Graphene Oxide and Lysozyme Ultrathin Films with Strong

Subscriber access provided by Bibliothèque de l'Université Paris-Sud

Biological and Environmental Phenomena at the Interface

Graphene oxide (GO) and lysozyme (Lys) ultrathin film with strong antibacterial and enhanced osteogenesis Meng Li, Huaqiong Li, Qiongxi Pan, Chenyuan Gao, Yingying Wang, Shuoshuo Yang, Xingjie Zan, and Yifu Guan Langmuir, Just Accepted Manuscript • DOI: 10.1021/acs.langmuir.9b00035 • Publication Date (Web): 27 Apr 2019 Downloaded from http://pubs.acs.org on April 27, 2019

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 27 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

Graphene oxide (GO) and lysozyme (Lys) ultrathin film with strong antibacterial and enhanced osteogenesis Meng Li, + a Huaqiong Li, + b, c, d Qiongxi Pan, c, d Chenyuan Gao, c, d Yingying Wang, b Shuoshuo Yang, b, c, d Xingjie Zan, b, c, d* Yifu Guan a*

a

Department of Biochemistry and Molecular Biology, China Medical University, Shenyang,

110122. PR China b

School of Ophthalmology and Optometry, Eye Hospital, School of Biomedical Engineering,

Wenzhou Medical University, Wenzhou, Zhejiang Province, 325035. PR China. c

Wenzhou Institute of Biomaterials and Engineering, CNITECH, Chinese Academy of Sciences,

Wenzhou, Zhejiang Province, 325011. PR China. d

Engineering Research Center of Clinical Functional Materials and Diagnosis&Treatment

Devices of Zhejiang Province, Wenzhou Institute of Biomaterials and Engineering, Chinese Academy of Sciences, Wenzhou, Zhejiang Province, 325011. PR China. +These

authors contributed equally to this work. RECEIVED DATE (automatically inserted by publisher);

*E-mail: [email protected]; [email protected]

1

ACS Paragon Plus Environment

Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Abstract There is a great demand worldwide for bone related implant materials. The drawbacks of chronic infections and poor bone healing of current implant materials have limited their clinical applications. Functionalizing the implant surfaces with antibacterial and osteogenic films on implant materials provides new opportunities for fabricating novel implant materials. In the present study, an ultrathin (GO/Lys)8 film of several ten nanometers, was fabricated using layer-by-layer (LBL) technique with alternative deposition of GO and lysozyme. The deposition of (GO/Lys)n film exhibited a successive growth as supported by ellipsometry, UV-Vis and Fourier transform infrared (FTIR) data, and the physical properties (morphology, roughness and stiffness) of this film were characterized with atomic force microscope (AFM). The ultrathin films exhibited a great effect on bacterium sterilization of Gram-positive S. aureus and Gram-negative E. coli, and enhanced osteogenic differentiation efficiency, showing the potential application on bone implants coatings. We believe that this layer-by-layer assembling strategy will pave the way to fabricating dual functional surfaces and guide the design of implanted surface in the future. Keywords: graphene oxide; osteogenesis; lysozyme; implant coating; antibacterial

2


Page 2 of 27

Page 3 of 27 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

1 Introduction Bone implantation is a common medical procedure for treatment of bone related diseases, such as bone defect, bone degradation and bone arthrosis. Based on market analysis conducted by Evaluate MedTech, the global market of bone implant materials was $34.8 billion in 2014 and will be increased to $42 billion in 2020 with an annual rate of 3.2%.1 As required by clinical regulations, bone implant materials must possess two of most fundamental properties: osteogenesis and antibacterium. Osteogenesis promotes the implant materials to fuse with the surrounding tissues, accelerate bone regeneration and reduce the therapeutic period. On the other hand, the antibacterial property prevents bacterial infection associated osteomyelitis and bacterial infection, and stimulates the healing process.2 Introducing the bioactive (such as growth factors,3 peptide,4 hydroxyapatide,5 calcium phosphate6) and antibacterial (antibiotics, inorganic particles, peptides, etc.) elements into implants materials is the preferred approach to provide the desired biofunctions.7,8 However, the currently functionalized materials have some technical drawbacks. To meet the requirement of tissue integration, controllable release of the bioactive elements, spatially as well as temporally, in a long term without losing the bioactivity is highly desired.3,8 The antibiotics are efficient on sterilizing bacteria, but the systemic injection is required and excessive use of antibiotics might lead to antibiotics resistance of bacteria.9 Although high dosage of metal nanoparticles is effective against bacteria, the released dosage has to be precisely controlled to assist the osteogenesis,10 and overdose usage would lead to lethal effects on normal cellular functions.11 Therefore, exploring new materials to fabricate such dual functional coating is highly desired. Graphene oxide (GO) is a novel two-dimension carbon material with a thickness at the atomic scale. Its high content of hydrophilic groups provides a good dispersity and stability.12,13 It has been reported that GO could accelerate the adhesion, growth, differentiation of marrow stem cells (MSCs),14 neural stem cells (NSCs),13 and induced pluripotent stem cells (iPSCs) into various tissue linage.15 In addition, GO has been known to possess a remarkable antibacterial ability against both Gram-negative and Gram-positive bacteria.16 Unfortunately, the cytotoxicity at GO high concentrations has limited its applications.17 Although decreasing the concentration of GO can reduce the cytotoxicity, the low efficiency on sterilizing bacteria at non-cytotoxicity concentration is a big concern.18 Rearranging the orientation of GO sheets, behaving as nano-knifes (sharp nano-edge of graphene), can reinforce the antibacterial ability, but the non-specific shearing could destroy the cellular membrane too and damage the mammalian 3


Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

cells.19 Biomedical applications of GO should be well balanced among bioactivity, biotoxicity and antibacterial ability.20 Ultrathin coating, around several ten nanometers thickness, seems to be a feasible strategy to reduce the GO’s cytotoxicity since very few GO is enough, much lower than the cytotoxic concentration, to generate the ultrathin film. In addition, the coated ultrathin film have no influence on property of the implanted bulk material but very effective on changing the interface phenomena, such as wettability, biocompatibility as well as antibacterial profile.21 However, very limited ability of GO to attach onto the implant materials gives rise to the issue of how to fabricate GO coating with a long term stability, especially under physiological conditions. Therefore, a facile method to fix these issues and control the GO deposition in nanometer scale is requisite. Layer-by-layer (LBL) assembly method, developed by Decher in 1990s,22 has attracted tremendous interest due to its technical advantages. The LBL assembly process can be implemented using low-cost equipments and under mild conditions. The components of these layers include a wide range of chemical or biological molecules.23 In addition, the LBL films have a long term physical stability as well as biological stability. Furthermore, the thickness of the LBL film can be controlled precisely at the nanometer scale, and these LBL assembly can be accomplished on almost any types of substrates and on any shapes of substrates (such as planes,24 spheres25 and nanoparticles26). Most importantly, any types of bioactive materials can be assembled on the substrates without interfering with the bioactivities of other incorporated components.27,28 Lysozyme, as an hydrolytic enzyme, is able to cleave the β-(1,4)-glycosidic bond between N-acetylmuramic acid and N-acetylglucosamine in peptidoglycan which is the major component of the bacterial wall, demonstrating a strong anti-microbial capability.29 Its contribution to antibacterial defense in animals has been widely recognized for 80 years and it has been used as a preservative in food products and pharmaceuticals.30,31 Lysozyme has a good biocompatibility due to its specific mechanism against bacteria. In the current study, we designed an experiment to fabricate ultrathin GO/Lys coating with thickness in several ten nanometers scale using LBL assembly technique. Lysozyme molecules act as biological glue to stick GO sheets together to form the GO/Lys film. Thus, the alternative GO/Lys layers are expected to provide dual functions of osteogenesis and antibacterium. Physical properties (thickness, secondary structure, roughness, stiffness) of this GO/Lys film have been 4


