Heterotrophic Nitrifiers Dominate Reactors Treating Incineration

Subscriber access provided by WESTERN SYDNEY U

Article

Heterotrophic nitrifiers dominate reactors treating incineration leachate with high free ammonia concentrations Xinying Liu, Zhifei Shu, Dezhi Sun, Yan Dang, and Dawn Holmes ACS Sustainable Chem. Eng., Just Accepted Manuscript • DOI: 10.1021/ acssuschemeng.8b03512 • Publication Date (Web): 12 Oct 2018 Downloaded from http://pubs.acs.org on October 15, 2018

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 31 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Sustainable Chemistry & Engineering

Heterotrophic nitrifiers dominate reactors treating incineration leachate with high free ammonia concentrations Xinying Liu1,2, Zhifei Shu1, Dezhi Sun1*, Yan Dang2*, Dawn E Holmes3 1

Beijing Key Laboratory for Source Control Technology of Water Pollution, Engineering

Research Center for Water Pollution Source Control and Eco-remediation, Beijing Forestry University, 35 Tsinghua East Rd, Beijing, 100083, China 2

College of Environmental Science and Engineering, Beijing Forestry University, 35

Tsinghua East Rd, Beijing, 100083, China 3

Department of Physical and Biological Sciences, Western New England University, 1215

Wilbraham Rd, Springfield, MA 01119, United States

Corresponding author: *Dezhi Sun. Email: [email protected]; [email protected] *Yan Dang. Email: [email protected]; [email protected]

1

ACS Paragon Plus Environment

ACS Sustainable Chemistry & Engineering 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Abstract Anaerobically treated leachate from municipal solid waste incineration plants contains extremely high free ammonia (FA) concentrations, which can hinder short-cut nitrification. pH adjustments made during the nitrification process kept FA concentrations below 110 mg/L, enabling reactors to operate when total ammonia nitrogen (TAN) concentrations were 1400 mg/L. Multiple lines of evidence showed that nitrite accumulation in these systems could be attributed to ammonia oxidation by heterotrophic nitrifiers from the genus Paracoccus. For example, 1) all of the amoA (ammonia monooxygenase subunit A) transcripts clustered with Paracoccus; 2) nitrite accumulated when membrane-bound nitrate reductase (Nar) was inhibited with sodium azide; 3) periplasmic nitrate reductase (nap) genes were not being actively transcribed; and 4) trace concentrations of nitrate in reactors were not sufficient to support nitrate reduction. Paracoccus species were actively transcribing genes from nitrification (amoA) and denitrification (narG, norB, nirS, nosZ) pathways in these systems even when FA concentrations reached 184 mg/L. Little is known about the role that heterotrophic ammonia oxidizing bacteria (AOB) play in nitrogen cycling in reactor systems. Therefore, this study is significant because this is the first investigation into the metabolism of heterotrophic nitrifiers in nitrogen removal systems with elevated FA concentrations. Keywords: Incineration leachate; Free ammonia inhibition; Heterotrophic nitrifiers; Transcriptomics; Short-cut nitrification

2


Page 2 of 31

Page 3 of 31 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Introduction Incineration is an effective way to reduce the volume (by~90%) and mass (by~70%) of municipal solid waste (MSW) 1, which is particularly important in countries with limited landfill space like China. MSW has a high-moisture content and therefore needs to be dried in storage bunkers for 3-7 days prior to the incineration process. Unfortunately, an appreciable amount of leachate, which contains high concentrations of chemical oxygen demand (COD, usually>70 000 mg/L), biological oxygen demand (BOD5), ammonia nitrogen (NH4+-N) and metals (e.g., calcium), is generated during storage 2. Anaerobic digestion can be used to degrade organic compounds in the incineration leachate while generating desirable products like methane. However, ammonia is a by-product of the anaerobic digestion of proteins, urea and nucleic acids found in the leachate and their degradation can increase ammonia concentrations to levels as high as 1000~1800 mg/L 3. In addition, methanogens in the anaerobic digester consume hydrogen ions and electrons, which can lead to an increase in pH 4 and cause free ammonia (NH3, FA) concentrations to increase. Soluble nitrogen is a harmful pollutant that needs to be removed from wastewater before it can be released into the environment. Partial nitrification to nitrite followed by denitrification is a technically feasible and economically favorable way to remove nitrogen from wastewater 5. However, high FA concentrations like those found in anaerobically treated incineration leachate can inhibit microbial activity and significantly reduce nitrogen removal efficiencies

6-7.

In order to optimize nitrogen removal from wastewater with high

3



Page 4 of 31

ammonia concentrations, inhibitory effects of FA on microbial communities responsible for the nitrification process need to be thoroughly understood. FA inhibits microbial growth by penetrating cell membranes and causing proton imbalance, increasing maintenance energy requirements, changing intracellular pH and inhibiting specific enzyme reactions

8-9.

Previous studies examining the impact of elevated

FA concentrations on the nitrification process have focused on autotrophic nitrifiers

10-13,

however, this is the first investigation into the role that heterotrophic nitrifiers might be playing in these systems. In addition, while previous studies have examined inhibitory effects of FA on nitrite oxidizing bacteria (NOB) and ammonia oxidizing bacteria (AOB) during nitrogen removal from young landfill leachate

14-17,

this is the first report on the

effects of FA on short-cut nitrogen removal from anaerobically digested MSW incineration leachate. Unlike previous studies done with young leachate, high total ammonia nitrogen (TAN) and low dissolved oxygen (DO) concentrations associated with MSW incineration leachate favor growth of heterotrophic nitrifiers that are capable of growth under low oxygen conditions 18-19. Conventional biological nitrogen removal systems that rely on autotrophic nitrifiers for conversion of ammonia to nitrite require high dissolved oxygen concentrations and aeration can account for nearly half of the energy used in these systems

20.

Energy

consumption can be dramatically decreased in reactors that do not have such significant oxygen requirements such as those dominated by heterotrophic nitrifiers. Therefore, a better understanding of the role of heterotrophic nitrifiers should help with the development of more energy efficient nitrogen removal systems treating waste with high ammonia concentrations such as MSW incineration leachate. 4


Page 5 of 31 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


In this study, analytical and molecular techniques were used to optimize nitrogen removal in reactors treating MSW incineration leachate and to show that heterotrophic nitrifiers from the genus Paracoccus were primarily responsible for nitrification in these ammonia-rich sequencing batch reactor (SBR) systems. Transcriptomic studies identified which genes from the nitrification and denitrification pathways were being actively transcribed by Paracoccus, and the influence that elevated FA concentrations can have on expression of these genes.

