Article pubs.acs.org/est
Silver Nanoparticles Disrupt Wheat (Triticum aestivum L.) Growth in a Sand Matrix Christian O. Dimkpa,*,†,‡ Joan E. McLean,§ Nicole Martineau,† David W. Britt,‡ Richard Haverkamp,∥ and Anne J. Anderson†,‡ †
Department of Biology, Utah State University, Logan, Utah 84322, United States Department of Biological Engineering, Utah State University, Logan, Utah 84322, United States § Utah Water Research Laboratory, Utah State University, Logan, Utah 84322, United States ∥ School of Engineering and Advanced Technology, Massey University, Palmerston North 4442, New Zealand ‡
S Supporting Information *
ABSTRACT: Hydroponic plant growth studies indicate that silver nanoparticles (Ag NPs) are phytotoxic. In this work, the phytotoxicity of commercial Ag NPs (10 nm) was evaluated in a sand growth matrix. Both NPs and soluble Ag were recovered from water extracts of the sand after growth of plants challenged with the commercial product; the surface charge of the Ag NPs in this extract was slightly reduced compared to the stock NPs. The Ag NPs reduced the length of shoots and roots of wheat in a dose-dependent manner. Furthermore, 2.5 mg/kg of the NPs increased branching in the roots of wheat (Triticum aestivum L.), thereby affecting plant biomass. Micron-sized (bulk) Ag particles (2.5 mg/kg) as well as Ag ions (63 μg Ag/kg) equivalent to the amount of soluble Ag in planted sand with Ag NPs (2.5 mg/kg) did not affect plant growth compared to control. In contrast, higher levels of Ag ions (2.5 mg/kg) reduced plant growth to a similar extent as the Ag NPs. Accumulation of Ag was detected in the shoots, indicating an uptake and transport of the metal from the Ag NPs in the sand. Transmision electron microscopy indicated that Ag NPs were present in shoots of plants with roots exposed to the Ag NPs or high levels of Ag ions. Both of these treatments caused oxidative stress in roots, as indicated by accumulation of oxidized glutathione, and induced expression of a gene encoding a metallothionein involved in detoxification by metal ion sequestration. Our findings demonstrate the potential effects of environmental contamination by Ag NPs on the metabolism and growth of food crops in a solid matrix.
■
INTRODUCTION Silver (Ag) is a traditional antimicrobial agent of long use.1,2 The recent upsurge in nanotechnology has increased the use of Ag in the form of nanoparticles (NPs) as additives in many industrial, medical, and consumer products.3,4 However, the expanding use of Ag NPs in such varied applications may portend danger for the ecosystem, considering reports on the release into the environment of Ag NPs from different products, including paints, clothes, and washing machine liners.5−7 Ag NPs release Ag ions that contribute to their biological toxicity.8−13 Thus, Ag seeping from products, either as NPs or dissolved ions, has the potential to contaminate wastewater systems. Because sludge produced from wastewater treatment is often applied as a soil amendment, the NPs or ions could contaminate agricultural settings, with possible consequences on plant health, growth, and productivity.14,15 Despite these risks and the importance of plants in the food chain, investigations of the effects of Ag NPs on plant growth and development are limited. The available reports on the phytotoxicity of Ag NPs are based mainly on studies in hydroponic systems; few studies © 2012 American Chemical Society
investigated the phytotoxicity of metal-containing NPs in solid matrices such as sand or soil.14,16,17 Plant growth in hydroponics differs from growth in solid matrices. Root structure and the greater availability of solutes are two important differences. Furthermore, soil or sand chemical components might modify NP stability and transport than would components in a defined hydroponic system. Nevertheless, the hydroponic studies reveal that Ag NPs damage root cell membranes, impair cell division, and affect leaf transpiration, root elongation, and plant biomass. Seed germination also is affected. The plants studied include cucumber, rye grass, onion, rice, zucchini, and the aquatic plant, Lemna minor.12,18−23 Ag NPs associate with plant root surfaces12,22 and are transported into plant tissues.12,20 Intact Ag NPs are found within rice root cells.22 Roots and shoot tissues of different dicotyledonous plants form Ag NPs when challenged with Ag ions.24,25 Studies of Ag speciation in rye grass (Lolium Received: Revised: Accepted: Published: 1082
July 23, 2012 October 26, 2012 December 21, 2012 December 21, 2012 dx.doi.org/10.1021/es302973y | Environ. Sci. Technol. 2013, 47, 1082−1090
Environmental Science & Technology
Article