Page 4 of 27

Page 5 of 27 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

characterized using ellipsometry, UV-Vis spectroscopy, circle dichroism (CD) spectroscopy, and AFM. The antibacterial activity of Lys as well as the osteogenesis of GO of this film have also been assessed using methods of immunocytochemistry, molecular biology, antibacterial test. Experimental results demonstrate that the GO/Lys assembly film demonstrates indeed the antibacterial capability and osteogenetic ability. The current study have paved the way to fabricate a film of dual functions and will shed the light on the future applications of GO in the biomedical field. 2 Experimental section. Materials. Lysozyme (catalog number 62970) from chicken egg white (100,000 units/mg), Chitosan (Mw ~ 100 k), phalloidin-FITC and 4’,6-diamidino-2-phenylindole (DAPI) were purchased from Sigma-Aldrich Co. (St. Louis, US). GO was purchased from XFNANO Material Tech Co. (Nanjing, China). 4% paraformaldehyde, Triton X-100, and Alizarin Red S were purchased from Solarbio Science & Technology Co. (Beijing, China). Sulfuric acid (95-98%), hydrogen peroxide (≥30%), sodium hydroxide (>99.8%), and hydrochloric acid (36-38%) were ordered from Zhongxing Chem. Co. (Hangzhou, China). Tris(hydroxymethyl) aminomethane hydrochloride (Tris-HCl, ≥99%) and 2-[Bis(2-hydroxyethyl) amino] -2-(hydroxymethyl) -1,3-propanediol hydrochloride (Bis Tris-HCl, 98%) were bought from Aladdin Industrial Co. (Shanghai, China). All chemicals were used without further purification. Silicon wafers (SSP, p-type doping, supplied by Wafer Works (Shanghai, China)), quartz plates (Alfa Aesar, (Ward Hill, US)), 14 mm round glass coverslips (NEST, Wuxi, China) were cleaned by piranha solution (70% H2SO4 and 30% H2O2, v/v) at 80 °C for 1 h, followed by rinsing with Milli-Q water and subsequently dried under a mild stream of purified nitrogen gas. Deionized water used here was purified through a Milli-Q system with a resistivity greater than 18 MΩ·cm. Preparation of (GO/Lys)n thin films. First, a layer of chitosan was deposited onto the surface as a precursor by dipping the substrate (silicon slide, quarts sheet, or glass slip) into chitosan solution (1 mg/mL) for 10 min. The substrate was subsequently dipped alternately in 1 mg/mL GO solution for 10 min and 1 mg/mL Lys solution for 10 min. The substrate was rinsed with corresponding buffer solution after each dipping. The dipping step could be repeated N times and the multilayer film was referred to as (GO/Lys)n. To examine the effect of pH values, the assembly process of (GO/Lys)n film was also conducted in solutions at different pH values (pH= 4.5, 5.5, 6.5, 7.5, 8.5), mixture of 10 mM Bis Tris-HCl and 10 mM Tris-HCl was added into GO 5


Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

and Lys solutions to control the pH value without changing other conditions during the assembly procedure, and the films were noted as (GO/Lys)n-pH. The pH value was adjusted using 1M NaOH and 1M HCl, respectively. Cell isolation and proliferation. Human dental pulp mesenchymal stem cells (DPSCs) were isolated from the pulp of human exfoliated deciduous teeth. The growth medium was prepared by addition of 100 U/mL penicillin, 100 mg/mL streptomycin and 10% FBS (Gibco, Thermo Fisher Scientific) into MEN-α medium (Gibco). The cells were cultured in a 5% CO2 incubator at 37 °C. Non-adherent cells were removed 2 days later, and fresh growth medium was added. The stem cells were passaged upon almost confluence. Stem cell seeding. After sterilization, the 14 glass slips with a (GO/Lys)n film were transferred into 24-well plates, and then DPSCs were seeded in each well with a density of 5000/mL. After 2 h of incubation, the non-adherent cells were removed, and the fresh medium was added into the wells. After cell culture on the glasses for 1, 3, 7 and 14 days, the CCK-8 assay (Dojindo Molecular Technologies, Inc., Kumamoto, Japan) was used to quantify the total cell viability according to the manufacturer’s instruction. Immunocytochemistry observation. DPSCs on glasses were rinsed carefully with PBS buffer solution after 7-day and 14-day incubation in growth medium. Then 4% paraformaldehyde was used to fix cells. After washing the glasses with PBS three times (5 min each wash), the cells were permeabilized with 0.1% Triton X-100 in PBS for 5 min, and the microfilaments were labeled with 1 mg/mL of phalloidin-TRITC (Sigma-Aldrich) for 15 min. The cells were treated with 2 mg/mL of DAPI (Sigma-Aldrich) for 5 min to stain cell nuclei, and finally all the stained samples were rinsed with deionized water thoroughly. Cell images were recorded on an inverted fluorescence microscope (Leica DMi8, Leica Microsystems Inc., Buffalo Grove, US). Alkaline phosphatase (ALP) activity of DPSCs. To assess the osteoblastic differentiation of DPSCs grown on the glasses, the ALP activity was measured on days 7 and 14. Three samples at each time point were prepared for DNA quantification measurements. The cells were lysed via sonication for 45 minutes at room temperature in 1 mL of 0.02 wt% Triton X-100 (Bio-Rad, US) solution in DNA-free H2O. Double stranded DNA in the cell lysates was quantified via fluorescent assay using Quanti-iT™ PicoGreen® dsDNA Assay Kit (Invitrogen Corp., Carlsbad, US). The same lysate solutions were used to determine alkaline phosphatase activity via the ALP activity kit (Beyotime Institute of Biotechnology, Shanghai, China) according to the

6


Page 6 of 27

Page 7 of 27 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

manufacturer’s instructions. ALP activity values were normalized to the corresponding sample-specific dsDNA values. Real-time

polymerase

chain

reaction

(RT-PCR).

