Graphene-Based Steganographically Aptasensing System for

Subscriber access provided by University of Massachusetts Amherst Libraries

Biological and Medical Applications of Materials and Interfaces

Graphene-Based Steganographicly Aptasensing System for Information Computing, Encryption and Hiding, Fluorescent Sensing and In Vivo Imaging of Fish Pathogens Qiu Yan Zhu, Fu Rui Zhang, Yan Du, Xin Xing Zhang, Jiao Yang Lu, Qing Feng Yao, Wei Tao Huang, Xue Zhi Ding, and Li Qiu Xia ACS Appl. Mater. Interfaces, Just Accepted Manuscript • DOI: 10.1021/acsami.8b22592 • Publication Date (Web): 07 Feb 2019 Downloaded from http://pubs.acs.org on February 7, 2019

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 37 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Applied Materials & Interfaces

Graphene-Based Steganographicly Aptasensing System for Information Computing, Encryption and Hiding, Fluorescent Sensing and In Vivo Imaging of Fish Pathogens Qiu Yan Zhu#, Fu Rui Zhang#, Yan Du, Xin Xing Zhang, Jiao Yang Lu, Qing Feng Yao, Wei Tao Huang*, Xue Zhi Ding, and Li Qiu Xia State Key Laboratory of Developmental Biology of Freshwater Fish, Hunan Provincial Key Laboratory of Microbial Molecular Biology, College of Life Science, Hunan Normal University, Changsha 410081, P. R. China *Corresponding author: E-mail: [email protected]. Fax: (+86)731-8887-2905; Tel: (+86)731-8887-2905

Keywords: aptasensing, DNA aptamer, encryption, fish pathogens, graphene oxide, in vivo imaging, information hiding, steganography

1 ACS Paragon Plus Environment

ACS Applied Materials & Interfaces 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 37

Abstract Inspired by information processing and communication of life based on complex molecular interactions, some artificial (bio)chemical systems have been developed for applications in molecular information processing or chemo/biosensing and imaging. However, little attention has been paid to simultaneously and comprehensively utilize the information computing, encoding and molecular recognition capabilities of molecular-level systems (such as DNA-based systems) for multifunctional applications. Herein, a graphene-based steganographicly aptasensing system was constructed for multifunctional application, which relies on specific molecular recognition and information encoding abilities of DNA aptamers (Aeromonas hydrophila and Edwardsiella tarda-binding aptamers as models) and the selective adsorption and fluorescence quenching capacities of graphene oxide (GO). Although graphene-DNA systems have been widely used in biosensors and diagnostics, our proposed graphenebased aptasensing system can not only be utilized for fluorescent sensing and in vivo imaging of fish pathogens (Aeromonas hydrophila and Edwardsiella tarda), but can also function as a molecular-level logic computing system where the combination of matters (specific molecules or materials) as inputs produces the resulting product (matter level) or fluorescence (energy level) changes as two outputs. More importantly and interestingly, our graphene-based steganographicly aptasensing system can also be served as a generally doubly cryptographic and steganographic system for sending different secret messages by using pathogen-binding DNA aptamers as information carriers, GO as a cover, a pair of keys: target pathogen as a public key, the encryption key used to encode or decode a message in DNA as a private key. Our study not only provides a novel nano-biosensing assay for rapid and effective sensing and in vivo imaging fish pathogens, but also demonstrates a prototype of (bio)molecular steganography as an important and interesting extension direction of molecular information technology, which is helpful in probably promoting the development of multifunctional molecular-level devices or machines. 2 ACS Paragon Plus Environment

Page 3 of 37 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


1. Introduction The power and mystery of life lies in its sophisticated information processing and communication functions generated by highly complex biochemical reaction networks based on molecular recognition and interaction.1 Inspired by life systems and information science, the molecular interactions of some (bio)chemical systems (DNA2-3 or enzymes4 or organic molecules-based5 systems) have been abstracted into (bio)molecular computing,5-7 to develop complex Boolean logic circuits,5-6, systems,9-10 fuzzy logic systems,11-12 reversible logic gates10,

13

8

sequential logic

for application in multiplexed

chemo/biosensing,14 intelligent molecular searching,11 and drug targeted delivery.15-16 Ongoing efforts have been directed toward solving the problems of cascading molecular logic systems,17 designing a new information processing paradigm (like DNA-based neural networks18), and expanding alternative directions (such as information encoding, cell behavior regulation,19 and so on). Information storage and security, which are vital to information age, are also the important and interesting extension direction of molecular information technology.20 Security inks is a successful chemistry-related example for practical application in data protection and anti-counterfeiting.21 Recently, some molecular-level systems (including organic molecules,22-24 polymers,25 and biomolecules26) were designed to encode, protect, encrypt, and conceal information27 for information storage,25,

28-29

communication and safety (including early molecular keypad locks,30-31 complex multi-factor authentication, cryptography, and steganography).24, 27, 32-35 The diversity of the molecular platforms and the analytical techniques give a potential opportunity to develop several layers of security, including preventing access (password protection), information encrypting (cryptography), and hiding 3 ACS Paragon Plus Environment


Page 4 of 37

(steganography),27 by using the unique structure (such as DNA or polymer sequences)25-26 or the inherent chemical identity (absorption or fluorescence spectra)24,

32

of (bio)molecules. Especially, the unique

information storage and processing abilities of DNA is not only crucial to life systems, but also signposts a potential new direction for new generation man-made information and control technologies, such as DNA biocomputer18 and DNA machines.36 Moreover, due to its self-assembly and molecular recognition capabilities,37 DNA have been also widely used in combination with various nanomaterials38 and different analytical methods to develop a number of chem/biosensing tools39 for detection of bacteria,40 cancer cells,41 biomolecules, 38, 42-44 and metal ions.45 While unremitting efforts have been devoted to designing DNA-based systems to achieve limited function application (like only application in logic computation and analytical detection, 7, 16 or only in information encryption and hiding34-35), little attention has been paid to simultaneously and comprehensively utilize the information computing, encoding and molecular recognition capabilities of molecular-level systems (such as DNA-based systems) for multifunctional applications. Herein, we construct a graphene-based steganographicly aptasensing system for multifunctional application, which relies on specific molecular recognition and information encoding26, 28, 34 abilities of DNA aptamers (Aeromonas hydrophila and Edwardsiella tarda-binding aptamers as models) and the selective adsorption and fluorescence quenching capacity of graphene oxide (GO)11-12. Due to its large plane and quenching ability, GO can absorb and steganographicly “hide” the FAM-labeled aptamer and its fluorescence; Only when the target pathogen is present, aptamer concealed in GO can appear and restore its fluorescence. By using matter, energy and information exchange and change, the system can 4 ACS Paragon Plus Environment

Page 5 of 37 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


not only be used for fluorescent sensing and in vivo imaging of fish pathogens (Aeromonas hydrophila, A. hydrophila and Edwardsiella tarda, E. tarda), but can also function as a molecular-level logic computing system where the combination of matters (specific molecules or materials) as inputs produces the resulting product (matter level) or fluorescence (energy level) changes as two outputs. More interestingly, our graphene-based steganographicly aptasensing system also can be served as a generally doubly cryptographic and steganographic system via a non-digital channel for sending different secret messages by using pathogen-binding DNA aptamers as information carriers, GO as a cover, a pair of keys: target pathogen as a public key, the encryption key used to encode or decode a message in DNA as a private key. Our steganography system has the advantages of simple operation, high security, universality, and easy expansion, because numerous molecular recognitions and interactions can be utilized to construct versatile molecular cipher devices that can convert distinct molecular patterns into unique information and encryption keys. Our study not only provides a novel nano-biosensing assay for rapid and effective sensing and in vivo imaging fish pathogens, but also demonstrates a prototype of (bio)molecular steganography as a new possible dimension of alternative information storage and communication security, which is helpful in probably promoting the development of multifunctional molecular-level devices or machines.