Materials and methods Fresh leachate and feed solution. Effluent collected from a laboratory-scale expanded granular sludge bed (EGSB) reactor anaerobically treating MSW incineration leachate collected from an MSW incineration plant in Beijing, China

21

was used as the

feedstock solution for reactors in this study. Characteristics of the solution are provided in Table 1. Total alkalinity of the anaerobic effluent feedstock was 30-50% lower than what is needed for ammonia oxidation to occur. Therefore, it was necessary to add NaHCO3 to the reactors at the beginning of each operational cycle to supplement the alkalinity. Table 1 Characteristics of the feedstock solution used in this study

Item Feed solution (Anaerobicallytreated leachate)

COD (mg/L)

1980-3660

BOD5 (mg/L)

NH4+-N (mg/L)

850-2380

1140-1420

Total nitrogen (mg/L) 1200-1490

5


Total phosphorus (mg/L) 18-29

pH

8.05-8.55


Inoculation and partial nitrification SBR reactor setup. Two 7 L laboratoryscale SBRs (Φ16 cm × 35 cm) were inoculated with 5 L activated sludge collected from a wastewater treatment plant (WWTP) located in Beijing, China. The biomass concentration measured as mixed liquor suspended solids (MLSS) was 4.5~5.5 gMLSS/L with a volatile suspended solid (VSS)/suspended solids (SS) ratio of 0.70. SBRs were operated at 25±1oC. Each reactor was equipped with a mechanical stirrer and air diffuser to ensure complete mixing and aeration when needed. There were six phases in each operational cycle: filling, aerobic, anoxic, settling, withdraw and idle. Lengths of settling, withdraw, and filling were fixed at 10 min, 20 min and 10 min, respectively. Durations of aerobic and anoxic phases varied with DO and pH changes and were determined using methods described by Peng, et al. 22. Ratios of clarified supernatant to operation volume were maintained at 0.7~0.8 during the withdraw phase, and equal volumes of feedstock solution were pumped into the reactor during the filling phase. During the aerobic phase, DO concentrations were maintained at 0.5~1.0 mg/L using techniques described by Peng, et al. 22. Sodium acetate (2.0 M) was provided as an electron donor for denitrification during the anaerobic phase at concentrations consistent with a COD/N ratio of ~3.0. A sludge retention time of 12 to 15 days was used to maintain a constant biomass within the reactors of ~6.0 g MLSS/L. The duration of reactor operation could be divided into three periods. During Period 1 (days 0-60; cycles 1-19), the initial total ammonia nitrogen (TAN) concentration in the effluent feed-stock for both reactors was raised stepwise from 50 to 250 mg/L. Period 2 started once both reactors were operating stably (days 61-100; cycles 20-35) and initial

6


Page 6 of 31

Page 7 of 31 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


TAN concentrations continued to increase stepwise from 250 to 650 mg/L. During Period 3 (days 101-140; cycles 36-47), TAN concentrations were increased stepwise from 700 mg/L to 1400 mg/L. However, only Reactor 2 was operational at TAN concentrations > 700 mg/L because pH adjustments with 2.0 N HCl were made at the beginning of each operational cycle during Period 3.

Analytical methods. COD, BOD5, MLSS, and mixed liquor volatile suspended solids (MLVSS) were determined with standard methods

23.

Concentrations of various nitrogen

compounds were determined in accordance with standard methods

23.

The Nesslerization

method was used to measure NH4+-N at an absorbance of 425 nm, NO2--N was measured with a colorimetric method at an absorbance of 540 nm, and NO3--N was measured with an ultraviolet spectrophotometric method at an absorbance of 220 and 275 nm. A digital portable pH meter (Sartorius PB-10, Germany) was used to measure pH, and DO was measured with a digital portable DO meter (YSI, Model 55, USA). Free ammonia nitrogen (NH3) and free nitrous acid (FNA) were determined from NH4+-N or NO2--N, pH and temperature measurements using calculations from a previous study24. Hydroxylamine concentrations were measured as previously described 25. Ammonia conversion rates were determined by monitoring decreases in ammonia concentrations per hour.

7



Page 8 of 31

DNA extraction and sequence analysis. DNA was extracted from sludge samples collected from Reactor 1 during Cycles 30 and 38 and from Reactor 2 during Cycle 46 using an E.Z.N.A. Soil DNA Kit (OMEGA) according to the manufacturer’s instructions. DNA concentration and purity of each sample was then determined with a Nanodrop UV spectrophotometer (Thermo Fisher Scientific, Delaware). Bacterial 16S rRNA gene fragments were amplified via the polymerase chain reaction (PCR) with the primer set 515F/806R

26.

Amplicons were sequenced on a Illumina Hiseq

2000 platform (Illumia, San Diego, USA) by Allwegene Co., Ltd. (Beijing, China). Sequences were placed into various operational taxonomic units with Pyrosequencing Pipeline software (https://pyro.cme. msu.edu). Raw sequence files have been submitted to the NCBI Sequence Read Archive database under accession No. SAMN07244091 and No. SAMN07244092. The universal autotrophic ammonia monooxygenase primer set amoA-F (5’GGGGTTTCTACTGGTGGT-3’) / amoA-R (5’-CCCCTCKGSAAAGCCTTCTTC-3’)

27

was used to amplify autotrophic amoA transcripts and genes. Degenerate primers targeting the heterotrophic amoA gene were designed from alignments of genes from a diversity of bacteria including species from the following genera: Paracoccus, Pseudomonas, Arthrobacter,

Agrobacterium,

Alcaligenes,

Diaphorobacter,

Acinetobacter,

and

Comamonas. These nucleotide sequences were downloaded from the NCBI Genbank database (https://www.ncbi.nlm.nih.gov/genbank/) and aligned with Clustal X version 2 software

28.

Highly conserved regions were then selected for design of hetero-amo378f

(GTTGCAGGACATGCTGGTCTTCG) and 634r (CATCGGCCAAGGATCGAGGC).

8


Page 9 of 31 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


PCR products generated from DNA and cDNA with this primer set were purified with the Qiagen PCR Purification Kit (Qiagen, Valencia, CA), and ligated into the TOPO TA cloning vector (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. One hundred clones were selected and all plasmid inserts were sequenced and compared to the NCBI nucleotide database (http://blast.ncbi.nlm.nih.gov/) with the BLASTx algorithm 29.

mRNA extraction and quantitative RT-PCR. Total RNA was extracted from sludge samples as previously described

30.