The

expression

levels

of

the

osteogenic-related genes: runt-related transcription factor 2 (RUNX2), alkaline phosphatase (ALP), osteonectin (ON), osteocalcin (OCN) and osteopontin (OPN), were measured using qRT-PCR. Total RNAs of stem cells on (GO/Lys)n thin film after 7 days incubation in the co-induction medium were extracted using the TRIzol Reagent (Invitrogen Corp.). The RNA purity was determined on NanoDrop 2000 (Thermo Scientific) and the complementary DNA (cDNA) was reversely transcribed from RNA using PrimeScript RT reagent kit (Takara Bio Inc., Kusatsu, Japan). Quantitative PCR was conducted in a total volume of 20 μL with corresponding primers (Table 1) and SYBR Green PCR Kit (Takara Bio Inc.). Data were analyzed using the 2-△△Ct method, and β-actin was chosen as the internal standard. The results were normalized by the mean values of the corresponding control groups. Table 1 Primer sequences used for PCR experiments of targeted genes ON OCN OPN ALP β-actin

forward TCGGCATCAAGCAGAAGGATA reverse CCAGGCAGAACAACAAACCAT forward GTGACGAGTTGGCTGACC reverse TGGAGAGGAGCAGAACTGG forward CTCCATTGACTCGAACGACTC reverse CAGGTCTGCGAAACTTCTTAGAT forward GTATCGGCAGCAGTCAGCAGTG reverse TCCAGGCAGGCGGCGAAG forward CATGTACGTTGCTATCCAGGC reverse CTCCTTAATGTCACGCACGAT

Antibacterial test. Bacteria (S. aureus (ATCC #6538) and E. coli (ATCC #8739)) in the mid-exponential growth phase were harvested by centrifugation and then resuspended in PBS solutions to a final concentration of 1×108 number in 10 mL solution. 1 mL bacteria solution was added onto blank silicon slide or (GO/Lys)n films at the bottom of each well of 24-well plates. The suspensions were incubated for additional 6 h at 37 °C, washed three times with PBS solution, and prefixed with 4% paraformaldehyde (PFA) for 15 min. The substrates were subsequently washed three times with PBS solution and dried under vacuum for 12 h before measurements. 7


Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Instruments, data processing and statistical analysis. Protein conformation was run on CD spectroscopy (Chirascan Plus qCD, Applied Photophysics Ltd., England) and the composition of secondary structure was generated from simulation with the affiliated CDDN software. Surface morphology was observed with AFM (Dimension Icon, Bruker) under tapping mode. Surface roughness was quantified by the average roughness (Ra) parameter from the topographical images, calculated by the affiliated software. For stiffness test, all scans were performed in a PeakForce Quantiative Nanoscale Mechanical Characterization (PeakForce QNM) mode. Elastic modulus was obtained from the force distance curves using the Derjaguin–Muller–Toporov (DMT) model.32 CLSM (A1, Nikon) and fluorescence microscope (DMi8, Leica) with live cell workstation were used for cell observation. Bacterial morphology was observed with FESEM (SU8010, HITACHI). Microplate reader (Varioskan LUX, Thermo Scientific), ellipsometer (M-2000U, J.A. Woollam), stereoscopic microscope (SMZ800N, Nikon) and inverted fluorescence microscope (Axio Vert.A1, ZEISS) were used. The UV-Vis absorption was observed by Lambda 25 spectrophotometer from PerkinElmer. FTIR spectra were obtained on a Bruker Vertex 70 FTIR spectrometer equipped with a DTGS detector. All quantitative data were statistically analyzed using t-test. P < 0.05 was considered statistically significant, noted as “*”; P < 0.01, noted as “**”; no significant, noted as “NS”. Results were presented as mean standard deviation. 3 Results and Discussion Fabrication of (GO/Lys)n film. Fabricating (GO/Lys)n film is schematically illustrated in Figure 1a. Step (1) a layer of chitosan was first formed on substrate; step (2) a layer of GO and step (3) a layer of Lys were formed, respectively; and step (4) the mutliple layer formation of (GO/Lys)n was assmebled by repeating steps (2) and (3) with a desired number. The fabrication processes were also carried out at different pH values, and these processes were monitored by ellipsometry measurement.

8


Page 8 of 27

Page 9 of 27 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

Figure 1. (a) Schematically illustrating (GO/Lys)n fabrication: (1) chitosan was deposited on substrate first, following by deposition of (2) GO and (3) Lys, (4) repeating (2) and (3) with desired number. (b) The thickness deposited at various pH values plotted as function of number of bilayers. (c) The thickness of (GO/Lys)8-8.5 plotted as function of incubated time in PBS at 37 0C.

Figure 1b shows the thickness of the assembled multilayer films. As displayed, the thickness of the (GO/Lys)n film is strongly depedent on the number of bilayers in the linear growth mode: the more layers, the thicker the film. Figure 1b also shows that the thickness of the (GO/Lys)n film is strongly depedent on the pH values of the solution. The assembled film with the same number layers is thicker at a higher pH value than that at lower ones. Many interactions between GO and Lys may contribute to thus alternative deposition, such as electrostatic interaction, hydrophobic-hydrophobic interaction, stacking interaction, and van der Waals interaction. Considering the fact that the isoelectric point of Lys is around 11.2, Lys is positively charged at all deposited pH. While the GO is negatively charged due to its richness in carbonoxyl and hydroxyl groups, the charge of GO increased with the increase of pH. It is reasonable to attribute the deposition of (GO/Lys)n films to electrostatic interaction, supporting from the strong dependence of increased thickness with the increase of deposited pH values. Lysozyme is rich in lysine and arginine residues, the positive charge density decreases with the increase of pH value. However, it seems contrary to the increased deposited thickness. In fact, it has been reported that the positive charge distribution could shift from the side to the edge of lysozyme with the increase of pH value.33 Therefore, the deposited Lys is apt to adopt a edge-on conformation at a high pH and the side-on conformation at a low pH.33 The global conformations of Lys is an elliptic shape of 4.5×3.0×3.0 nm3. The average thickness of each bilayer deposited at pH=8.5 is around 5 nm, close to the thickness of Lys with edge-on conformation (4.5 nm) and a single layer of GO (0.34 nm). Judging from the thickness data, it is impossible to imagine the sandwich structure of (GO/Lys) deposited at pH=8.5, where the Lys with edge-on conformation was sandwiched between the layers of single lying down GO. At pH=4.5, the average thickness of each deposited bilayer is about 1.1 nm which is much smaller than the smallest dimension of Lys with side-on conformation (3 nm), indicating that lysozymes are not fully covered entire area of each layer of GO at each deposition. For the film deposited at pH=4.5-8.5, Lys might adopt a mixed conformation of side-on and edge-on on the GO layer. Therefore, the adopted conformation of Lys is a key factor on the thickness. The long-term stability is critical for the 9


Langmuir

implant coating, scince several weeks are the average treatment period needed for implants to integrate with the surrounding tissues. As tested, by immersing (GO/Lys)8-8.5 into PBS for different time incubated in at 37 0C addition, the thickness of (GO/Lys)8-8.5 does not decrease for as long as 4 weeks (Figure 1c). Thus, the fabrication condition at pH 8.5 is proposed to be used for fabricating (GO/Lys)n film in the following study. (a)

(b)

Lys solution GO solution (GO/Lys)5-8.5

230 nm

(GO/Lys)4-8.5

230 nm

321 nm

0.2

(GO/Lys)5-8.5

0.4

Absorbance

Absorbance

0.4

(GO/Lys)3-8.5 (GO/Lys)2-8.5 (GO/Lys)1-8.5

321 nm 0.2

280 nm

0.0 200

250

300

350

400

450

Wavelength (nm)

500

550

(c)

600

0.0 200

(d)

250

300

350

400

450

500

Wavelength (nm) -1

1658 cm

-1

1530 cm

550

600

(GO/Lys) films GO Lys -1

1050 cm

Absorbance

Absorbance at 230 nm

Absorbance

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 10 of 27

0.2

0.0

0

1

2

3

4

2000

5

1800

1600

1400

1200

-1

1000

800

600

Wavenumber (cm )

Number of bilayers

Figure 2. UV-Vis spectra of (a) GO solution (0.05 mg/mL), Lys solution (0.1 mg/mL) and (GO/Lys)5-8.5 film, and (b) (GO/Lys)n-8.5, n=1-5. (c) Absorbance at 230 nm of (GO/Lys)5-8.5 in (b) is plotted against the number of bilayers. (d) FTIR spectra of Lys (bottom), GO (middle) and (GO/Lys) films (top).

