High Antimicrobial Activity and Low Human Cell Cytotoxicity of Core

Subscriber access provided by Chicago State University

Article

High antimicrobial activity and low human cell cytotoxicity of core-shell magnetic nanoparticles functionalized with an antimicrobial peptide Hajar Maleki, Akhilesh Rai, Sandra Pinto, Marta Evangelista, Renato M.S. Cardoso, Cristiana Silva Oliveira Paulo, Tiago Carvalheiro, Artur Paiva, Mohammad Imani, Abdolreza Arash Simchi, Luisa Durães, António Alberto Portugal, and Lino Silva Ferreira ACS Appl. Mater. Interfaces, Just Accepted Manuscript • DOI: 10.1021/acsami.6b03355 • Publication Date (Web): 13 Apr 2016 Downloaded from http://pubs.acs.org on April 14, 2016

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

ACS Applied Materials & Interfaces is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 39

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Applied Materials & Interfaces

High antimicrobial activity and low human cell cytotoxicity of core-shell magnetic nanoparticles functionalized with an antimicrobial peptide Hajar Maleki1,$, Akhilesh Rai2,3$, Sandra Pinto2,3$, Marta Evangelista2,3, Renato M.S. Cardoso2,3, Cristiana Paulo2,3, Tiago Carvalheiro4, Artur Paiva4, Mohammad Imani5, Abdolreza Simchi6,7, Luísa Durães1, António Portugal1, Lino Ferreira2,3* 1

CIEPQPF, Department of Chemical Engineering, University of Coimbra, 3030-790 Coimbra, Portugal 2

Biocant- Biotechnology Innovation Center, Cantanhede, 3004-517 Coimbra, Portugal 3

CNC-Center of Neurosciences and Cell Biology, University of Coimbra, 3004-517 Coimbra, Portugal E-mail: [email protected] 4

Blood and Transplantation Center of Coimbra, Portuguese Institute of Blood and Transplantation 5

Novel Drug Delivery Systems Department, Iran Polymer and Petrochemical Institute, Tehran, Iran 6

Department of Material Science and Engineering, Sharif University of Technology, Tehran, Iran 7

Institute for Nanoscience and Nanotechnology, Sharif University of Technology, Tehran, Iran $ Authors contributed equally. *Corresponding author: Lino Ferreira Keywords: antimicrobial peptide, cecropin melittin, magnetic nanoparticles, core-shell nanoparticles, human cell biocompatibility.

1 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Abstract Superparamagnetic iron oxide nanoparticles (SPION) functionalized with antimicrobial agents are promising infection-targeted therapeutic platforms when coupled with external magnetic stimuli. These antimicrobial nanoparticles (NPs) may offer advantages in fighting intracellular pathogens as well as biomaterials-associated infections. This requires the development of NPs with high antimicrobial activity without interfering with the biology of mammalian cells. Here, we report the preparation of biocompatible antimicrobial SPION@gold (Au) core-shell NPs based on covalent immobilization of the antimicrobial peptide (AMP) cecropin mellitin (CM) (the conjugate is named AMP-NP). The minimal inhibitory concentration (MIC) of the AMP-NP for Escherichia coli (E. coli) was 0.4 µg/mL, 10-times lower than MIC of soluble CM. The antimicrobial activity of CM depends on the length of spacer between CM and the NP. AMP-NPs are taken up by endothelial (between 60 and 170 pg of NPs per cell) and macrophage (between 18 and 36 pg of NPs per cell) cells and accumulate preferentially in endolysosomes. These NPs have no significant cytotoxic and pro-inflammatory activities for concentrations up to 200 µg/mL (at least 100 times higher than the MIC of soluble CM). Our results in membrane models suggest that the selectivity of AMP-NPs to bacteria and not eukaryotic membranes is due to their membrane compositions. The AMP-NPs developed here open new opportunities for infection-site targeting.