In order to ensure that RNA samples were not

contaminated with DNA, PCR with primers targeting the 16S rRNA gene was conducted on RNA samples that had not undergone reverse transcription. cDNA was generated from all RNA samples (1 μg) with the TRUEscript 1st Strand cDNA Synthesis Kit (Aidlab Biotech, Beijing, China) according to the manufacturer’s instructions. Alignments of genes from nitrogen metabolism pathways and recA (recombinase A) in Paracoccus aminovorans, P. denitrificans, P. pantotrophus, P. versutus, strain N5, and P. yeei were used to design quantitative reverse transcription PCR (qRT-PCR). All qRT-PCR primers (Supplementary Table S1) were designed according to the manufacturer’s specifications (amplicon size 100-200 bp), and representative products from each of these primer sets were verified by sequencing. The housekeeping gene, recA, was used as a reference to normalize all qRT-PCR results. Quantitative PCR amplification and detection was performed with the 9500 Real Time System (Applied Biosystems) using either genomic DNA or cDNA made by reverse transcription. Each reaction mixture consisted of a total volume of 25 µl and contained 1.5

9



µl of the appropriate primers (stock concentration 1.5 µM), 5 ng template, and 12.5 µl Power SYBR Green PCR Master Mix (Applied Biosystems). Optimal thermal cycling parameters consisted of an activation step at 50°C for 2 minutes, an initial 10 minutes’ denaturation step at 95°C, and 50 cycles of 95°C for 15 sec and 60°C for 1 minute. Dissociation curves generated by increasing the temperature from 58 to 95°C at a ramp rate of 2% showed that the PCR amplification process yielded a single predominant peak for all primer sets, further supporting the specificity of the qRT-PCR primer pairs.

Results and Discussion SBR performance. Influent TAN concentrations were increased stepwise from 50 to 650 mg/L during Periods 1 and 2 (cycles 1-35) in both reactors (Figure 1). Ammonia removal efficiencies remained above 99% and nitrite ratios (NO2--N/NOx--N) were >90% indicating that the short-cut nitrification process was effective in both reactors at TAN concentrations as high as 650 mg/L even without pH adjustment. Nitrification was inhibited in Reactor 1 when TAN concentrations were increased to 700 mg/L during Period 3, likely due to the fact that FA concentrations increased over 200 mg/L (pH=8.6~8.8) (Figure 1A). The pH in Reactor 2 was adjusted with HCl (2.0 N) to the desired value in order to keep FA concentrations stable below 110 mg/L throughout Period 3 (Figure 1B). Conditions of low FA and neutral pH in Reactor 2 enabled the short-cut nitrification process to continue even when the reactor was fed leachate with TAN concentrations as high as 1400 mg/L (Figure 1B).

10


Page 10 of 31

Page 11 of 31 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(A)

(B) Figure 1 Concentrations of FA, NH4+-N, NO3--N, NO2--N and the nitrite ratio (NO2- N/NOx--N) detected in (A) Reactor 1 without pH adjustment and (B) Reactor 2 with pH adjustment.

Boundaries of FA inhibition on nitritation and nitratation. Concentrations of FA that permitted nitritation (oxidation of ammonia to nitrite) while inhibiting nitratation (oxidation of nitrite to nitrate) were determined during Period 1 (cycles 1-19) of the experiment. During this period, FA concentrations ranged from 1.5~5.5 mg/L, ammonia removal rates were >99%, and nitrite ratios were >95% in both reactors (Figure 1). These

11



results suggested that concentrations of FA up to 5.5 mg/L allowed ammonia oxidation to proceed but inhibited the activity of nitrite oxidizing bacteria. These results are similar to those obtained by Abeling and Seyfried

31

concentrations which were 0.1~1.0 mg/L

24, 32.

but higher than many previously reported It is likely that these higher inhibition

threshold concentrations can be attributed to high concentrations of humic substances found in the MSW incineration leachate fed to these reactors 33 which have been shown to adsorb FA 34 subsequently removing it from the system. In order to determine whether ammonia oxidation was being impacted by elevated FA concentrations, the aeration phase of the nitrification process was closely monitored in reactor 2 during cycle 33 (Period 2) of the experiment. The aeration phase could be divided into three stages (Figure 2). During Stage I, hydrolytic bacteria degraded organic compounds and CO2 stripping caused a slight increase in pH from 8.67 to 8.79 that corresponded with an increase in FA concentrations from 156 mg/L to 184 mg/L. In a stable system, once organic compounds have been degraded, nitrifying bacteria should then be able to utilize available oxygen for ammonia oxidation, thereby reducing DO to concentrations around 0.5~1.0 mg/L

22.

However, during Stage II of this experiment, DO

concentrations jumped to 1.6 mg/L and ammonia conversion rates were only 6.2 mgNH4+/(L.h), indicating that FA concentrations >120 mg/L had an inhibitory effect on nitritation. When FA concentrations decreased to < 119 mg/L during Stage III, AOB were no longer inhibited, causing DO concentrations to decrease to ~0.5 mg/L and ammonia to disappear (Figure 2). The mean rate of ammonia conversion during Stage III was 12.7 mg

12


Page 12 of 31

Page 13 of 31 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


NH4+/(L.h), two times greater than rates observed during Stage II. Similar results were obtained from a parallel experiment carried out during Cycle 35 (Fig. S1).

Figure 2 Concentrations of various nitrogen based compounds, ammonia conversion rates, pH, and DO measured in Reactor 2 during Period 2 (cycle 33) when TAN concentrations were 650 mg/L.