3. Results and discussions 3.1 Construction of graphene-based steganographicly aptasensing system and its application in logic computing. 5 ACS Paragon Plus Environment


Page 6 of 37

Firstly, we utilized the selective adsorption and fluorescence quenching capacity of GO and specific molecular recognition ability of aptamer to construct a graphene-based steganographicly aptasensing system in which matter, energy and information can interact and exchange (Scheme 1A). Two FAMlabeled aptamers were used as models, in which Apt1 can specifically recognize A. hydrophila and Apt2 can specifically recognize E. tarda (Scheme 1Aa, their sequences in Table 1, see fluorescence binding assays and fluorescence anisotropy assays for the interaction between aptamers and pathogens, Figures S1 and S2). The selected aptamers self-assembled with GO, resulting in steganographicly hiding of aptamers with the fluorescence quenching (Scheme 1Ab, turnoff, Scheme 1B,C, black → red curves, Figures S3A and S4A in SI), because of the adsorption of aptamers on GO and the effective FRET between fluorescent FAM and GO.11-12 Upon addition of pathogens (A. hydrophila or E. tarda), the aptamers (Apt1 or Apt2) which were originally adsorbed on GO surface specifically recognize the corresponding pathogens, released from the GO surface, resulting in revealing of aptamers with the fluorescence recovery (Scheme 1Ac, turnon, Scheme 1B,C, red → blue curves). When the optimized concentration for GO was 0.02 mg/mL (aptamers were 200 nM), the fluorescence quenching ratio reached 85.37% for Apt1 (Figure S3B in SI) and 87.15% for Apt2 (Figure S4B in SI), and the fluorescence changes of the aptamer–GO complexes to pathogens reached maximal values (Figures S3E and S4E in SI).


Page 7 of 37 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Scheme 1. (A) Schematic illustration of a graphene-based steganographicly aptasensing system in which matter, energy and information can interact and exchange. a, Apt1 or Apt2 and their corresponding pathogens as models; b, self-assembly of Apt1 or Apt2 and GO (Apt1−GO and Apt2−GO as two examples); c, aptamers release from the GO surface specifically triggered by their corresponding pathogens. Matter, energy, and information are represented respectively as dotted circle (or box), sphere, binary number 0/1. From the perspective of information, “1” and “0” indicate respectively presence and absence of matter or high and low energy. For example, Apt1 and Apt2 are represented as “11” where the first bit “1” indicate the presence of matter, the second bit “1” indicate the high energy (fluorescence). (B and C) The fluorescence emission spectra of two FAM-labeled aptamer models (B for Apt1 and C for Apt2) in different conditions: aptamer alone (200 nM, black curve), aptamerGO complexes (200 nM: 7 ACS Paragon Plus Environment


Page 8 of 37

0.02 mg/mL, red curve), aptamerGO and pathogen mixtures (blue curve). A. hydrophila, 2.5105 CFU/mL; E. tarda, 2.5104 CFU/mL. Buffer: 50 mM TrisHCl, 100 mM NaCl, 5 mM KCl, 1 mM MgCl2, pH 7.4.

Logic gates are fundamental building units of modern digital integrated circuits which receive one or more binary inputs and produce outputs. The aforementioned processes in Scheme 1A show matters (GO, aptamers, and the corresponding pathogens), energy (fluorescence) and information can interact and exchange. From the perspective of information processing, the graphene-based steganographicly aptasensing system can be considered as a molecular-level information processing system where the combination of matters (specific molecules or materials) as inputs produces the resulting product (matter level) or fluorescence (energy level) changes as two outputs.11-12 Our system can implement simple logic gates (such as ‘AND’ and ‘NOT’, Figure 1A,B) and more complex combinatorial functions which contains the functionalities of all three fundamental logic gates (‘AND’, ‘OR’ and ‘NOT’, Figure 1C). For an AND gate, the output occurrence requires the simultaneous presence of all the inputs. The output of a NOT gate happens as long as the input does not. The output to an OR gate results from the presence of at least one of the inputs. Matter (M) can be abstracted as inputs and outputs which has two states, such as presence (logical 1) or absence (logical 0) of matter level. Self-assembly of GO and aptamer (Apt1 or Apt2) forms AND-gate aptamerGO complexes which functions as AND matter gate (Figure 1A red gate symbol, that is, aptamer AND GO). By combining the two inputs GO and aptamer in accordance with the 8 ACS Paragon Plus Environment

Page 9 of 37 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


truth tables, the matter output was 1 only if in the simultaneous presence of GO and aptamer (Figure 1A). Pathogens (A. hydrophila = A.h and E. tarda = E.t) and the aptamerGO complexes through exchanged AND matter gate interacted and exchanged aptamer to produce two outputsGO and aptamerpathogens (Figure 1B red gate symbol). Thus, the whole aptasensing system can function as a matter logic circuit (GO AND aptamer AND pathogens) (Figure 1C red gate symbol). Moreover, the fluorescence change in the different combinations of these aforementioned molecular events can also be abstracted as logical outputs for energy level, which are defined respectively when fluorescence (F)  22/50 (a.u.) for logical 1 and < 22/50 (a.u.) for logical 0 (note that the F threshold values of Apt1 and Apt2-based systems are 22 and 50, respectively). Self-assembly of GO and aptamer (Apt1 or Apt2) functions as N-IMPLY fluorescence gate (Figure 1A black gate symbol, that is, aptamer ANDNOT GO fluorescence gate). By combining the two inputs GO and aptamer in accordance with the truth tables, the fluorescence output was 1 exclusively in the presence of aptamer and not GO (Figure 1A). Similarly, by combining the two inputs aptamerGO complexes and pathogens (A. hydrophila = A.h and E. tarda = E.t) in accordance with the truth table, only if in the simultaneous presence of aptamerGO complexes and pathogens, the substrate aptamerGO complexes gave the fluorescence signal (logical 1), corresponding to fluorescence AND gate functions (Figure 1B black gate symbol). By considering matter, energy and information exchange and change of the whole aforementioned processes in Scheme 1A, the whole aptasensing system can function as a more complex fluorescent logic circuit (aptamer ANDNOT GO) OR (aptamer AND pathogens) (Figure 1C black gate symbol and right radar chart).



Page 10 of 37

Figure 1. Molecular logic computing application of the graphene-based steganographicly aptasensing system in which the combination of matters (GO, aptamers, and the corresponding pathogens) as inputs produces the resulting product (matter level) or fluorescence (energy level) changes as two outputs. (A) Symbols and the truth tables of (aptamer AND GO) matter gate and N-IMPLY (aptamer ANDNOT GO) 10 ACS Paragon Plus Environment

Page 11 of 37 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


fluorescence gate. (B) Symbols and the truth tables of (aptamerGO AND pathogens) exchanged matter gate and (aptamerGO AND pathogens) fluorescence gate. (C) Symbols (left) and processing performance (right radar chart) of combinatorial matter and fluorescence logic circuits with three matter inputs and two outputs matter and fluorescence. Matter (M) and its energy (fluorescence, F) can be abstracted as two bits which has two states, such as presence (logical 1) or absence (logical 0) for matter level, F  22/50 (logical 1) or < 22/50 (logical 0) for energy level (note that the F threshold values of Apt1 and Apt2-based systems are 22 and 50, respectively). Bright green columns/points for Apt1-based system and bright orange columns/points for Apt2-based system represent fluorescence output 1. While dark green columns/points for Apt1-based system and dark orange columns/points for Apt2-based system represent fluorescence output 0. GO, 0.02 mg/mL; aptamer, 200 nM; A. hydrophila, 2.5105 CFU/mL; E. tarda, 2.5104 CFU/mL; Buffer: 50 mM TrisHCl, 100 mM NaCl, 5 mM KCl, 1 mM MgCl2, pH 7.4.