Component analysis of (GO/Lys)n film. For probing the composition of the (GO/Lys)n-8.5, the UV-Vis spectroscopy was employed. As shown in Figure 2a, the characteristic absorbance peaks of GO at 230 nm and Lys at 280 nm are both clearly observed in their respective spectra. But, in the films, the peak at 280 nm attributed to Lys is hardly found due to the coverage by the wide absorbance from GO around 300 nm. The newly appeared peak around 321 nm might be ascribed to the shift of GO absorbance, caused by Lys adsortion onto GO or complex with GO.34 Although 10


Page 11 of 27

the evidence of the adsorbed Lys is hardly found in UV-vis, the successive growth of (GO/Lys)n-8.5 can be further proved by recording UV-Vis spectra of (GO/Lys)n-8.5, n=1-5 (Figure 2b). The absorbance at 230 nm and 321 nm are clearly observed for all of these films (GO/Lys)n-8.5, and the intensity increases with the number of bilayers increasing.. In order to further confirm the role of Lys during the formation of (GO/Lys)n films, a control experiment, alternatively immersing the substrate into GO and buffer solution without Lys, was carried out. No continuous growth absorbance of GO is observed, further demonstrating the Lys is sticky between two GO layers like a glue to support the further growth of (GO/Lys)n. The absorbance at 230 nm exhibits a linear growth with the number of bilayers (Figure 2c), indicating the distribution of both GO and Lys are homogenous in the vertical direction of (GO/Lys)n-8.5 film. In order to further detect the existance of Lys in the (GO/Lys) films, FTIR was employed since it is very sensitive to amide groups of protein (Lys). After scratching the (GO/Lys) films off the substrates, the spectra of Lys, GO and (GO/Lys) films were recorded. In Figure 2d, the absorbance peaks at 1658 cm-1 and 1530 cm-1, are assigned to the amide I and amide II in Lys respectively, while the absorbance peak at 1050 cm-1 is attributed to C-O group in GO. In the spectrum of (GO/Lys) films (Figure 2d, top), all of these three characteristic absorbance peaks could be observed. It’s a good suggestion that the (GO/Lys) films are composed of Lys and GO.

(a) 1

Lys in solution Lys in film

(b)40

Lys in solution Lys in film

0

Percentage (%)

Ellipcity (mdeg)

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

-1 -2

30

20

10

-3 0

190

200

210

220

230

Wavelength (nm)

240

250

 H

elix Sheet

  Tu

rn

om Rand

Figure 3. (a) CD spectra of Lys in solution (0.1 mg/mL) and in (GO/Lys)4-8.5film. (b) Compositions of secondary structure of Lys in solution (0.1 mg/mL) and in (GO/Lys)4-8.5 film.

Conformation determination of Lys in (GO/Lys)n film. The native structures of proteins are extremely important to their biological functions. Lys is a globular, monomeric and relatively small protein with a molecular weight of 14.3 KDa. It has two domains: a β-domain consisting of 11


Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

abundant β-stands and an α-domain consisting of several α-helices.35 Circular dichroism (CD) spectroscopy was used to assess the secondary structure of Lys in (GO/Lys)4-8.5 film. In Figure 3a, the negative peaks at 208 nm and 222 nm and the positive peak at 192 nm are assigned to the α-helix structure, and the negative peak around 215 nm is the characteristic of the β-sheet structure.36 After Lys deposition onto the film, both the shapes and positions of these peaks exhibit a great change in CD spectrum. Compared with that of Lys in solution, all of these peaks shift to lower wavelength, and the negative peaks exhibit the intensity increase, suggesting different secondary structures of Lys in the assembled state. Using simulation software, the conformation compositions of Lys in film and solution are obtained (Figure 3b). In comparison with that of Lys in solution, the global conformation does not exhibit significant changes in the film, but the random composition in the film decreases about 7%. Analysis of the secondary structures suggests that Lys in the assembled state of the (GO/Lys)4-8.5 film maintains its original structure during the assembling process. Lys has 129 amino acid residues, containing 18 basic residues and 8 cysteine residues. Four intra-molecular disulfide bonds are formed between cysteine polypeptide sequences to stabilize its folded conformations, i.e. the α-domain and β-domain.35 In most cases, conformations of disulfide-intact Lys are highly folded (native Lys), while those of disulfide-reduced Lys are unfolded (denatured Lys). When deposited onto nanostructured particles or two-dimensional plates, the native conformations and activities of Lys can be well retained.37,38 However, there is some debate concerning the effects of graphene-related materials on the protein conformation. Some studies have shown that the structure and functions of proteins undergo significant changes when interacting with graphene materials. It is attributed to the hydrophobic interaction between hydrophobic amino acid residues of proteins and aromatic rings of graphene.39-44 Baweja et al. have reported the preservation of α-helical structure of proteins in the presence of GO by computer simulation and experiment results. They claimed that it is due to extensive hydration of GO and absence of π-πstacking interactions between Tyr residues and GO.45,46 Some researchers have shown that the interaction of graphene with proteins depends on functionalization of graphene sheets. GO-COOH shows a limited impact on the conformation of proteins, while GO-NH2 significantly alters the conformation and functions of proteins.47 Moreover, the accessibility of protein to GO surface is another critical factor in determining the degree of conformational changes of proteins, as concluded in a recent report.39 In the case of (GO/Lys)n assembly in our work, the reducibility of GO is not strong enough to break up disulfide bonds of Lys. Therefore, Lys tends to preserve its 12


Page 12 of 27

Page 13 of 27

conformation in the (GO/Lys)n film. Furthermore, under the above-mentioned fabrication conditions, GO lies down on substrates and Lys is assumed to deposit onto GO with an “edge on” conformation. The side chains of some amino acid residues of Lys are largely restricted to contacting the surface of GO due to the space hindrance. Consequently, the secondary structures of Lys in the (GO/Lys)n multilayer films are highly preserved in comparison to those of native Lys. (a2)

25 nm Rough ness (nm)

(a1)

-25 nm

(c1)

(c2)

25 Mpa Modulus (MPa)

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

6

(b)

4

2

0

(GO/Lys)3.5-8.5

(GO/Lys)4-8.5

(GO/Lys)3.5-8.5

(GO/Lys)4-8.5

(d) 8 7 6 5 4

-25 Mpa

Figure 4. (a) AFM images of (a1) (GO/Lys)3.5-8.5 and (a2) (GO/Lys)4-8.5 films and corresponding (b) surface roughness calculated from AFM images. (c) DMT modulus images of (c1) (GO/Lys)3.5-8.5 and (c2) (GO/Lys)4-8.5 films and corresponding (d) surface modulus calculated from DMT images. The scale bars in (a) and (c) are 1 μm.