13



Further evidence that FA was having an inhibitory effect on nitritation was observed during Period 2 of the experiment when influent TAN concentrations were increased from 550 mg/L to 650 mg/L (cycles 32-35) (Figure 1A). Ammonia oxidation is a zero-order reaction which means that reaction rates should be directly correlated with biomass concentrations 35. Since biomass in the system was kept constant (6 gMLSS/L), increases in nitritation durations should have directly corresponded with increases in TAN concentrations unless inhibition was occurring. When TAN concentrations were stepwise increased from 250 mg/L to 550 mg/L (Cycles 16-31), nitritation reaction rates increased by ~8 h per 100 mg/L influent TAN (Fig. S2). However, when TAN concentrations were further increased from 550 mg/L to 650 mg/L (cycles 32-35), nitritation reaction rates increased to 14 h per 100 mg/L influent TAN. Although nitritation was negatively impacted by FA concentrations >120 mg/L, it was not completely inhibited until FA concentrations reached 700 mg/L and the system deteriorated (Figure 1A). In addition, FNA concentrations measured during these cycles were 200mg/L) and from Reactor 2 during cycle 43 (Period 3) when TAN concentrations were 1400 mg/L and FA

20


Page 21 of 31 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


concentrations were below 110 mg/L. (B) Phylogenetic breakdown of heterotrophic amoA gene (DNA) and mRNA transcript sequences (cDNA) detected in Reactor 1 and 2 operational samples.

Transcriptomic analysis of heterotrophic ammonia oxidizers. Most studies of communities involved in nitrification of ammonia to nitrite in reactors treating wastewater have focused on autotrophic nitrifiers 18, 56-59. However, autotrophic nitrifiers did not appear to be significant members of ammonia oxidizing communities in these reactors, rather the majority of ammonia oxidizing activity could be attributed to heterotrophic AOB, specifically Paracoccus species. This can be explained by the fact that DO concentrations were ~0.5 mg/L, and heterotrophic ammonia oxidation dominates over autotrophic ammonia oxidation at DO concentrations < 1 mg/L 18, 60. To date, the pathway for heterotrophic ammonia oxidation is unclear, and ammonia monooxygenase (Amo) and hydroxylamine oxidoreductase (Hao) proteins from heterotrophic AOB have never been fully characterized

44, 61-64.

In fact, although Amo and

Hao enzymatic activities have been detected in a wide range of bacteria (i.e. Paracoccus, Pseudomonas, Arthrobacter, Agrobacterium, Alcaligenes, Diaphorobacter, Providencia, Thiosphaera, Bacillus, Acinetobacter, and Comamonas)44,

61, 65-70,

sequence data for the

proteins responsible for these activities have yet to be obtained. It is also possible that unlike autotrophic nitrifiers, nitrate reductase (Nar) is involved in heterotrophic nitrification. In fact, interruptions in Pseudomonas nitrate reductase-related genes (narH, narJ, and moaE) inhibited nitrification 71.

21



Page 22 of 31

Evidence that ammonia oxidation was occurring in these heterotrophic nitrifying reactors was provided by the accumulation of nitrite in reactors amended with sodium azide (0.2 mM) which inhibits membrane-bound nitrate reductase (Nar) activity

72

(Fig. S3).

Furthermore, nearly undetectable concentrations of nitrate ruled out the possibility that nitrite was being formed by periplasmic nitrate reductase (Nap), transcripts from the gene coding for the catalytic subunit of periplasmic nitrate reductase (napA) were not detected, and nitrite oxidizing bacteria were not present in these systems. The presence of hydroxylamine (0.06~0.15 mg/L) also indicated that ammonia oxidation was occurring in the reactors. Because so little is known about the metabolism of heterotrophic AOB in nitrifying reactors with high TAN concentrations, transcription patterns of genes from ammonia oxidation (amoA) and denitrification pathways (narG, nirS, norB, nosZ) were evaluated in reactors with TAN concentrations of 650 mg/L that were exposed to various concentrations of FA: 22, 70, 119, and 184 mg/L FA (Figure 7). Consistent with analytical results, a gene coding for Paracoccus amoA (ammonia monooxygenase subunit A), the first enzyme from the nitrification pathway, was being actively transcribed in reactors exposed to 22, 70, and 119 mg/L FA, however, transcript levels dropped 200 fold when FA concentrations were increased from 119 to 184 mg/L. Denitrification genes (narG, norB, nirS, and nosZ) involved in transformation of nitrite formed during ammonia oxidation all the way to nitrogen gas were also being actively transcribed in the reactors and their transcript levels decreased when exposed to 184 mg/L FA. The number of norB (nitric oxide reductase, subunit B) and narG (respiratory nitrate reductase, gamma subunit) transcripts was consistently lower than amoA, nirS and nosZ transcripts at all FA concentrations. Low 22


Page 23 of 31 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


overall expression of narG and norB genes can be explained by transcriptional inhibition caused by low nitrate 73, oxygen and iron concentrations 74-75

Figure 7. Results from quantitative RT-PCR using primers targeting heterotrophic amoA, nirS, nosZ, norB, and narG mRNA transcripts normalized against the number of recA mRNA transcripts detected in reactors exposed to 22, 70, 119, and 184 mg/L FA when TAN concentrations were 650 mg/L. Results and standard deviations were obtained from triplicate samples. Although nitrate was not present in the reactor, it is possible that narG was being actively transcribed because membrane-bound nitrate reductase (Nar) is involved in ammonia oxidation in a manner similar to Pseudomonas 71. However, other denitrification genes (nirS, norB, and nosZ) were also being expressed suggesting that denitrification was occurring in the reactors. Although Paracoccus (the dominant nitrifier in the reactor system) is capable of aerobic denitrification

68,

the denitrifiation process is significantly

more efficient under anaerobic conditions 76. Paracoccus can form biofilms where the inner layers of the biofilm are anaerobic

77-78.

Therefore, enhancement of Paracoccus biofilm

formation should provide optimal conditions for nitrification in the upper aerobic regions of the biofilm and denitrification in the lower anaerobic regions of the biofilm.

23



Currently, most reactor systems involved in biological nitrogen removal from wastewater require two consecutive conversion steps; an initial aerobic nitrification step followed by an anaerobic denitrification step. Enhancement of biofilm formation in reactors dominated by Paracoccus might make it possible to obtain complete removal of nitrogen in a single reactor simplifying the entire nitrogen removal process. In fact, increased Paracoccus biofilm formation in aerobic reactors was correlated with lower nitrite concentrations 77.

ACKNOWLEDGEMENT This research was financially supported by the National Natural Science Foundation of China (No.51678051).

ASSOCIATED CONTENT Supplementary Information This file contains 1 table and 3 figures and includes information regarding Paracoccus primer sequences (Table S1); nitrogen and DO concentrations, and pH values from cycle 35, Period 2 (Figure S1); average nitrification reaction durations (Figure S2); nitrogen concentrations in reactors amended with NaN3 (Figure S3).