centrifuged at 10,000 g for 15 min and filtered through a 0.2 μm filter to remove bacteria before being stored frozen at −20 °C. The total organic carbon (TOC) content of the root exudates was determined by a standard TOC analytical method using a Phoenix 8000 UV-persulfate TOC Analyzer (TekmarDohrmann, OH, U.S.A.). Characterization of Ag NPs: Size Distribution, Atomic Force Microscopy Imaging, Surface Charge, and Dissolution in Sand. The size distribution of Ag NPs in water suspension, in root exudates, and in water extract from the sand was determined by dynamic light scattering (DLS) as described previously.35 Imaging of NPs (2.5 mg/L) suspended in water or in root wash was achieved with atomic force microscopy (AFM) using published procedures.9 Imaging of preparations of the root wash was performed as a control. To determine changes to the NPs during incubation in the sand microcosms, with and without plant growth, sand was extracted from the area around the root zones or the same site in the microcosm with unplanted sand and a suspension prepared with 40 g sand/10 mL sterile dd water. As another control, a water suspension of sand without amendment of Ag NPs was prepared. The mixtures were vigorously shaken by hand, and after overnight equilibration at room temperature, the upper aqueous layer was removed. Samples of this layer were dried for AFM imaging. Soluble Ag in the sand washes was determined after centrifugation for 30 min × 2 at 15,557 g to pellet organic debris and NPs.9 The supernatant was analyzed by ICP-MS for Ag following the U.S. Environmental Protection Agency (USEPA) Methods 6020. The surface charge (ζ-P) of the colloids visible in the aqueous fractions from the sand microcosms was determined using a Zeta Meter (Zeta Meter Inc., VA, USA).9,36 Ag Accumulation in Wheat Shoots. Shoots from 15 replicates of three independent growth studies for control, Ag NPs, bulk Ag, and Ag ions-treated plants were harvested, with care to avoid contamination from the growth matrix. Shoots from each treatment of the same study were pooled, dried, ground to powder and digested with concentrated nitric acid, and analyzed for their total Ag contents using ICP-MS. The structure of the Ag in the shoot was determined by transmission electron microscopy (TEM). Shoots were dipped in liquid nitrogen and freeze-dried. The plant material was fixed with 3% glutaraldehyde, 2% formaldehyde, and 0.1 M phosphate buffer at pH 7.2. There was no secondary fixing with osmium tetroxide. After a buffer wash, samples were dehydrated using an acetone series and set in Procure 812 epoxy resin. TEM sections were cut on a diamond knife mounted on Cu grids and imaged without staining. A Philips CM10 TEM was used with an acceleration voltage of 60 kV. Images were recorded with a SIS Morada high-resolution camera. Glutathione Oxidation in Roots of Ag NP-Treated Plants. The presence of oxidized glutathione (GSSG) in plant roots was detected using the GSSG-Glo Glutathione Assay kit (Promega, WI, U.S.A.). The procedure has been described in a previous study. 16 Detection of Transcripts from a Metallothionein Gene in Roots of Ag NP-Challenged Plants. Freshly harvested wheat roots (one g) were frozen in liquid nitrogen and ground in a chilled mortar and pestle. Total RNA was extracted from the ground roots according to the procedure described in the RNeasy Plant Mini Kit (QIAGEN Inc., Valencia, CA, U.S.A.). DNase treatment of RNA and first-strand cDNA synthesis were
multif lorum) tissues suggest that Ag NPs applied to the roots are transformed to other forms such as Ag2O and Ag2S.12 Recently, we reported that commercial Ag NPs are toxic to a soil bacterium in a sand matrix.26 The current study investigates the impact of commercial Ag NPs on wheat (Triticum aestivum L.) in sand. The effects on wheat growth and metabolism engendered by the Ag NPs were compared with responses to micrometer-size (bulk) Ag and Ag ion. The release of soluble Ag from the Ag NPs was determined in the presence and absence of plants. Ag ions supplied from AgNO3 was used at the concentration equal to release from the NPs as well as at a higher concentration to explore the role of ion release on plant growth and metabolism. The accumulation of oxidized glutathione (GSSG) in the plant roots was assessed as a measure of induced oxidative stress.27,28 Induction of a gene encoding the metal-sequestering protein metallothionein (MT)29−33 was determined in root tissues to understand whether a defense response was initiated by the plant. Wheat is one of the most important food crops globally, and accumulation of Ag from NPs into the plant could pose a route for metal-contamination of the food chain.34 Therefore, we determined the shoot accumulation and structure of Ag in shoots of plants grown with Ag NPs and Ag ions.