Morphologic characterization of (GO/Lys)n film. It has been reported the physical properties (morphology, roughness, stiffness and wettability) of biomedical materials play a very critical role on cell attachment, proliferation and differentiation.48-50 Various studies have demonstrated that a patterned or a rough surface could have a positive effect on cell behaviors, and the optimal roughness and distance between patterns could induce the differentiation of stem cell to osteogenesis.49,50 The stiffer substrate was apt to induce the stem cells to bone cells, while the softer substrate was likely to induce stem cells to neuron cells.51 Therefore, the physical properties of (GO/Lys)n-8.5 coatings were further well characterized before any cell experiment.

13


Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

The topographical images of the (GO/Lys)3.5-8.5 and (GO/Lys)4-8.5 films are measured with AFM (Figure 4a1-2). It shows that the films are rather homogeneous with presence of some irregular island-like domains at the scale of tens of nanometers, reflecting the sheet structure of GO. The irregular island-like domains disappear after the deposition of Lys, showing the fiber-like morphology (Figure 4a2), mainly dominated by the deposition of Lys. Obviously, the morphologies of (GO/Lys)n-8.5 are alternatively dominated by outmost deposited material. The roughness of (GO/Lys)3.5-8.5 and (GO/Lys)4-8.5 films were calculated by AFM software and plotted in Figure 4b. The (GO/Lys)4-8.5 film has a rougher surface than that of the (GO/Lys)3.5-8.5 film. The smoother surface (about 3.5 nm) indicates that deposited of GO is adopt to lie down onto the substrate rather than standing-up. The following deposited Lys increases the roughness to about 5.9 nm due to the formation of the fiber like morphology of Lys. The mechanical properties of the (GO/Lys)n-8.5 films were further studied by AFM in dry state, and Young’s modulus was derived from AFM mechanical tests. The DMT modulus images of the (GO/Lys)n-8.5 films and the corresponding mechanical modulus calculated using the affiliated software are shown in Figures 4c and 4d. The stiffness of film with the outmost deposition of GO is much smaller than that with the outmost deposition of Lys (Figure 4d), which could be attributed to the highly ordered structure of deposited Lys.52 The stiffness tested here is comparable to other polyelectrolyte multilayer films in previous reports.53,54 It should be also noted that the PeakForce QNM of AFM technique is based on the control of the maximum normal mechanical probing of the films, which cannot detect the creep modulus (or long-term elastic modulus). In addition, there may be change in the secondary structure of Lys during the drying process, which may contribute to the change of elastic modulus as well.

14


Page 14 of 27

Page 15 of 27 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

Control

(GO/Lys)3.5-8.5

(GO/Lys)4-8.5

(a) S. aureus

(b) E. coli

Figure 5. SEM images of (a) S. aureus and (b) E. coli after exposure to control (silica wafer, left row), (GO/Lys)3.5-8.5 (middle row), and (GO/Lys)4-8.5 (right row).

Antibacterial function of (GO/Lys)n film. The antibacterial activity of the (GO/Lys)n film is examined. Two types of representative bacteria are chosen for testing: Gram-positive bacterium S. aureus, and Gram-negative bacterium E. coli. Both S. aureus and E. coli are non-specific to Lys or GO. The silicon slides with/without (GO/Lys)n coatings are exposed to freshly prepared bacterial solution for 6 h at 37 °C. (GO/Lys)n with different terminal layer were prepared and tested. The bacterial morphologies were recorded on SEM (Figure 5). In control, both bacteria (S. aureus and E. coli) appear round and intact, without visible abnormalities and tend to form clusters. While bacteria exposed to (GO/Lys)n films, Figure 5 demonstrates the collapsed and ruptured structure. For both S. aureus and E. coli, there are more intact bacteria on (GO/Lys)3.5-8.5 film than that on (GO/Lys)4-8.5 film. It is very difficult to find the intact bacteria on (GO/Lys)4-8.5 film, indicating that the (GO/Lys)4-8.5 film has stronger antibacterial ability. Although both GO and Lys of (GO/Lys)4-8.5 have antibacterial effect, they behave differently. Lysozyme implements the antibacterial function by cleaving the β-(1, 4)-glycosidic bond between N-acetylmuramic acid and N-acetylglucosamine in peptidoglycan, the major and unique component of the bacterial cell wall.29 GO lyses the bacteria by penetrating into the bacteria membrane using its sharp edge.19 Considering that the film is very stable, the antibacterial ability should be generated from the direct contact of GO and Lys with bacteria. Although GO has the antibacterial effect, the lie-down state of GO sheets adopted during deposition might reduce the 15


Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

antibacterial ability. In the case of Lys as the outmost layer, Lys is able to sterilize bacteria efficiently due to the native conformation of Lys in (GO/Lys)4-8.5 film. Cell proliferation capability of (GO/Lys)n film. Dental Pulp Stem Cells (DPSCs), marrow-like stem cells, can be isolated from different parts of teeth, and cultured in vitro.55 Compared with stem cells derived from other tissues, they are characterized by high proliferative capacity and multi-potential differentiation into various phenotype, such as osteogenesis, chondrogenesis, and adipogenesis.55 Most importantly, DPSCs are easy to collect without damaging the donor and invasive surgical procedures.20 We also evaluated whether the composite LBL films meet the basic requirements for the cell proliferation and osteogenic differentiation using DPSCs. To investigate the effect of the GO and Lys on cells adhesion and proliferation, the morphology of DPSCs cultured on the film at 7-day and 14-day was observed using actin microfilaments (red) and nuclei (blue) fluorescent staining. Figure 6 shows that, 7-days after seeding, the cytoskeleton and nuclear staining showed that (GO/Lys)3.5-8.5 was significantly different in comparison with other two groups in the number of DPSCs cultured on the different substrates. However, cells cultured on the (GO/Lys)4-8.5 film for 14 days presented more cells than that on (GO/Lys)3.5-8.5 and the control group, indicating that the film with Lys as outmost layer significantly stimulates cell proliferation, and cell number of all three groups increases gradually with the prolonged culture time. Moreover, we can see from the lager magnification diagram that the cell morphology spread well, which may be due to the Lys protein secretion adsorption capacity.

16


Page 16 of 27

Page 17 of 27 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

Figure 6. Evaluating the viability of DPSCs on (GO/Lys)3.5-8.5 and (GO/Lys)4-8.5 substrates and glass coverslips as control. A. Fluorescent images of actin cytoskeleton of DPSCs and stained with rhodamine phalloidin and B. Cell numbers at day 7 and day 14. Significant *p < 0.05, **p < 0.01.

Osteogenesis of (GO/Lys)n film. To evaluate the effects of (GO/Lys)3.5-8.5 and (GO/Lys)4-8.5 films on the osteogenic differentiation of re-seeded DPSCs, 14-day osteoinductive culture was involved in this experiment using cells cultured on glass coverslips as control. Alkaline phosphatase (ALP) activity, which is regarded as an early marker of osteoblast differentiation, was tested for different groups. Figure 7 shows that the ALP activities of DPSCs on different substrates at 7-day and 14-day. A significantly higher ALP activity was detected in cells cultured on the (GO/Lys)4-8.5 film than those on the (GO/Lys)3.5-8.5 film and control group (p < 0.01), suggesting that Lys can stimulate the osteoblastic phenotype including high ALP levels.