References (1) Chou, J.-d.; Wey, M.-Y.; Liang, H.-H.; Chang, S.-H. Biotoxicity evaluation of fly ash and bottom ash from different municipal solid waste incinerators. Journal of hazardous materials 2009, 168 (1), 197-202, DOI 10.1016/j.jhazmat.2009.02.023. (2) Wiszniowski, J.; Robert, D.; Surmacz-Gorska, J.; Miksch, K.; Weber, J. V. Landfill leachate treatment methods: A review. Environmental Chemistry Letters 2006, 4 (1), 51-61, DOI 10.1007/s10311-005-0016-z.

24


Page 24 of 31

Page 25 of 31 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(3) Ye, J.; Mu, Y.; Cheng, X.; Sun, D. Treatment of fresh leachate with high-strength organics and calcium from municipal solid waste incineration plant using UASB reactor. Bioresource technology 2011, 102 (9), 5498-5503, DOI 10.1016/j.biortech.2011.01.001. (4) Thauer, R. K.; Kaster, A. K.; Seedorf, H.; Buckel, W.; Hedderich, R. Methanogenic archaea: ecologically relevant differences in energy conservation. Nat Rev Microbiol 2008, 6 (8), 579-91, DOI 10.1038/nrmicro1931. (5) Surmacz-Górska, J.; Cichon, A.; Miksch, K. Nitrogen removal from wastewater with high ammonia nitrogen concentration via shorter nitrification and denitrification. Water Science & Technology 1997, 36 (10), 73-78, DOI 10.1016/S0273-1223(97)00000-0. (6) Muller, T.; Walter, B.; Wirtz, A.; Burkovski, A. Ammonium toxicity in bacteria. Current Microbiology 2006, 52 (5), 400-406, DOI 10.1007/s00284-005-0370-x. (7) Zhang, Y.; Zamudio Cañas, E. M.; Zhu, Z.; Linville, J. L.; Chen, S.; He, Q. Robustness of archaeal populations in anaerobic co-digestion of dairy and poultry wastes. Bioresource Technology 2011, 102 (2), 779, DOI 10.1016/j.biortech.2010.08.104. (8) Wang, H.; Zhang, Y.; Angelidaki, I. Ammonia inhibition on hydrogen enriched anaerobic digestion of manure under mesophilic and thermophilic conditions. Water research 2016, 105, 314-319, DOI 10.1016/j.watres.2016.09.006. (9) Sung, S.; Liu, T. Ammonia inhibition on thermophilic anaerobic digestion. Chemosphere 2003, 53 (1), 43-52, DOI 10.1016/S0045-6535(03)00434-X. (10) Bae, H.; Chung, Y.-C.; Yang, H.; Lee, C.; Aryapratama, R.; Yoo, Y. J.; Lee, S. Assessment of bacterial community structure in nitrifying biofilm under inorganic carbonsufficient and-limited conditions. Journal of Environmental Science and Health, Part A 2015, 50 (2), 201-212, DOI 10.1080/10934529.2014.975550. (11) Baek, K.; Park, C.; Oh, H.-M.; Yoon, B.-D.; Kim, H.-S. Diversity and abundance of ammonia-oxidizing bacteria in activated sludge treating different types of wastewater. Journal of microbiology and biotechnology 2010, 20 (7), 1128-1133, DOI 10.4014/jmb.0907.07021. (12) Harms, G.; Layton, A. C.; Dionisi, H. M.; Gregory, I. R.; Garrett, V. M.; Hawkins, S. A.; Robinson, K. G.; Sayler, G. S. Real-time PCR quantification of nitrifying bacteria in a municipal wastewater treatment plant. Environmental science & technology 2003, 37 (2), 343-351, DOI 10.1021/es0257164. (13) Satoh, H.; Yamakawa, T.; Kindaichi, T.; Ito, T.; Okabe, S. Community structures and activities of nitrifying and denitrifying bacteria in industrial wastewater‐treating biofilms. Biotechnology and bioengineering 2006, 94 (4), 762-772, DOI 10.1002/bit.20894. (14) Chung, J.; Ph.D, W. B.; Lee, Y.-W.; Ko, G.-B.; Lee, S.-U.; Park, S.-J. Investigation of the effect of free ammonia concentration upon leachate treatment by shortcut biological nitrogen removal process. Journal of Environmental Science & Health Part A Toxic/hazardous Substances & Environmental Engineering 2004, 39 (7), 1655-65, DOI 10.1081/ESE-120037867. (15) Lv, B.; Yang, K.; Wang, H.-y. In Effects of Free Ammonia on Partial Nitrification under Different Conditions, Bioinformatics and Biomedical Engineering (iCBBE), 2010 4th International Conference on, IEEE: 2010; pp 1-5, DOI 10.1109/ICBBE.2010.5517328. (16) Kim, D. J.; Lee, D. I.; Keller, J. Effect of temperature and free ammonia on nitrification and nitrite accumulation in landfill leachate and analysis of its nitrifying