3.2 Characterization of graphene-based steganographicly aptasensing system. AFM, UVvis spectrometer, ζ-potential, and dynamic light scattering were used to characterize the graphene-based steganographicly aptasensing system. As shown in Figure S5, AFM images and size distribution histograms showed that the lateral size of the GO with a flake morphology ranged from 0.075 to 0.925 μm with an average value of 0.326  0.017 μm (N = 125) and the flake area from 0.025 to 1.375 μm2 with an average value of 0.117  0.013 μm2 (N = 125). As shown in Figure 2A and F, the GO had a relatively uniform thickness distribution and its average thickness was 1.289  0.005 nm, consistent with earlier work.46-47 Whereas the average thickness of the aptamerGO complexes was determined to be 11 ACS Paragon Plus Environment


Page 12 of 37

1.809  0.042 nm (Apt1GO, Figure 2B and F) and 1.735  0.005 nm (Apt2GO, Figure 2C and G), with 0.4-0.5 nm increments compared to a clean GO sheet. The increasement of thickness suggests that the GO surface may adsorb single-stranded aptamers (Scheme 1Ab), because the average thickness of single-stranded DNA was about 0.4 ± 0.1 nm.48-49 Moreover, after incubation with pathogens, the average thickness of the resulted nanosheets decreased to 1.359  0.005 nm (A. hydrophila, Figure 2D and F) and 1.362  0.007 nm (E. tarda, Figure 2E and G), indicating that aptamers may release from the GO surface due to the competitively binding of the corresponding pathogens with aptamers.


Page 13 of 37 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 2. (A-E) Low- and high-magnification (enlargement of the green boxes) AFM images and typical height analysis of GO (A), Apt1GO (B), Apt2GO (C), Apt1GO + A. hydrophila (D) and Apt2GO + E. tarda (E). Scale bars, 1 and 0.1 µm. (F and G) Comparison of histograms of the thickness of GO (brown bars), aptamerGO (green bars), aptamerGO + pathogens (purple bars) by using Gwyddion software to process the AFM images in A-E, left panel (N = 20 positions, F for A,B,D and G for A,C,E). The red (GO), green (aptamerGO), blue (aptamerGO + pathogens) lines are Gaussian fits to the data (R2 > 0.95).



As shown in Figure 3A, a strong absorption peak at 230 nm was observed in GO (black curve a), which was attributed to π–π* transitions of C=C in aromatic rings. In addition, the shoulder peak at 295 nm indicated the n–π* transitions of the C=O groups.50 The absorption peaks of Apt1 (red curve b) and Apt2 (blue curve c) were observed at 260 nm (corresponding DNA) and 485 nm (corresponding FAM label). Whereas aptamerGO complexes (curves d and e) had an intense characteristic absorption peak of the FAM label at 485 nm and a peak at 235 nm with a slight red-shift relative to GO, which indicated that aptamer successfully absorbed onto the surface of GO. Moreover, as shown in Figure 3B, ζ-potential of GO dispersion was 20.75  1.33 mV in buffer solutions, which was attributed to the presence of electronegative functional groups formed at the graphite lattice during the oxidation.51 While the aptamerGO complexes exhibited increased negative ζ-potentials (25.43  0.90 mV for Apt1GO and 23.12  1.69 mV for Apt2GO), due to the negatively charged phosphate backbone of DNA.52 Furthermore, dynamic light scattering revealed that the average GO size increased with aptamer adsorption (Figure 3C). The hydrodynamic diameters of the aptamerGO complexes were approximately 280  11 nm (for Apt1GO) and 302  9 nm (for Apt2GO), while that of GO was approximately 243  7 nm. The results also prove the formation of the aptamerGO complexes.

1.5 1.0 0.5

235

B

a 0.2 b c d 0.1 e 485 0.0

260

300 400 500 600

0.0 200 300 400 500 600 700 800 Wavelength (nm)

C -24

Z-average (nm)

2.0 230

Zeta potential (mV)

A Abs (a.u.)

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 14 of 37

-16 -8 0

GO

GO 2-GO t t1p Ap A

300 200 100 0

GO Ap

GO 2-GO t1t Ap


Page 15 of 37 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 3. (A) UVvis absorption spectra of GO (a), Apt1 (b), Apt2 (c), Apt1GO complex (d), Apt2GO complex (e). (B) Comparison of zeta potentials and (C) hydrodynamic size distribution of GO, Apt1GO, and Apt2GO complex.

3.3 Fluorescent sensing and in vivo imaging of fish pathogens. 3.3.1 Sensitivity and selectivity of the fluorescent turnon aptasensors for fish pathogens. With the rapid development of the fish farming industry in the world and the aggravation of the aquaculture environment, various fish diseases caused by pathogenic bacteria have become an important threat to aquaculture.53 As common pathogens in aquaculture, A. hydrophila and E. tarda not only resulted in the extensive economic loss in the aquaculture industry, but also caused diseases for fish and human.54,55 Therefore, it is of great significance to develop a rapid, sensitive, highly specific and low-cost method for sensing fish pathogens (such as A. hydrophila and E. tarda). Although there are a few papers reporting aptamer-based biosensors for detection of some pathogens (like Staphylococcus aureus and Salmonella enterica),56 there have been few reports on the detection of fish pathogens (such as A. hydrophila and E. tarda) by using aptamers in combination with nanomaterials. Thus, to evaluate detection effect of the aptamerGO complexes, a series different concentrations of A. hydrophila and E. tarda solutions were respectively incubated with Apt1GO complex and Apt2GO complex, followed by the determination of the fluorescence signal of each sample. As shown in Figure 4A and C, the fluorescence intensity of Apt1GO complex and Apt2GO complex gradually increased with increasing concentration of 15 ACS Paragon Plus Environment


Page 16 of 37

pathogens from 0 to 1.3105 CFU/mL and from 0 to 1.3104 CFU/mL, respectively. The increased fluorescence signals were proportional to the concentrations of pathogens (log10 CA. hydrophila in the range of 0.1-1.3105 CFU/mL and CE. tarda in the range of 1.3-1.3104 CFU/mL). As shown in Figure 4B and D, the regression equations were y = 0.02533x + 0.0667 (R = 0.97657) with a detection limit of 1.5 CFU/mL (3/slope) for A. hydrophila and y = 8.4245105 x + 0.45354 (R = 0.99097) with a detection limit of 6.7101 CFU/mL (3/slope) for E. tarda, respectively. Although some traditional methods based on polymerase chain reaction (PCR) or antibodies have been reported for detection of A. hydrophila or E. tarda, most of them are indirect determination methods and/or have poor detection performance (like narrow linear range and high detection limit, see Tables S1 and S2). Compared with them, our proposed approach based on aptamers and nanomaterials opens an alternative and promising way and has much lower detection limit (Tables S1 and S2). Furthermore, in the absence and presence of GO, target bacteria respectively resulted in the fluorescence quenching and recovery of aptamers (Figure S6 in SI), proving that GO plays a role in reducing the fluorescence background and improving the sensitivity and signal-tonoise ratio in the system (Figure S6 in SI). Moreover, the problem of the sensitivity and reproducibility of our direct detection method may be attributed to poor bacterial dispersion and unstable bacterial activity (especially for A. hydrophila at a relatively higher concentration) which deserves special attention in future work.


