling Protein Polymers in the Absence of Covalent Crosslinking. Biomaterials 2010, 31, 779−791.

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS This work was supported by the National Science Foundation Center of Integrated Nanomechanical Systems (EEC-0832819) and a NIH ARRA supplement to an NIDCR R21 Grant (DE 018360-02). The authors thank Dr. Jin-Woo Oh and Dong Shin Choi for helping with laser setup and video capture.

■

ABBREVIATIONS GBM, graphene-based materials; GO, graphene oxide; rGO, reduced graphene oxide; PBP, protein-based polymer; ELP, elastin-like polypeptide; ITT, inverse temperature transition; GCVD, graphene synthesized by chemical vapor deposition; AFM, atomic force microscopy; DMSO, dimethyl sulfoxide (DMSO); DMF, N,N-dimethylformamide; NMP, N-methyl-2pyrrolidone; FBS, fetal bovine serum; PBS, phosphate buffered saline; BSA, bovine serum albumin; DAPI, 4′,6-diamidino-2phenylindole; RGD, arginine-glycine-aspartate.

■

REFERENCES

(1) Zhu, Y. W.; Murali, S.; Cai, W. W.; Li, X. S.; Suk, J. W.; Potts, J. R.; Ruoff, R. S. Graphene and Graphene Oxide: Synthesis, Properties, and Applications. Adv. Mater. 2010, 22, 3906−3924. (2) Novoselov, K. S.; Fal’ko, V. I.; Colombo, L.; Gellert, P. R.; Schwab, M. G.; Kim, K. A Roadmap for Graphene. Nature 2012, 490, 192−200. (3) Feng, L. Y.; Wu, L.; Qu, X. G. New Horizons for Diagnostics and Therapeutic Applications of Graphene and Graphene Oxide. Adv. Mater. 2013, 25, 168−186. (4) Liu, Z.; Robinson, J. T.; Sun, X. M.; Dai, H. J. PEGylated Nanographene Oxide for Delivery of Water-Insoluble Cancer Drugs. J. Am. Chem. Soc. 2008, 130, 10876−+. (5) Feng, L. Z.; Zhang, S. A.; Liu, Z. A. Graphene Based Gene Transfection. Nanoscale 2011, 3, 1252−1257. (6) Huang, Y. X.; Dong, X. C.; Shi, Y. M.; Li, C. M.; Li, L. J.; Chen, P. Nanoelectronic Biosensors Based on CVD Grown Graphene. Nanoscale 2010, 2, 1485−1488. (7) Lu, C.-H.; Yang, H.-H.; Zhu, C.-L.; Chen, X.; Chen, G.-N. A Graphene Platform for Sensing Biomolecules. Angew. Chem., Int. Ed. 2009, 48, 4785−4787. (8) Wang, H. B.; Zhang, Q.; Chu, X.; Chen, T. T.; Ge, J.; Yu, R. Q. Graphene Oxide-Peptide Conjugate as an Intracellular Protease Sensor for Caspase-3 Activation Imaging in Live Cells. Angew. Chem., Int. Ed. 2011, 50, 7065−7069. (9) Sun, X.; Liu, Z.; Welsher, K.; Robinson, J. T.; Goodwin, A.; Zaric, S.; Dai, H. Nano-Graphene Oxide for Cellular Imaging and Drug Delivery. Nano Res. 2008, 1, 203−212. (10) Hou, C. Y.; Duan, Y. R.; Zhang, Q. H.; Wang, H. Z.; Li, Y. G. Bio-applicable and Electroactive near-Infrared Laser-Triggered SelfHealing Hydrogels Based on Graphene Networks. J. Mater. Chem. 2012, 22, 14991−14996. (11) Park, S.; Mohanty, N.; Suk, J. W.; Nagaraja, A.; An, J.; Piner, R. D.; Cai, W.; Dreyer, D. R.; Berry, V.; Ruoff, R. S. Biocompatible, Robust Free-Standing Paper Composed of a TWEEN/Graphene Composite. Adv. Mater. 2010, 22, 1736−+. (12) Li, D.; Muller, M. B.; Gilje, S.; Kaner, R. B.; Wallace, G. G. Processable Aqueous Dispersions of Graphene Nanosheets. Nat. Nanotechnol. 2008, 3, 101−105. (13) Chowdhury, I.; Duch, M. C.; Mansukhani, N. D.; Hersam, M. C.; Bouchard, D. Colloidal Properties and Stability of Graphene Oxide Nanomaterials in the Aquatic Environment. Environ. Sci. Technol. 2013, 47, 6288−6296. (14) Si, Y.; Samulski, E. T. Synthesis of Water Soluble Graphene. Nano Lett. 2008, 8, 1679−1682. 2228