25



bacterial community by FISH. Bioresour Technol 2006, 97 (3), 459-68, DOI: 10.1016/j.biortech.2005.03.032. (17) Spagni, A.; Marsili-Libelli, S. Nitrogen removal via nitrite in a sequencing batch reactor treating sanitary landfill leachate. Bioresource Technology 2009, 100 (2), 609-614, DOI 10.1016/j.biortech.2008.06.064. (18) Fitzgerald, C. M.; Camejo, P.; Oshlag, J. Z.; Noguera, D. R. Ammonia-oxidizing microbial communities in reactors with efficient nitrification at low-dissolved oxygen. Water research 2015, 70, 38-51, DOI 10.1016/j.watres.2014.11.041. (19) Guo, J.; Peng, Y.; Wang, S.; Ma, B.; Ge, S.; Wang, Z.; Huang, H.; Zhang, J.; Zhang, L. Pathways and organisms involved in ammonia oxidation and nitrous oxide emission. Critical reviews in environmental science and technology 2013, 43 (21), 2213-2296, DOI 10.1080/10643389.2012.672072. (20) Tchobanoglous, G.; Burton, F. L.; Stensel, H. D. Wastewater engineering treatment and reuse, Boston, US: McGraw-Hill Higher Education: 2003. (21) Dang, Y.; Ye, J.; Mu, Y.; Qiu, B.; Sun, D. Effective anaerobic treatment of fresh leachate from MSW incineration plant and dynamic characteristics of microbial community in granular sludge. Applied Microbiology & Biotechnology 2013, 97 (24), 10563, DOI 10.1007/s00253-013-4792-2. (22) Peng, Y.; Chen, Y.; Peng, C.; Liu, M.; Wang, S.; Song, X.; Cui, Y. Nitrite accumulation by aeration controlled in sequencing batch reactors treating domestic wastewater. Water Science and Technology 2004, 50 (10), 35, DOI 10.2166/wst.2004.0603. (23) APHA. Standard methods for the examination of water and wastewater. American Public Health Association (APHA): Washington, DC, USA 2005. (24) Anthonisen, A. C.; Loehr, R. C.; Prakasam, T. B.; Srinath, E. G. Inhibition of nitrification by ammonia and nitrous acid. Journal - Water Pollution Control Federation 1976, 48 (5), 835. (25) Vajrala, N.; Martens-Habbena, W.; Sayavedra-Soto, L. A.; Schauer, A.; Bottomley, P. J.; Stahl, D. A.; Arp, D. J. Hydroxylamine as an intermediate in ammonia oxidation by globally abundant marine archaea. Proceedings of the National Academy of Sciences 2013, 110 (3), 1006-1011, DOI 10.1073/pnas.1214272110. (26) Lei, Y.; Sun, D.; Dang, Y.; Chen, H.; Zhao, Z.; Zhang, Y.; Holmes, D. E. Stimulation of methanogenesis in anaerobic digesters treating leachate from a municipal solid waste incineration plant with carbon cloth. Bioresource Technology 2016, 222, 270, DOI 10.1016/j.biortech.2016.10.007. (27) Okano, Y.; Hristova, K. R.; Leutenegger, C. M.; Jackson, L. E.; Denison, R. F.; Gebreyesus, B.; Lebauer, D.; Scow, K. M. Application of real-time PCR to study effects of ammonium on population size of ammonia-oxidizing bacteria in soil. Applied and environmental microbiology 2004, 70 (2), 1008-1016, DOI 10.1128/AEM.70.2.10081016.2004. (28) Larkin, M. A.; Blackshields, G.; Brown, N. P.; Chenna, R.; Mcgettigan, P. A.; Mcwilliam, H.; Valentin, F.; Wallace, I. M.; Wilm, A.; Lopez, R. Clustal W and Clustal X version 2.0. Bioinformatics 2007, 23 (21), 2947-2948. (29) Altschul, S. F.; Gish, W.; Miller, W.; Myers, E. W.; Lipman, D. J. Basic local alignment search tool. Journal of Molecular Biology 1990, 215 (3), 403-10.

26


Page 26 of 31

Page 27 of 31 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(30) Holmes, D. E.; Shrestha, P. M.; Djf, W.; Dang, Y.; Nevin, K. P.; Woodard, T. L.; Lovley, D. R. Metatranscriptomic Evidence for Direct Interspecies Electron Transfer between Geobacter and Methanothrix Species in Methanogenic Rice Paddy Soils. Applied & Environmental Microbiology 2017, 83 (9), DOI 10.1128/AEM.00223-17. (31) Abeling, U.; Seyfried, C. F. Anaerobic-aerobic treatment of high strength ammonium wastewater nitrogen removal via nitrite. Water Sci Technol. Water Science & Technology A Journal of the International Association on Water Pollution Research & Control 1992, 26 (5-6), 1007-1015, DOI 10.2166/wst.1992.0542. (32) Kim, D. J.; Chang, J. S.; Lee, D. I.; Han, D. W.; Yoo, I. K.; Cha, G. C. Nitrification of high strength ammonia wastewater and nitrite accumulation characteristics. Water Science & Technology A Journal of the International Association on Water Pollution Research 2003, 47 (11), 45, DOI 10.2166/wst.2003.0585. (33) Dang, Y.; Lei, Y.; Liu, Z.; Xue, Y.; Sun, D.; Wang, L. Y.; Holmes, D. E. Impact of fulvic acids on bio-methanogenic treatment of municipal solid waste incineration leachate. Water Research 2016, 106, 71, DOI 10.1016/j.watres.2016.09.044. (34) Schnitzer, M.; Khan, S. U. Humic substances in the environment. Soil Science Society of America Journal 1972, 39 (3). (35) Shah, D. B.; Coulman, G. A. Kinetics of Nitrification and Denitrification. Biotechnology & Bioengineering 1978, 20 (1), 43-72, DOI 10.1002/bit.260200105. (36) Qiao, S.; Matsumoto, N.; Shinohara, T.; Nishiyama, T.; Fujii, T.; Bhatti, Z.; Furukawa, K. High-rate partial nitrification performance of high ammonium containing wastewater under low temperatures. Bioresource technology 2010, 101 (1), 111-117, DOI 10.1016/j.biortech.2009.08.003. (37) Yang, J.; Zhang, L.; Daisuke, H.; Takahiro, S.; Ma, Y.; Li, Z.; Furukawa, K. High rate partial nitrification treatment of reject wastewater. Journal of bioscience and bioengineering 2010, 110 (4), 436-440, DOI 10.1016/j.jbiosc.2010.05.003. (38) Ruiz, G.; Jeison, D.; Chamy, R. Nitrification with high nitrite accumulation for the treatment of wastewater with high ammonia concentration. Water research 2003, 37 (6), 1371-1377, DOI 10.1016/S0043-1354(02)00475-X. (39) Ciudad, G.; Rubilar, O.; Munoz, P.; Ruiz, G.; Chamy, R.; Vergara, C.; Jeison, D. Partial nitrification of high ammonia concentration wastewater as a part of a shortcut biological nitrogen removal process. Process biochemistry 2005, 40 (5), 1715-1719, DOI 10.1016/j.procbio.2004.06.058. (40) Painter, H. A.; Painter, H. A. Review of Literature on Inorganic Nitrogen Metabolism in Microorganisms. Water Research 1970, 4 (6), 393–450, DOI 10.1016/00431354(70)90051-5. (41) Balmelle, B.; Nguyen, K. M.; Capdeville, B.; Cornier, J. C.; Deguin, A. Study of factors controlling nitrite build-up in biological processes for water nitrification. Water Science & Technology 1992, 26 (5-6), 1017-1025, DOI 10.2166/wst.1992.0543. (42) Hellinga, C.; Loosdrecht, M. C. M. v.; Heijnen, J. J. Model Based Design of a Novel Process for Nitrogen Removal from Concentrated Flows. Mathematical & Computer Modelling of Dynamical Systems 2010, 5 (4), 351-371, DOI 10.1076/mcmd.5.4.351.3678. (43) Moir, J. W.; Wehrfritz, J. M.; Spiro, S.; Richardson, D. J. The biochemical characterization of a novel non-haem-iron hydroxylamine oxidase from Paracoccus