Page 17 of 37 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 4. (A) Fluorescence emission spectra of the Apt1GO complex (200 nM: 0.02 mg/mL) in the presence of A. hydrophila at varying concentrations (0, 0.1, 12.5, 1.3103, 6.3104, 1.3105 CFU/mL). Inset: The dependence of the fluorescence intensity changes (FF0)/F0 on the concentration of A. hydrophila. (B) The calibration curve obtained from the spectra of panel A showing the linear dependence of change (FF0)/F0 in fluorescence intensity on the logarithm to the base 10 of A. hydrophila concentrations (log10 C, CFU/mL). (C) Fluorescence emission spectra of the Apt2GO complex in the presence of E. tarda at varying concentrations (0, 0.1, 1.3, 12.5, 1.3102, 1.3103, 2.5103, 6.3103, 1.3104 CFU/mL). Inset: The dependence of the fluorescence intensity changes (FF0)/F0 on the 17 ACS Paragon Plus Environment


concentration of E. tarda. (D) The calibration curve obtained from the spectra of panel C showing the linear dependence of change (FF0)/F0 in fluorescence intensity on the E. tarda concentrations. F and F0 are fluorescence intensities in the presence and absence of target bacteria, respectively.

As shown in Figure 5, in comparison with interfering bacteria, including Escherichia coli (E. coli, Gram-negative = G−), Erwinia (G−), Aeromonas caviae (A. caviae, G−), and Aeromonas veronii (A. veronii, G−), Bacillus subtilis (B. subtilis, Gram-positive = G+), only the target bacteria exhibited obvious fluorescence enhancement. The observations demonstrated that the aptamerGO complexes presented excellent selectivity detection of target pathogens with high specificity. Furthermore, the results of fluorescence microscopy images (Figure S7 in SI) also demonstrated our method had good specificity.

A

B 0.75 (F-F0)/F0

0.15 (F-F0)/F0

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 18 of 37

0.10 0.05 0.00 A.

d hy

h ro p

ila arda coli inia viae ronii btilis t E. Erw . ca . ve . su E. A A B

0.50 0.25 0.00

A.

ia lis nii ila oli ae da ph . tar E. c rwin cavi vero subti o r E . . E d . A A B hy

Figure 5. Fluorescence response (FF0)/F0 of the Apt1GO complex (A) or the Apt2GO complex (B) to target bacteria (A. hydrophila (A) or E. tarda (B)) and interfering bacteria (E. coli (Gram-negative = G−), Erwinia (G−), A. caviae (G−), A. veronii (G−), and B. subtilis (Gram-positive = G+)). The concentration of target bacteria and interfering bacteria were 1.3103 CFU/mL for Figure 5A and 2.5103 CFU/mL for 18 ACS Paragon Plus Environment

Page 19 of 37 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 5B, respectively. AptamerGO complexes, 200 nM: 0.02 mg/mL. F and F0 are fluorescence intensities in the presence and absence of bacteria, respectively.

3.3.2 In vivo fluorescence imaging of Carassius auratus infected by A. hydrophila and E. tarda. In order to investigate the feasibility of aptamerGO complexes for practical application in vivo fluorescence detection and imaging of fish Carassius auratus infected by fish pathogens, we established pathogen infection models by injecting intraperitoneally 200 μL of different amount of A. hydrophila (105 and 106 CFU/mL) and E. tarda (104 and 105 CFU/mL) into Carassius auratus. After overnight injection, then 2 mL of aptamerGO complexes were injected intraperitoneally into the fishes. Because the maximum excitation and emission wavelength of the FAM-labeled aptamers located at about 485 and 520 nm, respectively, in vivo fluorescence imaging, the fluorescence imaging parameter (excitation, 500 nm; emission, 540 nm) was set closest to the above-mentioned condition. The similar fluorescence imaging parameter was also used for in vivo imaging of aquatic species (such as non-transparent zebrafish adults, shell-less fish, and shrimp).57-59 Although this imaging parameter is generally considered to have a weak penetration ability for bio-organism, we confirmed that after 6 h post injection of aptamer−GO complexes, the body of fishes exhibited fluorescence signals, and their fluorescent intensities increased gradually with increasing concentration of pathogens (Figure 6A and B, Figure S8A1 and B1, Figure S9A). The results clearly prove the feasibility of aptamer−GO complexes for in vivo fluorescence imaging of fish infected by fish pathogens. Furthermore, the fishes were sacrificed and the main organs (heart, kidney, spleen, gonad, liver, or intestine) were harvested for fluorescent imaging. Only gonad, liver and intestine had 19 ACS Paragon Plus Environment


Page 20 of 37

obvious fluorescent signals, and their fluorescent intensities also increased gradually with increasing concentration of pathogens (Figure 6A and B, Figure S8A2 and B2, Figure S9B). The gonad of fish infected by 105 CFU/mL of E. tarda had stronger and more concentrated fluorescence (Figure 6B, bottom right corner, Figure S8B2, red column), which may be attributed to special colonization of E. tarda. These results indicate that aptamerGO complexes have a potential capability to sense and image A. hydrophila and E. tarda in vivo in fish Carassius auratus.


Page 21 of 37 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 6. In vivo fluorescence detection and imaging of Carassius auratus infected by A. hydrophila and 21 ACS Paragon Plus Environment


Page 22 of 37

E. tarda. (A) Apt1GO complex (200 nM: 0.02 mg/mL) injected intraperitoneally into fishes with different concentrations of A. hydrophila (from left to right: 0, 105, 106 CFU/mL); (B) Apt2GO complex (200 nM: 0.02 mg/mL) injected intraperitoneally into fishes with different concentrations of E. tarda (from left to right: 0, 104, 105 CFU/mL). The images from top to bottom are belly, left side, and right side, and ex vivo main organs (heart, kidney, spleen, gonad, liver and intestine) of the fishes, respectively. Color scales are located on the right side of each line of images and were manually set to the same values for every comparable image. The high intensity of fluorescence appeared as red color and low intensity of fluorescence as blue. Scale bar, 5 cm for all images.

3.4 Graphene-based steganographicly aptasensing system for information encryption and hiding. With the rapid development of the information age, information security becomes all the more necessary. There are several layers of security measures to protect information safety, including encrypting (cryptography), hiding (steganography), and preventing access (password protection).31 Unlike encryption which convert messages into unintelligible ciphertexts, steganography is the practice of concealing an object (like message, file, image, or video) within another object (like message, file, image, or video) and its essence is hiding information whether the information is encrypted or not (corresponding to pure or hybrid steganography). In fact, steganography has been widely used for centuries from ancient physical media to modern digital media, including hiding messages within a wax tablet, on messenger’s body, on paper written in invisible inks, concealing secret data in an appropriate multimedia carrier (e.g., image, audio, and video files). Inspired by the microdot of concealing messages in the Second World War, 22 ACS Paragon Plus Environment