dx.doi.org/10.1021/la404333b | Langmuir 2014, 30, 2223−2229

Langmuir

Article

(34) Meyer, D. E.; Chilkoti, A. Purification of Recombinant Proteins by Fusion with Thermally-Responsive Polypeptides. Nat. Biotechnol. 1999, 17, 1112−1115. (35) Wang, E.; Desai, M. S.; Lee, S. W. Light-Controlled GrapheneElastin Composite Hydrogel Actuators. Nano Lett. 2013, 13, 2826− 2830. (36) Wang, S.; Humphreys, E. S.; Chung, S.-Y.; Delduco, D. F.; Lustig, S. R.; Wang, H.; Parker, K. N.; Rizzo, N. W.; Subramoney, S.; Chiang, Y.-M.; Jagota, A. Peptides with Selective Affinity for Carbon Nanotubes. Nat. Mater. 2003, 2, 196−200. (37) Zhang, Y.; Wu, C.; Guo, S.; Zhang, J. Interactions of Graphene and Graphene Oxide with Proteins and Peptides. Nanotechnol. Rev. 2013, 2, 27−45. (38) Robinson, J. T.; Tabakman, S. M.; Liang, Y.; Wang, H.; Casalongue, H. S.; Vinh, D.; Dai, H. Ultrasmall Reduced Graphene Oxide with High Near-Infrared Absorbance for Photothermal Therapy. J. Am. Chem. Soc. 2011, 133, 6825−6831. (39) Muhammad, A.; Kwang, H.; Byung Yang, L.; Joohyung, L.; David, H. S.; Sunae, S.; Jikang, J.; Seunghun, H. Metallic Nanowire− Graphene Hybrid Nanostructures for Highly Flexible Field Emission Devices. Nanotechnology 2011, 22, 355709. (40) Stalder, A. F.; Kulik, G.; Sage, D.; Barbieri, L.; Hoffmann, P. A Snake-Based Approach to Accurate Determination of Both Contact Points and Contact Angles. Colloids Surf., A 2006, 286, 92−103. (41) Carpenter, A. E.; Jones, T. R.; Lamprecht, M. R.; Clarke, C.; Kang, I. H.; Friman, O.; Guertin, D. A.; Chang, J. H.; Lindquist, R. A.; Moffat, J.; Golland, P.; Sabatini, D. M. CellProfiler: Image Analysis Software for Identifying and Quantifying Cell Phenotypes. Genome Biol. 2006, 7, R100. (42) Liu, J.; Yang, W.; Tao, L.; Li, D.; Boyer, C.; Davis, T. P. Thermosensitive Graphene Nanocomposites Formed Using PyreneTerminal Polymers Made by RAFT Polymerization. J. Polym. Sci., Part A: Polym. Chem. 2010, 48, 425−433. (43) Zhang, Q.; Zheng, H.; Geng, Z.; Jiang, S.; Ge, J.; Fan, K.; Duan, S.; Chen, Y.; Wang, X.; Luo, Y. The Realistic Domain Structure of AsSynthesized Graphene Oxide from Ultrafast Spectroscopy. J. Am. Chem. Soc. 2013, 135, 12468−12474. (44) Park, S.; An, J.; Jung, I.; Piner, R. D.; An, S. J.; Li, X.; Velamakanni, A.; Ruoff, R. S. Colloidal Suspensions of Highly Reduced Graphene Oxide in a Wide Variety of Organic Solvents. Nano Lett. 2009, 9, 1593−1597. (45) Eda, G.; Chhowalla, M. Graphene-Based Composite Thin Films for Electronics. Nano Lett. 2009, 9, 814−818. (46) Deng, Y.; Zhang, J. Z.; Li, Y.; Hu, J.; Yang, D.; Huang, X. Thermoresponsive Graphene Oxide-PNIPAM Nanocomposites with Controllable Grafting Polymer Chains via Moderate in Situ SET− LRP. J. Polym. Sci., Part A: Polym. Chem. 2012, 50, 4451−4458. (47) Liu, X.; Chen, Y.; Li, H.; Huang, N.; Jin, Q.; Ren, K.; Ji, J. Enhanced Retention and Cellular Uptake of Nanoparticles in Tumors by Controlling Their Aggregation Behavior. ACS Nano 2013, 7, 6244− 6257. (48) Cui, Y.; Kim, S. N.; Jones, S. E.; Wissler, L. L.; Naik, R. R.; McAlpine, M. C. Chemical Functionalization of Graphene Enabled by Phage Displayed Peptides. Nano Lett. 2010, 10, 4559−4565. (49) Laaksonen, P.; Walther, A.; Malho, J.-M.; Kainlauri, M.; Ikkala, O.; Linder, M. B. Genetic Engineering of Biomimetic Nanocomposites: Diblock Proteins, Graphene, and Nanofibrillated Cellulose. Angew. Chem., Int. Ed. 2011, 50, 8688−8691.

2229

dx.doi.org/10.1021/la404333b | Langmuir 2014, 30, 2223−2229