27



denitrificans GB17. Biochemical Journal 1996, 319 ( Pt 3) (3), 823-827, DOI 10.1042/bj3190823. (44) Moir, J. W.; Crossman, L. C.; Spiro, S.; Richardson, D. J. The purification of ammonia monooxygenase from Paracoccus denitrficans. FEBS letters 1996, 387 (1), 71-74, DOI 10.1016/0014-5793(96)00463-2. (45) Huang, X.; Bai, J.; Dang, J.; Zhang, Y.; Zhao, Y.; Li, K. In Experimental studies on the influential factors of cold-tolerant and salt-tolerant ammonia-oxidizing bacteria, International Conference on Advances in Energy Resources and Environment Engineering, 2015, DOI 10.1201/b19126-124. (46) Otte, S.; Schalk, J.; Kuenen, J. G.; Jetten, M. S. M. Hydroxylamine oxidation and subsequent nitrous oxide production by the heterotrophic ammonia oxidizer Alcaligenes faecalis. Applied Microbiology & Biotechnology 1999, 51 (2), 255-61, DOI 10.1007/s002530051390. (47) Liu, B.; Mao, Y.; Bergaust, L.; Bakken, L. R.; Frostegård, Å. Strains in the genus Thauera exhibit remarkably different denitrification regulatory phenotypes. Environmental microbiology 2013, 15 (10), 2816-2828, DOI 10.1111/1462-2920.12142. (48) Liu, B.; Zhang, F.; Feng, X.; Liu, Y.; Yan, X.; Zhang, X.; Wang, L.; Zhao, L. Thauera and Azoarcus as functionally important genera in a denitrifying quinoline-removal bioreactor as revealed by microbial community structure comparison. FEMS Microbiology Ecology 2005, 55 (2), 274-286, DOI 10.1111/j.1574.6941.2005.00033.x (49) Foesel, B. U.; Gößner, A. S.; Drake, H. L.; Schramm, A. Geminicoccus roseus gen. nov., sp. nov., an aerobic phototrophic Alphaproteobacterium isolated from a marine aquaculture biofilter. Systematic and applied microbiology 2007, 30 (8), 581-586, DOI 10.1016/j.syapm.2007.05.005. (50) Chen, W.-M.; Cho, N.-T.; Huang, W.-C.; Young, C.-C.; Sheu, S.-Y. Description of Gemmobacter fontiphilus sp. nov., isolated from a freshwater spring, reclassification of Catellibacterium nectariphilum as Gemmobacter nectariphilus comb. nov., Catellibacterium changlense as Gemmobacter changlensis comb. nov., Catellibacterium aquatile as Gemmobacter aquaticus nom. nov., Catellibacterium caeni as Gemmobacter caeni comb. nov., Catellibacterium nanjingense as Gemmobacter nanjingensis comb. nov., and emended description of the genus Gemmobacter and of Gemmobacter aquatilis. International journal of systematic and evolutionary microbiology 2013, 63 (2), 470-478, DOI 10.1099/ijs.0.042051-0. (51) Weon, H.-Y.; Anandham, R.; Tamura, T.; Hamada, M.; Kim, S.-J.; Kim, Y.-S.; Suzuki, K.-i.; Kwon, S.-W. Leucobacter denitrificans sp. nov., isolated from cow dung. The journal of microbiology 2012, 50 (1), 161-165, DOI 10.1007/s12275-012-1324-1. (52) Lu, H.; Kalyuzhnaya, M.; Chandran, K. Comparative proteomic analysis reveals insights into anoxic growth of Methyloversatilis universalis FAM5 on methanol and ethanol. Environmental microbiology 2012, 14 (11), 2935-2945, DOI 10.1111/j.14622920.2012.02857.x. (53) Song, J.; Choo, Y.-J.; Cho, J.-C. Perlucidibaca piscinae gen. nov., sp. nov., a freshwater bacterium belonging to the family Moraxellaceae. International journal of systematic and evolutionary microbiology 2008, 58 (1), 97-102, DOI 10.1099/ijs.0.650390.

28


Page 28 of 31

Page 29 of 31 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(54) Spring, S.; Jäckel, U.; Wagner, M.; Kämpfer, P. Ottowia thiooxydans gen. nov., sp. nov., a novel facultatively anaerobic, N2O-producing bacterium isolated from activated sludge, and transfer of Aquaspirillum gracile to Hylemonella gracilis gen. nov., comb. nov. International Journal of Systematic & Evolutionary Microbiology 2004, 54 (1), 99-106, DOI 10.1099/ijs.0.02727-0. (55) Chen, C.-X.; Zhang, X.-Y.; Liu, C.; Yu, Y.; Liu, A.; Li, G.-W.; Li, H.; Chen, X.-L.; Chen, B.; Zhou, B.-C. Pseudorhodobacter antarcticus sp. nov., isolated from Antarctic intertidal sandy sediment, and emended description of the genus Pseudorhodobacter Uchino et al. 2002 emend. Jung et al. 2012. International journal of systematic and evolutionary microbiology 2013, 63 (3), 849-854, DOI 10.1099/ijs.0.042184-0. (56) Gieseke, A.; Purkhold, U.; Wagner, M.; Amann, R.; Schramm, A. Community structure and activity dynamics of nitrifying bacteria in a phosphate-removing biofilm. Applied and environmental microbiology 2001, 67 (3), 1351-1362, DOI 10.1128/AEM.67.3.1351-1362.2001. (57) Egli, K.; Langer, C.; Siegrist, H.-R.; Zehnder, A. J.; Wagner, M.; van der Meer, J. R. Community analysis of ammonia and nitrite oxidizers during start-up of nitritation reactors. Applied and Environmental Microbiology 2003, 69 (6), 3213-3222, DOI 10.1128/AEM.69.6.3213-3222.2003. (58) Wittebolle, L.; Vervaeren, H.; Verstraete, W.; Boon, N. Quantifying community dynamics of nitrifiers in functionally stable reactors. Applied and Environmental Microbiology 2008, 74 (1), 286-293, DOI 10.1128/AEM.01006-07. (59) Prinčič, A.; Mahne, I.; Megušar, F.; Paul, E. A.; Tiedje, J. M. Effects of pH and oxygen and ammonium concentrations on the community structure of nitrifying bacteria from wastewater. Applied and environmental microbiology 1998, 64 (10), 3584-3590. (60) Van Niel, E. W.; Arts, P.; Wesselink, B.; Robertson, L.; Kuenen, J. Competition between heterotrophic and autotrophic nitrifiers for ammonia in chemostat cultures. FEMS Microbiology Ecology 1993, 11 (2), 109-118, DOI 10.1111/j.1574-6968.1993.tb05802.x. (61) Jetten, M. S.; Logemann, S.; Muyzer, G.; Robertson, L. A.; de Vries, S.; van Loosdrecht, M. C.; Kuenen, J. G. Novel principles in the microbial conversion of nitrogen compounds. Antonie van leeuwenhoek 1997, 71 (1-2), 75-93, DOI 10.1023/A:1000150219937. (62) Daum, M.; Zimmer, W.; Papen, H.; Kloos, K.; Nawrath, K.; Bothe, H. Physiological and molecular biological characterization of ammonia oxidation of the heterotrophic nitrifier Pseudomonas putida. Current Microbiology 1998, 37 (4), 281-288, DOI 10.1007/s002849900379. (63) James, W.; WEHRFRITZ, J.-M.; SPIRO, S.; RICHARDSON, D. J. The biochemical characterization of a novel non-haem-iron hydroxylamine oxidase from Paracoccus denitrificans GB17. Biochemical Journal 1996, 319 (3), 823-827, DOI 10.1042/bj3190823. (64) Ono, Y.; Enokiya, A.; Masuko, D.; Shoji, K.; Yamanaka, T. Pyruvic oxime dioxygenase from the heterotrophic nitrifier Alcaligenes faecalis: purification, and molecular and enzymatic properties. Plant and cell physiology 1999, 40 (1), 47-52, DOI 10.1093/oxfordjournals.pcp.a029473. (65) Wehrfritz, J.-M.; Reilly, A.; Spiro, S.; Richardson, D. J. Purification of hydroxylamine oxidase from Thiosphaera pantotropha: Identification of electron acceptors that couple