Page 23 of 37 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


DNA microdot was further developed as a steganographic technique for sending secret messages, by utilizing the enormous complexity of human genomic DNA and information coding ability of DNA.34 In a basic steganography model (Scheme 2A), a secret message is being embedded inside a cover or carrier to produce the stego object. This process is called as steganography which generally must satisfy some requirements, including the integrity of the hidden information and unchange of appearance for the stego object compared with cover or carrier. The produced stego object can then be sent off via some communications channel, such as post for physical format or email for digital format, to the intended recipient for decoding. The recipient must use a key to decode the stego object for viewing the secret message. The decoding process is simply the reverse of the embedding process (also called as steganalysis). Different types of stegosystems use different inputs and outputs. In general, there are two basic types of stegosystems, including pure stegosystems (only steganography, like invisible inks) and secret key stegosystems (steganography  encryption, like the above-mentioned DNA microdot stegosystems34). In order to expand the steganographic technique, our developed graphene-based steganographicly aptasensing system can be used as a doubly cryptographic and steganographic system (Scheme 2B) for sending secret information. This double stegosystem consists of pathogen-binding DNA aptamers as information carriers, GO as a cover, a pair of keys: pathogen that can be specifically recognized by aptamer as a public key, the encryption key used to encode or decode a message in DNA as a private key (Scheme 2B). According to estimates, 1 kg DNA with extremely high data density (~1019 bits per cm3) can store all the world’s data.28 By using a simple substitution cipher (polyalphabetic cipher), almost all common characters can be encoded in DNA hexaplets (6-bit, 46 = 4096) or heptaplets (7-bit, 47 = 16384, 23 ACS Paragon Plus Environment


Page 24 of 37

Figures S10,S11 in SI). Thus, take our 35-base DNA aptamers (Apt1 and Apt2) as examples, we can utilize DNA hexaplets or heptaplets to encode 30 or 29 characters from the 5’ end by moving one base in turn (Scheme 2C). In a digital system, the larger the cover/carrier (in binary data, the number of bits) relative to the hidden message, the easier it is to hide the hidden message. Thus, a ‘secret message’ DNA aptamer containing an encoded message can be more easily hidden in the graphene cover/carrier to produce aptamer–GO complexes (the stego object, turnoff, Scheme 2Ba,b). The GO not only provides a large two-dimensional plane and quenches the fluorescence of aptamer to near zero background level (Figure S3A,B and S4A,B). The interaction between GO and aptamers is sufficient to protect the aptamers from leaking (Figure S1 and S2, Figure 5). Even if an adversary somehow discovered the complexes, it would still verify exceedingly difficult to view the message without knowing the specific public key. Only when the target pathogen (the right public key) is present, aptamer–GO complexes (the stego object) can be decoded to release the secret-message aptamers and restore the fluorescence (Scheme 2Bc,d, Figure S1 and S2, Figure 5). According to the corresponding rules between the secret-message aptamers and the public keys (target pathogens), A. hydrophila unlocks Apt1 (fluorescence restoring, (FF0)/F0  0.05, Figure 5A) to clearly know its DNA sequence, and E. tarda unlocks Apt2 (fluorescence restoring, (FF0)/F0  0.5, Figure 5B) to clearly know its DNA sequence (Scheme 2Da,c). Even if an adversary somehow uncovered the DNA sequence, it would still validate very difficult to understand the message without knowing the specific private key (the encryption key). Thus, some pre-designed aptamer–GO solution can be sent to the intended recipient knowing both our experimental methods and a pair of keys. The one could readily add the corresponding pathogen into the receiving solution and monitor the 24 ACS Paragon Plus Environment

Page 25 of 37 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


fluorescence restoring via a common fluorometer, and obtain the DNA sequence of aptamers ((FF0)/F0  0.05 for Apt1 and (FF0)/F0  0.5 for Apt2). According to our encryption key (Scheme 2Db,d, Figures S10,S11 in SI), the hidden message encoded in DNA sequence was further decoded in a specific sequence for yielding the secret texts: “Sensing everything, everytime” or “Richard Feynman At 100 (1918-2018)” (Scheme 2Be,f, Scheme 2D, Tables S3,S4 in SI). Of course, we could also design two or more steganographic systems to achieve multiple steganography operations to further improve the security level, such as two pieces of secret message hidden in two stegosystems or secret message and information of public key hidden in cascade stegosystems.



Page 26 of 37

Scheme 2. Graphene-based steganographicly aptasensing system for information encoding and steganography. (A) A simple representation of the generic embedding and decoding process in basic steganography model. (B) Schematic illustration of graphene-based double stegosystem which consists of pathogen-binding DNA aptamers as information carriers, GO as a cover, a pair of keys: pathogen that can be specifically recognized by aptamer as a public key, the encryption key used to encode or decode a message in DNA as a private key. (C) Structure of information coding in a secret-message DNA strand. (D) Decoding the hidden message in the graphene-based double stegosystems. a,c, The corresponding 26 ACS Paragon Plus Environment

Page 27 of 37 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


decoding rules, diagrams, and secret texts. b,d, Encryption keys used to encode a message in DNA Apt1 (b) and Apt2 (d). For more details of coding tables, see SI.

4. Conclusions In summary, we proposed a graphene-based steganographicly aptasensing system for multipurpose applications in information computing, encryption and hiding, fluorescent sensing and in vivo imaging of two fish pathogens (A. hydrophila and E. tarda). By using matter, energy and information exchange and change, this system is used for fabricating matter logic circuit and complex fluorescent logic circuit. Our designed approach for rapid, highly sensitive detection fish pathogens may have potential applications in aquaculture disease diagnostics and environment monitoring. More importantly, our developed graphenebased steganographicly aptasensing system also can be served as a generally doubly cryptographic and steganographic system to bypass using electronic communication systems for improving information security. It is a novel design and paradigm to use pathogen-binding DNA aptamers as information carriers, GO as a cover, a pair of keys: target pathogen as a public key, the encryption key used to encode or decode a message in DNA as a private key. The doubly cryptographic and steganographic system can satisfy a higher level of security. Our steganography sensing system has the advantages of simple operation, high security (cryptography and steganography), universality, and easy expansion. Future, inspired by this steganographicly sensing system, by combining numerous recognition and signalling elements with materials, more molecular cipher devices can be developed to convert distinct molecular patterns into unique information coding and encryption keys. Our study provides a novel nano-biosensing assay for rapid and effective sensing and in vivo imaging fish pathogens and demonstrates a new possible dimension 27 ACS Paragon Plus Environment


Page 28 of 37

of advanced information communication, which is helpful in probably promoting the development of intelligent chem/bio-sensing and treatment system and molecular-level information security (molecular cascade steganography).

2. Experimental section 2.1 Materials and apparatus. The aptamers that can specifically recognize A. hydrophila and E. tarda were synthesized by Sangon Biotech. Co., Ltd. (Shanghai, China), and are shown in Table 1. Table 1. Sequences and modifications of aptamers targeted for A. hydrophila and E. tarda.60 Aptamers

Sequences and modifications (5’ to 3’)

Targets

Apt1

FAMGGTGGAGGTGGGGGTTGGGTGGGGTTGCGTTCAGT

A. hydrophila

Apt2

FAMGCTTTTTCAAGTTGTGCTCCGTGTTTAGTTTTGTG

E. tarda

Graphene oxide (GO) was purchased from XFNANO Co., Ltd. (Nanjing, China). Tris(hydroxymethyl)aminomethane (Tris), Acetic acid, NaCl, MgCl2, HCl were of analytical reagent grade and purchased from Aladdin Reagents Co., Ltd. (Shanghai, China). KCl was purchased from Macklin Reagents Co., Ltd. (China). Tryptone and yeast extract were provided by Oxoid (Basingstoke, UK). Agar was purchased from Biotopped Co., Ltd. (Beijing, China). All aqueous solutions were prepared with double-distilled water produced by a Milli-Q system (Millipore, Bedford, MA, USA, 18.2 MΩ·cm). 2.2 Instruments. 28 ACS Paragon Plus Environment