17


Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Figure 7. Evaluating the quantitative analysis on osteogenesis-related marker ALP activity, the osteogenic differentiation of DPSCs cultured for 7 and 14 days on the (GO/Lys)3.5-8.5 and (GO/Lys)4-8.5 substrates and glass coverslips as control. Significant **p < 0.01.

As shown in Figure 8, we then cultured the DPSCs for 7 days and 14 days to quantitatively analyze the expression of osteogenesis-related genes, ALP, OPN, ON and OCN. All the four genes have lower expression when cultured for 7 days, and there is no significant difference between three different groups. After 14 days of osteogenic differentiation, the (GO/Lys)4-8.5 film exhibits a higher expression of these four selected osteogenic genes than the other two groups. Moreover, it was noticed that the (GO/Lys)3.5-8.5 film showed more osteogenic differentiation than the control group. The results obtained here are in good agreement with the DPSCs show higher cell proliferation capability on (GO/Lys)4-8.5 substrate than on (GO/Lys)3.5-8.5, also reflecting that the cells on substrates with Lys as outmost layer have a more differentiated stage toward mature osteoblasts. It was proving the enhanced effect of Lys-based substrates on the cell proliferation and osteogenic differentiation of DPSCs.

18


Page 18 of 27

Page 19 of 27 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

Figure 8. Expressions of genes in relation to osteogenic differentiation for DPSCs being inductively cultured on the (GO/Lys)3.5-8.5 and (GO/Lys)4-8.5 substrates and glass coverslips as control: (a) ALP; (b) OPN; (c) ON; (d) OCN. Significant *p < 0.05, **p < 0.01.

Some previous reports have proven the osteoinduction of Lys and GO, individually. Tonye Briggs et al.56 studied protein release profile and stem cell commitment of the emulsion electrospun composite materials using lysozyme and ceramic material. They investigated the effect of the protein and the ceramic on the protein release and found that human mesenchymal stem cells (MSCs) cultured on polymer/ceramic scaffolds expressed higher levels of osteogenic markers. This study revealed that more lysozyme was released from polymer/ceramic scaffolds to promote osteoinduction and facilitate bone regeneration consequently. As many reports have reviewed that graphene oxide (GO) at the atomic scale provides reactive sites for functionalization because of its abundant functional groups and high surface area.57 Increasing evidence indicates that peculiar functional groups from GO play an important function in regulating cell behaviors.14,58,59 Additionally, many studies show that GO coated films having nanoridges can induce osteogenic differentiation of stem cells even osteogenic inducers are absent.60 However, there is no report on answering whether the GO/Lys composite materials would impact the adhesion or osteogenic differentiation of cells. Hence, we introduced a convenient process to build GO nanosheets and Lys ultrathin film. After the DPSCs were seeded 19


Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

sparsely onto the (GO/Lys)n films, judging from the result of cell proliferation and osteogenic differentiation, we considered that the nanotopography of the (GO/Lys)n film could regulate the cell behavior together by altering the ECM clustering, focal adhesions, and cytoskeletal organization of DPSCs, leading to further changes in the cell phenotype and cell differentiation process.

Conclusion As a summary, we demonstrated that fabricating a ultrathin multilayer film (GO/Lys)n as a potential implant coating material, where GO and Lys with respective functionality were integrated into the ultrathin film by LBL technique. The electrostatic interaction between GO and Lys mainly attributes the linear growth of multilayer film (GO/Lys)n, where lysozymes maintain their native structure in the (GO/Lys)n film. The physical properties (morphology, roughness and stiffness) of these films were strongly dependent on the outmost deposited layers. With GO as the outmost layer, the (GO/Lys)n appeared with sheet-like morphology, which was covered by fiber-like morphology, while Lys on the outmost layer would create the stiffer and rougher surface. Importantly, these ultrathin films displayed a very high efficiency on sterilizing bacteria, both Gram-positive bacterium S. aureus, and Gram-negative bacterium E. coli, as well as the enhanced osteogenic differentiation of DPSCs. With lysozyme as the outmost layer, the (GO/Lys)n films possess stronger antibacterial ability and higher osteogenic efficiency, through combing the strong bacterial property of Lys and osteogenic profile of GO. Thus, the LBL strategy demonstrated several technical advantages and would pave the way to fabricating dual functional surfaces and guide the design of the surface of implanted materials in the future. Acknowledgements. This work was supported by National Natural Science Foundation of China (81601079, 81601626) and startup funding from Wenzhou government (WIBEZD2014002-02, WIBEZD2014005-04). References (1) Moore, T.; Hau, W.; Yamazaki, H.; Dinkel, J. Evaluate Medtech: World Previes 2018, Outlook to 2024. Evaluate 2018, (7th Edition - September 2018).

20


Page 20 of 27

Page 21 of 27 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

(2) Norowski, P. A., Jr.; Bumgardner, J. D. Biomaterial and Antibiotic Strategies for Peri-implantitis: A Review. J. Biomed. Mater. Res., Part B, Appl. Biomater. 2009, 88B (2), 530-543. (3) Min, J.; Choi, K. Y.; Dreaden, E. C.; Padera, R. F.; Braatz, R. D.; Spector, M.; Hammond, P. T. Designer Dual Therapy Nanolayered Implant Coatings Eradicate Biofilms and Accelerate Bone Tissue Repair. ACS Nano 2016, 10 (4), 4441-4450. (4) Rammelt, S.; Illert, T.; Bierbaum, S.; Scharnweber, D.; Zwipp, H.; Schneiders, W. Coating of Titanium Implants with Collagen, Rgd Peptide and Chondroitin Sulfate. Biomaterials 2006, 27 (32), 5561-5571. (5) Ning, C.; Zhou, Y. Correlations between the In Vitro and In Vivo Bioactivity of the Ti/HA Composites Fabricated by a Powder Metallurgy Method. Acta Biomater. 2008, 4 (6), 1944-1952. (6) Inzana, J. A.; Olvera, D.; Fuller, S. M.; Kelly, J. P.; Graeve, O. A.; Schwarz, E. M.; Kates, S. L.; Awad, H. A. 3D Printing of Composite Calcium Phosphate and Collagen Scaffolds for Bone Regeneration. Biomaterials 2014, 35 (13), 4026-4034. (7) Zhou, W.; Jia, Z.; Xiong, P.; Yan, J.; Li, Y.; Li, M.; Cheng, Y.; Zheng, Y. Bioinspired and Biomimetic AgNPs/Gentamicin-Embedded Silk Fibroin Coatings for Robust Antibacterial and Osteogenetic Applications. ACS Appl. Mater. Interfaces 2017, 9 (31), 25830-25846. (8) Junker, R.; Dimakis, A.; Thoneick, M.; Jansen, J. A. Effects of Implant Surface Coatings and Composition on Bone Integration: A Systematic Review. Clin. Oral Impl. Res. 2009, 20 (Suppl. 4), 185-206. (9) Wang, B. L.; Liu, H. H.; Wang, Z. F.; Shi, S.; Nan, K. H.; Xu, Q. W.; Ye, Z.; Chen, H. A Self-Defensive Antibacterial Coating Acting through the Bacteria-Triggered Release of a Hydrophobic Antibiotic from Layer-by-Layer Films. J. Mater. Chem. B 2017, 5 (7), 1498-1506. (10) He, W.; Elkhooly, T. A.; Liu, X.; Cavallaro, A.; Taheri, S.; Vasilev, K.; Feng, Q. Silver Nanoparticle Based Coatings Enhance Adipogenesis Compared to Osteogenesis in Human Mesenchymal Stem Cells through Oxidative Stress. J. Mater. Chem. B. 2016, 4 (8), 1466-1479. 21


Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

(11) Pauksch, L.; Hartmann, S.; Rohnke, M.; Szalay, G.; Alt, V.; Schnettler, R.; Lips, K. S. Biocompatibility of Silver Nanoparticles and Silver Ions in Primary Human Mesenchymal Stem Cells and Osteoblasts. Acta Biomater. 2014, 10 (1), 439-449. (12) Loh, K. P.; Bao, Q. L.; Eda, G.; Chhowalla, M. Graphene Oxide as a Chemically Tunable Platform for Optical Applications. Nature Chem. 2010, 2 (12), 1015-1024. (13) Park, S. Y.; Park, J.; Sim, S. H.; Sung, M. G.; Kim, K. S.; Hong, B. H.; Hong, S. Enhanced Differentiation of Human Neural Stem Cells into Neurons on Graphene. Adv. Mater. 2011, 23 (36), H263-H267. (14) Nayak, T. R.; Andersen, H.; Makam, V. S.; Khaw, C.; Bae, S.; Xu, X. F.; Ee, P. L. R.; Ahn, J. H.; Hong, B. H.; Pastorin, G.; Ozyilmaz, B. Graphene for Controlled and Accelerated Osteogenic Differentiation of Human Mesenchymal Stem Cells. ACS Nano 2011, 5 (6), 4670-4678. (15) Chen, G. Y.; Pang, D. W. P.; Hwang, S. M.; Tuan, H. Y.; Hu, Y. C. A Graphene-Based Platform for Induced Pluripotent Stem Cells Culture and Differentiation. Biomaterials 2012, 33 (2), 418-427. (16) Akhavan, O.; Ghaderi, E. Toxicity of Graphene and Graphene Oxide Nanowalls against Bacteria. ACS Nano 2010, 4 (10), 5731-5736. (17) Zhang, Y. B.; Ali, S. F.; Dervishi, E.; Xu, Y.; Li, Z. R.; Casciano, D.; Biris, A. S. Cytotoxicity Effects of Graphene and Single-Wall Carbon Nanotubes in Neural Phaeochromocytoma-Derived PC12 Cells. ACS Nano 2010, 4 (6), 3181-3186. (18) Ji, H. W.; Sun, H. J.; Qu, X. G. Antibacterial Applications of Graphene-Based Nanomaterials: Recent Achievements and Challenges. Adv. Drug Deliv. Rev. 2016, 105, 176-189. (19) Liu, S. B.; Zeng, T. H.; Hofmann, M.; Burcombe, E.; Wei, J.; Jiang, R. R.; Kong, J.; Chen, Y. Antibacterial Activity of Graphite, Graphite Oxide, Graphene Oxide, and Reduced Graphene Oxide: Membrane and Oxidative Stress. ACS Nano 2011, 5 (9), 6971-6980. (20) Xiao, L.; Ide, R.; Saiki, C.; Kumazawa, Y.; Okamura, H. Human Dental Pulp Cells Differentiate toward Neuronal Cells and Promote Neuroregeneration in Adult Organotypic Hippocampal Slices In Vitro. Int. J. Mol. Sci. 2017, 18 (8), 1745. 22


Page 22 of 27

Page 23 of 27 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

(21) Borges, J.; Mano, J. F. Molecular Interactions Driving the Layer-by-Layer Assembly of Multilayers. Chem. Rev. 2014, 114 (18), 8883-8942. (22) Decher, G.; Hong, J.-D. Buildup of Ultrathin Multilayer Films by a Self-Assembly Process, 1 Consecutive Adsorption of Anionic and Cationic Bipolar Amphiphiles on Charged Surfaces. Makromol. Chem., Macromol. Symp. 1991, 46 (1), 321-327. (23) Decher, G.; Hong, J. D.; Schmitt, J. Buildup of Ultrathin Multilayer Films by a Self-Assembly Process: III. Consecutively Alternating Adsorption of Anionic and Cationic Polyelectrolytes on Charged Surfaces. Thin Solid Films 1992, 210-211, 831-835. (24) Zan, X.; Peng, B.; Hoagland, D. A.; Su, Z. Polyelectrolyte Uptake by PEMs: Impact of Salt Concentration. Polym. Chem. 2011, 2 (11), 2581-2589. (25) Qiu, H.; Lee, W. Y.; Sukhishvili, S. A. Layer-by-Layer Self-Assembly of Ceramic Particles for Coating Complex Shape Substrates. J. Am. Ceram. Soc. 2006, 89 (4), 1180-1187. (26) Schneider, G.; Decher, G. Functional Core/Shell Nanoparticles via Layer-by-Layer Assembly. Investigation of the Experimental Parameters for Controlling Particle Aggregation and for Enhancing Dispersion Stability. Langmuir 2008, 24 (5), 1778-1789. (27) Volodkin, D.; Skirtach, A.; Mohwald, H. LbL Films as Reservoirs for Bioactive Molecules. Adv. Polym. Sci. 2011, 240, 135-161. (28) Gentile, P.; Carmagnola, I.; Nardo, T.; Chiono, V. Layer-by-Layer Assembly for Biomedical Applications in the Last Decade. Nanotechnology 2015, 26 (42), 422001. (29) Yılmaz, M.; Bayramoǧlu, G.; Arıca, M. Y. Separation and Purification of Lysozyme by Reactive Green 19 Immobilised Membrane Affinity Chromatography. Food Chem. 2005, 89 (1), 11-18. (30) Callewaert, L.; Michiels, C. W. Lysozymes in the Animal Kingdom. J. Biosci. 2010, 35 (1), 127-160. (31) Juneja, V. K.; Dwivedi, H. P.; Yan, X. Novel Natural Food Antimicrobials. Annu. Rev. Food Sci. Technol. 2012, 3 (1), 381-403. (32) Derjaguin, B. V.; Muller, V. M.; Toporov, Y. P. Effect of Contact Deformations on the Adhesion of Particles. J. Colloid Interface Sci. 1975, 53 (2), 314-326.