■
MATERIALS AND METHOD Sources of Ag Nanoparticles and Bulk Ag. Commercial Ag NPs of particle size 10 nm, a zeta potential (ζ-P) of −37 mV, and no surface coatings were obtained from ATTOSTAT Inc. (West Jordan, UT, U.S.A.). Bulk Ag (44,000 nm) and AgNO3 were obtained from Alfa Aesar (MA, USA). Sterile, distilled deionized (dd) water was used to dilute the Ag NP suspensions and to prepare stocks of bulk Ag and Ag salt. Concentrations of Ag were determined by ICP-MS analysis. Plant Growth Conditions. The sand matrix used for plant growth was characterized for water-soluble trace elements that may influence plant growth, for major cations and for organic and inorganic carbon content.16,26 Preparation of the growth boxes and plant growth conditions are as described previously.16 Prior to seeding with wheat, the sand was amended with different concentrations of the Ag NPs (0−5 mg/kg sand). For further mechanistic studies, one dose of the Ag NPs, 2.5 mg/kg, was selected and compared with the equivalent level of bulk Ag. To determine the role of soluble Ag, treatments consisting of 2.5 mg Ag/kg (designated high ion) and 63 μg Ag/kg (designated low ion) were applied. This low Ag ion level was the equivalent of the soluble Ag measured from dissolution of Ag NPs in sand in the presence of plants. Following harvest 14 days after planting, root and shoot length and number of roots originating from the stem base as well as dry shoot and root mass were recorded. Three independent growth studies were performed, each comprising of 3 plants per box for 5 boxes. Extraction of Wheat Root Exudates. Wheat seeds were surface sterilized with 10% H2O2 for 10 min and rinsed thoroughly with sterile dd water. The plants were grown for 7 d in sterilized moist vermiculite without NP challenge and watered with sterile 1 mM CaCl2 daily to maintain a moist growth mix with no standing water. Seedlings were removed carefully, and root portions were immersed into sterile water and shaken gently at 100 rpm for 15 min. The wash solution was filtered through a layer of cheesecloth and centrifuged at 10,000 g for 15 min. The supernatant was lyophilized to a powder before suspension in sterile water. The solution was 1083
dx.doi.org/10.1021/es302973y | Environ. Sci. Technol. 2013, 47, 1082−1090
Environmental Science & Technology
Article
Figure 1. (A) Dynamic light scattering (DLS) analysis of ATTOSTAT Ag NPs showing particle size distribution of the NPs in water suspensions prior to plant challenge. 3-Dimensional Atomic force microscopy (AFM) images showing heights of (B) stock Attostat Ag NPs, (C) Attostat Ag NPs in the aqueous fraction from sand after plant growth for 14 days, (D) aqueous fraction from unamended sand showing the presence of root exudates, (E) Ag NPs suspended in root exudates from wheat plants, and (F) root exudates with no NP additions. DLS data are representatives from three different measurements, while AFM are images typical of at least five different samples.