Page 29 of 37 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Atomic force microscope (AFM) images were achieved on a Bruker Multimode 8 AFM/SPM (Bruker, Germany) system and analyzed by freeware: Gwyddion 2.30 (http://gwyddion.net/). UVVis absorption spectra were recorded on a Hach spectrophotometer DR6000 (USA). Fluorescence measurements were performed using a SpectraMax M5 microplate spectrophotometer system (Molecular Devices, USA). Fluorescence emission spectra were measured at an excitation wavelength of 485 nm. The zeta-potentials were achieved on a Zetasizer Nano ZS (Malvern Instruments Ltd, UK). Fluorescence imaging of bacteria was visualized using an inverted fluorescence microscope (Zeiss, Axio Observer A1) with 63x PlanApochromat (NA 1.4) DIC oil 270 immersion objective lens at the excitation of 488 nm. In vivo fluorescence imaging of fish pathogens in fishes were recorded by a small-animal in vivo imaging system (IVIS SPECTRUM, Caliper-PE, fluorescence excitation 500 nm, fluorescence emission 540 nm). Specific areas of the image may be analyzed by creating regions of interest (ROI) with Living Image software 4.3.1. 2.3 Bacteria culture and counting. Bacteria were grown in Luria−Bertani broth medium at 37 °C with continuous shaking overnight and then washed three times with binding buffer (50 mM TrisHCl, 100 mM NaCl, 5 mM KCl, 1 mM MgCl2, pH 7.4) by centrifugation (12000 rpm, 5 min). According to the conventional agar plate-counting method, after incubation at 37 °C for 18 h, the colonies on the plates were counted to determine the number of colony forming units per milliliter (CFU/mL), yielding the concentration of about 107 CFU/mL. 2.4 Detection of pathogens. First, aptamer solutions were diluted by the binding buffer (50 mM TrisHCl, 100 mM NaCl, 5 mM 29 ACS Paragon Plus Environment


Page 30 of 37

KCl, 1 mM MgCl2, pH 7.4). GO nanoflakes (0.02 mg/mL) was then incubated with aptamer solution (200 nM) for 8 min (reaction time optimization in Figures S3C and S4C in SI) at room temperature to forming the aptamerGO complexes. Then, A. hydrophila with different amount (0, 0.1, 12.5, 1.3103, 6.3104, 1.3105 CFU/mL) and E. tarda with different amount (0, 0.1, 1.3, 12.5, 1.3102, 1.3103, 2.5103, 6.3103, 1.3104 CFU/mL) were added into the above aptamerGO complex solution and incubated at room temperature for 30 min (reaction time optimization in Figures S3D and S4D in SI). The fluorescence intensity of the final mixture was measured directly by a SpectraMax M5 microplate spectrophotometer system at λex/λem = 485/520 nm. The same procedures were employed with interfering bacteria (such as E. coli, Erwinia, A. caviae, A. veronii, and B. subtilis) instead of target bacteria that were supplied in the control groups. 2.5 In vivo fluorescence imaging of freshwater fish Carassius auratus infected by A. hydrophila and E. tarda. All animal procedures were performed in accordance with the Guidelines for Care and Use of Laboratory Animals of Hunan Normal University and approved by the Animal Ethics Committee of Hunan Normal University. Healthy freshwater fish Carassius auratus (length: 17–20 cm and weight: 500 g) were obtained from Hunan Normal University in China. The fish were kept in quarantine plastic tanks with a follow-through water volume of 500 L (dissolved oxygen 6.0 ± 0.5 mg/L; temperature 28 ± 1 °C) with additions of the aerator and fed with commercial diet twice daily. All fishes were acclimatized for one week prior to the experiment. In order to investigate the feasibility of aptamerGO complexes for in vivo fluorescence detection 30 ACS Paragon Plus Environment

Page 31 of 37 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


and imaging of fish pathogens (A. hydrophila and E. tarda), 200 μL of different amount of A. hydrophila (105 and 106 CFU/mL) and E. tarda (104 and 105 CFU/mL) were injected intraperitoneally into Carassius auratus. After overnight injection, then 2 mL of aptamerGO complexes (200 nM: 0.02 mg/mL) were injected intraperitoneally into the fishes. After 6 h post injection, the fishes were anesthetized by immersion of tricaine (50 mg/L, Sigma-Aldrich), and then imaged with IVIS Spectrum imaging system (Caliper, MA). Finally, the fishes were sacrificed and the main organs (heart, kidney, spleen, gonad, liver and intestine) were harvested for fluorescent imaging. Image scaling was normalized by converting total radiant efficiency. Scales were manually set to the same values for every comparable image. To depict the differences in intensity of the signal, fluorescence intensity was represented by a multi-color scale ranging from blue (least intense) to red (most intense). Signal intensity images were superimposed over gray scale reference photographs for anatomical representations.

ASSOCIATED CONTENT Supporting Information. Fluorescence binding assays and fluorescence anisotropy assays for the interaction between aptamers and pathogens, optimization of the detection conditions, morphology and size distribution histograms of GO, comparison of the detection limits and linear ranges of other reported A. hydrophila and E. tarda assays, the role of GO in the sensing system, fluorescence microscope images of different bacteria after incubation with aptamerGO complexes, statistical results and blank control of 31 ACS Paragon Plus Environment


Page 32 of 37

in vivo fluorescence imaging, the encryption keys used to encode or decode a message in DNA aptamers. This material is available free of charge via the Internet at http://pubs.acs.org. AUTHOR INFORMATION Author Contributions #

These authors contributed equally to this work.

Notes The authors declare no competing financial interest.

ACKNOWLEDGMENT This work was supported by the National Natural Science Foundation of China (No. 21505042), Scientific and Technological Plan Project of Changsha of China (No. KQ1707010 and KQ1802046), Hunan Provincial Natural Science Foundation of China (No. 2016JJ3084), the Research Foundation of Education Bureau of Hunan Province (No. 15K084), the Cooperative Innovation Center of Engineering and New Products for Developmental Biology of Hunan Province (No. 20134486), Hunan Provincial Innovation Foundation for Postgraduate (No. CX2018B303), and College Student Innovative Experiment Project of Hunan Province (No. 2017106).

References (1) Nurse, P. Life, Logic and Information. Nature 2008, 454, 424-426. (2) Li, J.; Green, A. A.; Yan, H.; Fan, C. H. Engineering Nucleic Acid Structures for Programmable 32 ACS Paragon Plus Environment