29



heterotrophic nitrification to aerobic denitrification. FEBS letters 1993, 335 (2), 246-250, DOI 10.1016/0014-5793(93)80739-H. (66) Crossman, L. C.; Moir, J. W.; Enticknap, J. J.; Richardson, D. J.; Spiro, S. Heterologous expression of heterotrophic nitrification genes. Microbiology 1997, 143 (12), 3775-3783, DOI 10.1099/00221287-143-12-3775. (67) Chen, Q.; Ni, J. Heterotrophic nitrification–aerobic denitrification by novel isolated bacteria. Journal of industrial microbiology & biotechnology 2011, 38 (9), 1305-1310, DOI 10.1007/s10295-010-0911-6. (68) Stein, L. Y. Heterotrophic nitrification and nitrifier denitrification. In Nitrification; American Society of Microbiology: 2011; pp 95-114, DOI 10.1128/9781555817145.ch5. (69) Su, J.-J.; Yeh, K.-S.; Tseng, P.-W. A strain of Pseudomonas sp. isolated from piggery wastewater treatment systems with heterotrophic nitrification capability in Taiwan. Current Microbiology 2006, 53 (1), 77-81, DOI 10.1007/s00284-006-0021-x. (70) Robertson, L.; Kuenen, J.; Kleijntjens, R. Aerobic denitrification and heterotrophic nitrification byThiosphaera pantotropha. Antonie Van Leeuwenhoek 1985, 51 (4), 445-445, DOI 10.1007/BF02275068. (71) Nemergut, D.; Schmidt, S. Disruption of narH, narJ, and moaE inhibits heterotrophic nitrification in Pseudomonas strain M19. Applied and environmental microbiology 2002, 68 (12), 6462-6465, DOI 10.1128/AEM.68.12.6462-6465.2002. (72) Berks, B. C.; Ferguson, S. J.; Moir, J. W.; Richardson, D. J. Enzymes and associated electron transport systems that catalyse the respiratory reduction of nitrogen oxides and oxyanions. Biochimica et Biophysica Acta (BBA)-Bioenergetics 1995, 1232 (3), 97-173, DOI 10.1016/0005-2728(95)00092-5. (73) Wang, H.; Tseng, C.-P.; Gunsalus, R. P. The napF and narG nitrate reductase operons in Escherichia coli are differentially expressed in response to submicromolar concentrations of nitrate but not nitrite. Journal of bacteriology 1999, 181 (17), 5303-5308. (74) Isabella, V.; Wright, L. F.; Barth, K.; Spence, J. M.; Grogan, S.; Genco, C. A.; Clark, V. L. cis-and trans-acting elements involved in regulation of norB (norZ), the gene encoding nitric oxide reductase in Neisseria gonorrhoeae. Microbiology 2008, 154 (1), 226239, DOI 10.1099/mic.0.2007/010470-0. (75) Qu, Z.; Bakken, L. R.; Molstad, L.; Frostegård, Å.; Bergaust, L. L. Transcriptional and metabolic regulation of denitrification in Paracoccus denitrificans allows low but significant activity of nitrous oxide reductase under oxic conditions. Environmental microbiology 2016, 18 (9), 2951-2963, DOI 10.1111/1462-2920.13128. (76) Medhi, K.; Singhal, A.; Chauhan, D.; Thakur, I. S. Investigating the nitrification and denitrification kinetics under aerobic and anaerobic conditions by Paracoccus denitrificans ISTOD1. Bioresource technology 2017, 242, 334-343, DOI 10.1016/j.biortech.2017.03.084. (77) Rezić, T.; Šantek, B.; Novak, S.; Marić, V. Comparison between the heterotrophic cultivation of Paracoccus denitrificans in continuous stirred tank reactor and horizontal rotating tubular bioreactor. Process Biochemistry 2006, 41 (9), 2024-2028, DOI 10.1016/j.procbio.2006.05.001. (78) Uemoto, H.; Saiki, H. Nitrogen removal reactor using packed gel envelopes containing Nitrosomonas europaea and Paracoccus denitrificans. Biotechnology and bioengineering

30


Page 30 of 31

Page 31 of 31 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


2000, 67 (1), BIT9>3.0.CO;2-E.

80-86,

DOI

10.1002/(SICI)1097-0290(20000105)67:1

Heterotrophic Nitrifiers Dominate Reactors Treating Incineration

Recommend Documents