an average diameter of about 273 nm (Supporting Information, S1). Imaging of the water fraction from sand containing the control plants showed particles of similar size as the Ag NPs (Figure 1 D), demonstrating the exudation of nano- and submicrometer-sized materials from the plant. The pH of the stock Ag NPs suspended in water was 6.72. The aqueous fractions from the 14 d microcosms were at pH 7.92 for the NP unamended sand, pH 7.30 for the sand amended with Ag NPs without plant, and 7.96 in sand after plant growth. The colloids observed in the aqueous fraction from the control sand extract lacking Ag NPs had a negative surface charge of −12.6 ± 1.5 mV, while those recovered in the washes of sand containing Ag NPs but without plants had a ζ-P of −27.2 ± 4.9 mV, which was less negative, albeit insignificantly (p = 0.05), than those suspended in water, −34.4 ± 1.0 mV. When recovered from the microcosms containing plants, the ζ-P of the Ag NPs was −31.9 ± 1.3 mV. The highly negative ζ-P of the colloidal materials containing Ag NPs indicates a stabilization of the NPs in the sand matrix, with and without plant. Because plant roots secrete a mixture of metabolites38 and heavy metals stimulate the secretion of root exudates,39,40 we examined the effect of root exudates on NP stability. The wheat root exudates (pH 6.85) contained 2568 ± 278 mg/L of total organic carbon, and moderately polydisperse particulates of 3.8 nm, 25 and 195 nm average diameter sizes were observed by DLS analysis (Supporting Information, S2). When the NPs were suspended in the root exudate material, distinct particles with average diameters of 20.6 and 96 nm were present (Supporting Information S3), indicating that agglomeration of the NPs with the particulates present in the root exudates was minimal. AFM analysis of the root exudate-Ag NP mixture showed particles enmeshed in amorphous layer (Figure 1 E); such particles were absent in the imaging of the root exudates alone (Figure 1 F). The ζ-P of the root exudates-Ag NP mix was −35.8 ± 6.0 mV. To observe effects of plant growth on solubilization of Ag from the NPs, the Ag level in the aqueous fractions was determined from sand from microcosms with and without plant growth for 14 d. ICP-MS measurements (Table 1) showed that the extracted fraction from sand lacking Ag amendments had low background Ag values. The amendment with bulk Ag did
performed from the total RNA using a commercially available kit (Fermentas Life Sciences, E.U.). The gene specific primers used for standard PCR amplification were derived from the sequences of the wheat metallothionein (MT) gene (GenBank accession number AY688471.1).37 The forward and reverse primers were GTGCGGGTATGGATGTTTTT and GGGTTGCACTTGCAGTTGT, respectively. Expression from wheat actin gene (forward primer = GAAGGATATGCCCTTCCACA and reverse primer = TTGATCTTCATGCTGCTTGG) was used to normalize gene expression among the treatments. Conditions used for the PCR amplification consisted of an initial denaturation at 94 °C for 2 min, followed by 35 cycles of denaturation at 94 °C for 30 s, annealing at 60 °C for 40 s, and extension at 72 °C for 40 s. Final extension was performed at 72 °C for 10 min. The specificity of the primers was verified by their use in PCR with genomic DNA from wheat and sequencing the PCR products to confirm the identity of the genes being studied. PCR amplifications were replicated thrice, with RNA extracted from plants from three independent growth studies. Statistical Analysis. All errors are indicated as standard deviations (SD). Variations between treatments for the respective plant responses were tested using one-way ANOVA (OriginPro 8.5), followed by Tukey’s honestly significant difference (HSD) for differences that were significant at p = 0.05.
■
RESULTS Characterization of Ag NPs. Engineered NPs often become aggregated when suspended in different matrices. As indicated by DLS analysis (Figure 1 A), most of the Ag NPs aggregated in dd water to sizes greater than the manufacturerstated size (10 nm). A minor peak of particles, 7.4 nm diameter, and a major peak of 60.8 nm diameter particles were observed. AFM imaging (Figure 1 B) confirmed the agglomeration of the Ag NPs in water, although monodisperse particles with dimensions