Page 33 of 37 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Molecular Circuitry and Intracellular Biocomputation. Nat. Chem. 2017, 9, 1056-1067. (3) Lai, W.; Ren, L.; Tang, Q.; Qu, X.; Li, J.; Wang, L.; Li, L.; Fan, C.; Pei, H. Programming Chemical Reaction Networks Using Intramolecular Conformational Motions of DNA. ACS Nano 2018, 12, 70937099. (4) Katz, E.; Privman, V. Enzyme-Based Logic Systems for Information Processing. Chem. Soc. Rev. 2010, 39, 1835-1857. (5) Erbas-Cakmak, S.; Kolemen, S.; Sedgwick, A. C.; Gunnlaugsson, T.; James, T. D.; Yoon, J.; Akkaya, E. U. Molecular Logic Gates: The Past, Present and Future. Chem. Soc. Rev. 2018, 47, 2228-2248. (6) de Silva, A. P.; Uchiyama, S. Molecular Logic and Computing. Nat. Nanotechnol. 2007, 2, 399-410. (7) Wang, F.; Lu, C. H.; Willner, I. From Cascaded Catalytic Nucleic Acids to Enzyme-DNA Nanostructures: Controlling Reactivity, Sensing, Logic Operations, and Assembly of Complex Structures. Chem. Rev. 2014, 114, 2881-2941. (8) Lu, J. Y.; Zhang, X. X.; Huang, W. T.; Zhu, Q. Y.; Ding, X. Z.; Xia, L. Q.; Luo, H. Q.; Li, N. B. Boolean Logic Tree of Label-Free Dual-Signal Electrochemical Aptasensor System for Biosensing, Three-State Logic Computation, and Keypad Lock Security Operation. Anal. Chem. 2017, 89, 9734-9741. (9) de Ruiter, G.; Tartakovsky, E.; Oded, N.; van der Boom, M. E. Sequential Logic Operations with Surface-Confined Polypyridyl Complexes Displaying Molecular Random Access Memory Features. Angew. Chem. Int. Ed. 2010, 49, 169-172. (10) Andreasson, J.; Pischel, U. Molecules with a Sense of Logic: A Progress Report. Chem. Soc. Rev. 2015, 44, 1053-1069. (11) Huang, W. T.; Luo, H. Q.; Li, N. B. Boolean Logic Tree of Graphene-Based Chemical System for Molecular Computation and Intelligent Molecular Search Query. Anal. Chem. 2014, 86, 4494-4500. (12) Huang, W. T.; Zhang, J. R.; Xie, W. Y.; Shi, Y.; Luo, H. Q.; Li, N. B. Fuzzy Logic Sensing of GQuadruplex DNA and Its Cleavage Reagents Based on Reduced Graphene Oxide. Biosens. Bioelectron. 2014, 57, 117-124. (13) Guz, N.; Fedotova, T. A.; Fratto, B. E.; Schlesinger, O.; Alfonta, L.; Kolpashchikov, D. M.; Katz, E. Bioelectronic Interface Connecting Reversible Logic Gates Based on Enzyme and DNA Reactions. Chemphyschem 2016, 17, 2247-2255. (14) Orbach, R.; Willner, B.; Willner, I. Catalytic Nucleic Acids (Dnazymes) as Functional Units for Logic Gates and Computing Circuits: From Basic Principles to Practical Applications. Chem. Commun. 2015, 51, 4144-4160. (15) Douglas, S. M.; Bachelet, I.; Church, G. M. A Logic-Gated Nanorobot for Targeted Transport of Molecular Payloads. Science 2012, 335, 831-834. (16) Tregubov, A. A.; Nikitin, P. I.; Nikitin, M. P. Advanced Smart Nanomaterials with Integrated LogicGating and Biocomputing: Dawn of Theranostic Nanorobots. Chem. Rev. 2018, 118, 10294-10348. (17) Fu, T.; Lyu, Y. F.; Liu, H.; Peng, R. Z.; Zhang, X. B.; Ye, M.; Tan, W. H. DNA-Based Dynamic Reaction Networks. Trends Biochem. Sci. 2018, 43, 547-560. (18) Cherry, K. M.; Qian, L. Scaling up Molecular Pattern Recognition with DNA-Based Winner-TakeAll Neural Networks. Nature 2018, 559, 370-376. (19) Qu, X.; Wang, S.; Ge, Z.; Wang, J.; Yao, G.; Li, J.; Zuo, X.; Shi, J.; Song, S.; Wang, L.; Li, L.; Pei, H.; Fan, C. Programming Cell Adhesion for on-Chip Sequential Boolean Logic Functions. J. Am. Chem. 33 ACS Paragon Plus Environment


Page 34 of 37

Soc. 2017, 139, 10176-10179. (20) Colquhoun, H.; Lutz, J. F. Information-Containing Macromolecules. Nat. Chem. 2014, 6, 455-456. (21) Prime, E. L.; Solomon, D. H. Australia's Plastic Banknotes: Fighting Counterfeit Currency. Angew. Chem. Int. Ed. 2010, 49, 3726-3736. (22) Holub, J.; Vantomme, G.; Lehn, J. M. Training a Constitutional Dynamic Network for Effector Recognition: Storage, Recall, and Erasing of Information. J. Am. Chem. Soc. 2016, 138, 11783-11791. (23) Jiang, G. Y.; Song, Y. L.; Guo, X. F.; Zhang, D. Q.; Zhu, D. B. Organic Functional Molecules Towards Information Processing and High-Density Information Storage. Adv. Mater. 2008, 20, 2888-2898. (24) Huang, W. T.; Chen, L. X.; Lei, J. L.; Luo, H. Q.; Li, N. B. Molecular Neuron: From Sensing to Logic Computation, Information Encoding, and Encryption. Sens. Actuator B-Chem. 2017, 239, 704-710. (25) Lutz, J. F. Coding Macromolecules: Inputting Information in Polymers Using Monomer-Based Alphabets. Macromolecules 2015, 48, 4759-4767. (26) Goldman, N.; Bertone, P.; Chen, S.; Dessimoz, C.; LeProust, E. M.; Sipos, B.; Birney, E. Towards Practical, High-Capacity, Low-Maintenance Information Storage in Synthesized DNA. Nature 2013, 494, 77-80. (27) Andréasson, J.; Pischel, U. Molecules for Security Measures: From Keypad Locks to Advanced Communication Protocols. Chem. Soc. Rev. 2018, 47, 2266-2279. (28) Extance, A. How DNA Could Store All the World’s Data. Nature 2016, 537, 22-24. (29) Shipman, S. L.; Nivala, J.; Macklis, J. D.; Church, G. M. Molecular Recordings by Directed Crispr Spacer Acquisition. Science 2016, 353, aaf1175. (30) Margulies, D.; Felder, C. E.; Melman, G.; Shanzer, A. A Molecular Keypad Lock: A Photochemical Device Capable of Authorizing Password Entries. J. Am. Chem. Soc. 2007, 129, 347-354. (31) Lustgarten, O.; Motiei, L.; Margulies, D. User Authorization at the Molecular Scale. Chemphyschem 2017, 18, 1678-1687. (32) Boukis, A. C.; Reiter, K.; Froelich, M.; Hofheinz, D.; Meier, M. A. R. Multicomponent Reactions Provide Key Molecules for Secret Communication. Nat. Commun. 2018, 9, 1439. (33) Sarkar, T.; Selvakumar, K.; Motiei, L.; Margulies, D. Message in a Molecule. Nat. Commun. 2016, 7, 11374. (34) Clelland, C. T.; Risca, V.; Bancroft, C. Hiding Messages in DNA Microdots. Nature 1999, 399, 533534. (35) Li, S.-Y.; Liu, J.-K.; Zhao, G.-P.; Wang, J. Cads: Crispr/Cas12a-Assisted DNA Steganography for Securing the Storage and Transfer of DNA-Encoded Information. ACS Synth. Biol. 2018, 7, 1174-1178. (36) Qu, X.; Zhu, D.; Yao, G.; Su, S.; Chao, J.; Liu, H.; Zuo, X.; Wang, L.; Shi, J.; Wang, L.; Huang, W.; Pei, H.; Fan, C. An Exonuclease Iii-Powered, on-Particle Stochastic DNA Walker. Angew. Chem. Int. Ed. 2017, 56, 1855-1858. (37) Yang, F.; Li, Q.; Wang, L. H.; Zhang, G. J.; Fan, C. H. Framework-Nucleic-Acid-Enabled Biosensor Development. Acs Sensors 2018, 3, 903-919. (38) Pei, H.; Li, J.; Lv, M.; Wang, J.; Gao, J.; Lu, J.; Li, Y.; Huang, Q.; Hu, J.; Fan, C. A Graphene-Based Sensor Array for High-Precision and Adaptive Target Identification with Ensemble Aptamers. J. Am. Chem. Soc. 2012, 134, 13843-13849. (39) Meng, H. M.; Liu, H.; Kuai, H. L.; Peng, R. Z.; Mo, L. T.; Zhang, X. B. Aptamer-Integrated DNA 34 ACS Paragon Plus Environment