23


Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

(33) Shi, P.; Qin, J.; Hu, J.; Bai, Y.; Zan, X. Insight into the Mechanism and Factors on Encapsulating Basic Model Protein, Lysozyme, into Heparin Doped CaCO3. Colloids and Surf. B, Biointerfaces 2019, 175, 184-194. (34) Li, S. H.; Mulloor, J. J.; Wang, L. Y.; Ji, Y. W.; Mulloor, C. J.; Micic, M.; Orbulescu, J.; Leblanc, R. M. Strong and Selective Adsorption of Lysozyme on Graphene Oxide. ACS Appl. Mater. Interfaces 2014, 6 (8), 5704-5712. (35) Diamond, R. Real-space Refinement of the Structure of Hen Egg-white Lysozyme. J. Mol. Biol. 1974, 82 (3), 371-391. (36) Kelly, S. M.; Price, N. C. The Use of Circular Dichroism in the Investigation of Protein Structure and Function. Curr. Protein Pept. Sc. 2000, 1 (4), 349-384. (37) Fan, H.; Zhao, D.; Li, Y.; Zhou, J. Lysozyme Orientation and Conformation on MoS2 Surface: Insights from Molecular Simulations. Biointerphases 2017, 12 (2), 02D416. (38) Tohidi Moghadam, T.; Ranjbar, B.; Khajeh, K. Conformation and Activity of Lysozyme on Binding to Two Types of Gold Nanorods: A Comparative Study. Int. J. Biol. Macromol. 2012, 51 (1-2), 91-96. (39) Bai, Y.; Ming, Z.; Cao, Y.; Feng, S.; Yang, H.; Chen, L.; Yang, S.-T. Influence of Graphene Oxide and Reduced Graphene Oxide on the Activity and Conformation of Lysozyme. Colloids and Surf. B, Biointerfaces 2017, 154, 96-103. (40) Wei, X.-L.; Ge, Z.-Q. Effect of Graphene Oxide on Conformation and Activity of Catalase. Carbon 2013, 60, 401-409. (41) Shao, Q.; Qian, Y.; Wu, P.; Zhang, H.; Cai, C. Graphene Oxide-Induced Conformation Changes of Glucose Oxidase Studied by Infrared Spectroscopy. Colloids and Surf. B, Biointerfaces 2013, 109, 115-120. (42) Feng, R.; Yu, Y.; Shen, C.; Jiao, Y.; Zhou, C. Impact of Graphene Oxide on the Structure and Function of Important Multiple Blood Components by a Dose-dependent Pattern. J. Biomed. Mater. Res., Part A 2015, 103 (6), 2006-2014. (43) Wu, C.; He, Q.; Zhu, A.; Yang, H.; Liu, Y. Probing the Protein Conformation and Adsorption Behaviors in Nanographene Oxide-Protein Complexes. J. Nanosci. Nanotechnol. 2014, 14 (3), 2591-2598. 24


Page 24 of 27

Page 25 of 27 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

(44) Wang, Y.; Zhu, Z.; Zhang, H.; Chen, J.; Tang, B.; Cao, J. Investigation on the Conformational Structure of Hemoglobin on Graphene Oxide. Mater. Chem. Phys. 2016, 182, 272-279. (45) Baweja, L.; Balamurugan, K.; Subramanian, V.; Dhawan, A. Hydration Patterns of Graphene-Based Nanomaterials (GBNMs) Play a Major Role in the Stability of a Helical Protein: A Molecular Dynamics Simulation Study. Langmuir 2013, 29 (46), 14230-14238. (46) Wu, X.; Yang, S.-T.; Wang, H.; Wang, L.; Hu, W.; Cao, A.; Liu, Y. Influences of the Size and Hydroxyl Number of Fullerenes/Fullerenols on Their Interactions with Proteins. J. Nanosci. Nanotechnol. 2010, 10 (10), 6298-6304. (47) Ding, Z.; Ma, H.; Chen, Y. Interaction of Graphene Oxide with Human Serum Albumin and Its Mechanism. RSC Adv. 2014, 4 (98), 55290-55295. (48) Zan, X.; Feng, S.; Balizan, E.; Lin, Y.; Wang, Q. Facile Method for Large Scale Alignment of One Dimensional Nanoparticles and Control over Myoblast Orientation and Differentiation. ACS Nano 2013, 7 (10), 8385-8396. (49) Zan, X. J.; Sitasuwan, P.; Feng, S.; Wang, Q. Effect of Roughness on in Situ Biomineralized CaP-Collagen Coating on the Osteogenesis of Mesenchymal Stem Cells. Langmuir 2016, 32 (7), 1808-1817. (50) Hotchkiss, K. M.; Reddy, G. B.; Hyzy, S. L.; Schwartz, Z.; Boyan, B. D.; Olivares-Navarrete, R. Titanium Surface Characteristics, Including Topography and Wettability, Alter Macrophage Activation. Acta Biomater. 2016, 31, 425-434. (51) Smith, L. R.; Cho, S.; Discher, D. E. Stem Cell Differentiation is Regulated by Extracellular Matrix Mechanics. Physiology 2018, 33 (1), 16-25. (52) Burnett, B. J.; Cole, L. M.; Durrance, S. T.; Xu, S. H. Analyzing the Self-Organizing Mechanism of Lysozyme Amyloid Fiber Formation. Biophys. J. 2010, 98 (3 Suppl. 1), 653A-653A. (53) Rani, A.; Oh, K. A.; Koo, H.; Lee, H. J.; Park, M. Multilayer Films of Cationic Graphene-Polyelectrolytes and Anionic Graphene-Polyelectrolytes Fabricated Using Layer-by-Layer Self-Assembly. Appl. Surf. Sci. 2011, 257 (11), 4982-4989.

25


Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

(54) Francius, G.; Hemmerle, J.; Ball, V.; Lavalle, P.; Picart, C.; Voegel, J. C.; Schaaf, P.; Senger, B. Stiffening of Soft Polyelectrolyte Architectures by Multilayer Capping Evidenced by Viscoelastic Analysis of AFM Indentation Measurements. J. Phys. Chem. C 2007, 111 (23), 8299-8306. (55) Luo, L. H.; He, Y.; Wang, X. Y.; Key, B.; Lee, B. H.; Li, H. Q.; Ye, Q. S. Potential Roles of Dental Pulp Stem Cells in Neural Regeneration and Repair. Stem Cells Int. 2018, 1731289. (56) Briggs, T.; Matos, J.; Collins, G.; Arinzeh, T. L. Evaluating Protein Incorporation and Release in Electrospun Composite Scaffolds for Bone Tissue Engineering Applications. J. Biomed. Mater. Res. A 2015, 103 (10), 3117-3127. (57) Sanchez, V. C.; Ashish, J.; Hurt, R. H.; Kane, A. B. Biological Interactions of Graphene-Family Nanomaterials: An Interdisciplinary Review. Chem. Res. Toxicol. 2012, 25 (1), 15-34. (58) Kostarelos, K.; Novoselov, K. S. Exploring the Interface of Graphene and Biology. Science 2014, 344 (6181), 261-263. (59) Akhavan, O.; Ghaderi, E.; Shahsavar, M. Graphene Nanogrids for Selective and Fast Osteogenic Differentiation of Human Mesenchymal Stem Cells. Carbon 2013, 59, 200-211. (60) Yang, M.; Shuai, Y.; Sunderland, K. S.; Mao, C. Ice-Templated Protein Nanoridges Induce Bone Tissue Formation. Adv. Funct. Mater. 2017, 27 (44), 1703726.

26


Page 26 of 27

Page 27 of 27 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

TOC

27


Graphene Oxide and Lysozyme Ultrathin Films with Strong

Recommend Documents