Page 35 of 37 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Nanostructures for Biosensing, Bioimaging and Cancer Therapy. Chem. Soc. Rev. 2016, 45, 2583-2602. (40) Miranda-Castro, R.; Sanchez-Salcedo, R.; Suarez-Alvarez, B.; de-los-Santos-Alvarez, N.; MirandaOrdieres, A. J.; Lobo-Castanon, M. J. Thioaromatic DNA Monolayers for Target-Amplification-Free Electrochemical Sensing of Environmental Pathogenic Bacteria. Biosens. Bioelectron. 2017, 92, 162-170. (41) Zhou, G.; Latchoumanin, O.; Bagdesar, M.; Hebbard, L.; Duan, W.; Liddle, C.; George, J.; Qiao, L. Aptamer-Based Therapeutic Approaches to Target Cancer Stem Cells. Theranostics 2017, 7, 3948-3961. (42) Pei, H.; Zuo, X. L.; Zhu, D.; Huang, Q.; Fan, C. H. Functional DNA Nanostructures for Theranostic Applications. Acc. Chem. Res. 2014, 47, 550-559. (43) Qu, X.; Zhang, H.; Chen, H.; Aldalbahi, A.; Li, L.; Tian, Y.; Weitz, D. A.; Pei, H. Convection-Driven Pull-Down Assays in Nanoliter Droplets Using Scaffolded Aptamers. Anal. Chem. 2017, 89, 3468-3473. (44) Chen, L.; Chao, J.; Qu, X.; Zhang, H.; Zhu, D.; Su, S.; Aldalbahi, A.; Wang, L.; Pei, H. Probing Cellular Molecules with Polya-Based Engineered Aptamer Nanobeacon. ACS Appl. Mater. Interfaces 2017, 9, 8014-8020. (45) Zhou, W. H.; Saran, R.; Liu, J. W. Metal Sensing by DNA. Chem. Rev. 2017, 117, 8272-8325. (46) Lu, C. H.; Yang, H. H.; Zhu, C. L.; Chen, X.; Chen, G. N. A Graphene Platform for Sensing Biomolecules. Angew. Chem. Int. Ed. 2009, 48, 4785-4787. (47) Fan, X. B.; Peng, W. C.; Li, Y.; Li, X. Y.; Wang, S. L.; Zhang, G. L.; Zhang, F. B. Deoxygenation of Exfoliated Graphite Oxide under Alkaline Conditions: A Green Route to Graphene Preparation. Adv. Mater. 2008, 20, 4490-4493. (48) Klinov, D.; Dwir, B.; Kapon, E.; Borovok, N.; Molotsky, T.; Kotlyar, A. High-Resolution Atomic Force Microscopy of Duplex and Triplex DNA Molecules. Nanotechnology 2007, 18, 225102. (49) Kundukad, B.; Cong, P. W.; van der Maarel, J. R. C.; Doyle, P. S. Time-Dependent Bending Rigidity and Helical Twist of DNA by Rearrangement of Bound Hu Protein. Nucleic Acids Res. 2013, 41, 82808288. (50) Yang, S.; Yue, W.; Huang, D.; Chen, C.; Lin, H.; Yang, X. A Facile Green Strategy for Rapid Reduction of Graphene Oxide by Metallic Zinc. RSC Adv. 2012, 2, 8827. (51) Krishnamoorthy, K.; Veerapandian, M.; Yun, K.; Kim, S. J. The Chemical and Structural Analysis of Graphene Oxide with Different Degrees of Oxidation. Carbon 2013, 53, 38-49. (52) Patil, A. J.; Vickery, J. L.; Scott, T. B.; Mann, S. Aqueous Stabilization and Self-Assembly of Graphene Sheets into Layered Bio-Nanocomposites Using DNA. Adv. Mater. 2009, 21, 3159-3164. (53) Ben Hamed, S.; Tavares Ranzani-Paiva, M. J.; Tachibana, L.; de Carla Dias, D.; Ishikawa, C. M.; Esteban, M. A. Fish Pathogen Bacteria: Adhesion, Parameters Influencing Virulence and Interaction with Host Cells. Fish Shellfish Immunol. 2018, 80, 550-562. (54) Aznan, A. S.; Lee, K. L.; Low, C. F.; Iberahim, N. A.; Ibrahim, W. N. W.; Musa, N.; Yeong, Y. S.; Musa, N. Protective Effect of Apple Mangrove Sonneratia Caseolaris Extract in Edwardsiella TardaInfected African Catfish, Clarias Gariepinus. Fish Shellfish Immunol. 2018, 78, 338-345. (55) Yadav, S. K.; Dash, P.; Sahoo, P. K.; Garg, L. C.; Dixit, A. Modulation of Immune Response and Protective Efficacy of Recombinant Outer-Membrane Protein F (Rompf) of Aeromonas Hydrophila in Labeo Rohita. Fish Shellfish Immunol. 2018, 80, 563-572. (56) Chen, J.; Andler, S. M.; Goddard, J. M.; Nugen, S. R.; Rotello, V. M. Integrating Recognition Elements with Nanomaterials for Bacteria Sensing. Chem. Soc. Rev. 2017, 46, 1272-1283. 35 ACS Paragon Plus Environment


Page 36 of 37

(57) Ridges, S.; Heaton, W. L.; Joshi, D.; Choi, H.; Eiring, A.; Batchelor, L.; Choudhry, P.; Manos, E. J.; Sofla, H.; Sanati, A.; Welborn, S.; Agarwal, A.; Spangrude, G. J.; Miles, R. R.; Cox, J. E.; Frazer, J. K.; Deininger, M.; Balan, K.; Sigman, M.; Muschen, M.; Perova, T.; Johnson, R.; Montpellier, B.; Guidos, C. J.; Jones, D. A.; Trede, N. S. Zebrafish Screen Identifies Novel Compound with Selective Toxicity against Leukemia. Blood 2012, 119, 5621-31. (58) Tenente, I. M.; Hayes, M. N.; Ignatius, M. S.; McCarthy, K.; Yohe, M.; Sindiri, S.; Gryder, B.; Oliveira, M. L.; Ramakrishnan, A.; Tang, Q.; Chen, E. Y.; Petur Nielsen, G.; Khan, J.; Langenau, D. M. Myogenic Regulatory Transcription Factors Regulate Growth in Rhabdomyosarcoma. Elife 2017, 6, e19214. (59) Ramachandran, S.; Thiyagarajan, S.; Raj, G. D.; Uma, A. Non-Invasive in Vivo Imaging of Fluorescence-Labeled Bacterial Distributions in Aquatic Species. Int. J. Vet. Sci. Med. 2017, 5, 187-195. (60) Wang, L. The Selection of Aptamers against Aeromonas Hydrophila and Edwardsiella Tarda with Selex. Master Thesis, JiMei University, Xiamen, China, 2012.


Page 37 of 37 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


for TOC only


Graphene-Based Steganographically Aptasensing System for

Recommend Documents