Page 2 of 39

Page 3 of 39

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


1. Introduction The development of advanced platforms to target infection in the human body is needed for the treatment of diseases related to intracellular pathogens and biomaterialsassociated infections. Tuberculosis, hepatitis and meningitis are caused by intracellular pathogens and are a major burden of the contemporary world.1 Conventional treatments for these diseases include long-term therapies with a combination of drugs, which have undesired side effects due to the drug´s inherent toxicity and long-term drug exposure. Furthermore, some of the drugs have poor cellular penetration or have poor retention in the cell cytoplasm.2 Another major medical problem is related to biomaterial-associated infections coming from the contamination of implant surfaces during implantation.3 In both cases, a critical challenge is to develop therapies that can be targeted to the infection site avoiding its side effects while increasing its effectiveness. Magnetic NPs, which can be remotely controlled by applying an external magnetic field, are very promising to target the infection site. These NPs functionalized with different chemical functionalities have been recently explored to target implant-based infections.4,5 SPIONs without antimicrobial agents killed bacteria for concentrations above 100 µg/mL.4 In addition, carboxyl-grafted SPIONs killed approximately 44% of bacteria in a biofilm formed by gentamicin-resistant bacteria strain.5 Yet, further advances are necessary to design magnetic NPs with high antimicrobial activity. One of the strategies is by immobilizing antimicrobial agents on the surface of SPIONs. AMPs are a class of antimicrobial agents that are present in a large number in nature (more than 800 sequences), which are very effective against several strains of bacteria, fungi and viruses.6 AMPs form an essential part of the ‘‘innate’’ arm of host resistance, serving as a first line of defense against infection. Here, we report a simple platform to prepare biocompatible magnetic antimicrobial NPs based on the covalent immobilization of CM to gold (Au)-coated SPIONs (SPION@Au core-shell NPs; named as bare NPs). CM was selected due to its broad antimicrobial activity 3 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

and low hemolytic properties (>600 µM).7,8 The composition, optical properties and magnetic properties of AMP-NPs were characterized. The antimicrobial properties of the AMP-NPs were then studied against Gram-positive (Staphylococcus aureus (S. aureus)) and Gramnegative (E. coli) bacteria and the mechanism evaluated by scanning electron microscopy (SEM) and transmission electron microscopy (TEM) analyses. Finally, the internalization, cytotoxicity and pro-inflammatory properties of AMP-NPs were assessed.

2. Experimental section 2.1. Synthesis of Fe3O4 (SPION) NPs. Magnetite NPs were synthesized using a microemulsion technique in which two w/o microemulsions of the same composition [water/toluene (Ghataran Shimi T. Co., Iran) /cetyltrimethylammonium bromide (CTAB, Sigma-Aldrich)butanol] were prepared, according to our previous work.9 One of the microemulsions contained 1.9 mL of aqueous internal phase of ferric chloride hexahydrate (0.75 mmol, 111 mg/mL, Merck, Dusseldorf, Germany) and ferrous chloride tetrahydrate (0.37 mmol, 52.2 mg/mL, Merck) and the other micro-emulsion contained the reducing agent, i.e. ammonium hydroxide (NH4OH) (30% v/v, 1.9 mL, Sigma-Aldrich). SPIONs were formed and precipitated by blending of the two microemulsions under a high purity (99.9%) argon atmosphere at 50 ˚C for 1 h. The product was washed 3 times with 20 mL of absolute ethanol (Ghataran Shimi T. Co., Iran) and then washed under refluxing with ethanol to remove surfactant residues and unreacted by-products, and finally harvested using an external magnet. 2.2. Functionalization of SPIONs with dithiocarbamate groups. The SPIONs were resuspended in aqueous solution of HCl at pH 4 (40 mL, 0.1 mg/mL) followed by addition of 3-triethoxysilylpropylamine (2%, v/v, 10 mL, APTES, Sigma-Aldrich) in order to facilitate the sol-gel reaction between SPIONs and APTES. The mixture was stirred for 3 h using a glass mechanical stirrer at 40 °C. The SPIONs were then washed with ethanol and magnetically collected. The modification of APTES-functionalized SPIONs (4 mg) with 4 ACS Paragon Plus Environment

Page 4 of 39

Page 5 of 39

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


carbon disulfide (CS2, Sigma-Aldrich) was initiated by adding the NPs to a reaction mixture containing NaOH (0.1 M, 35 mL), 2-propanol (5 mL) and CS2 (0.6 mL). The suspension was mechanically stirred for 6 h. The powder was collected magnetically from the suspension and washed with 2-propanol and ethanol and kept at 4°C for further usage. 2.3. Formation of Au shell onto dithiocarbamate-coated SPIONs (bare NPs). Gold(III) chloride trihydrate (HAuCl4·3H2O, 0.02 g, 0.026 mmol, Sigma-Aldrich) was added to a suspension of dithiocarbamate-functionalized SPIONs (0.3 mg/mL, 50 mL) under sonication for the formation of Au shell. The molar concentration of SPIONs was confirmed using atomic absorption spectroscopy (AAS GBC, Avanta, Australia) by measuring iron concentration. The pH of the mixture was adjusted to slightly acidic (pH~ 4-5) to facilitate the reduction process. After 5 min sonication of the mixture with an ultrasonic probe, a solution of sodium borohydride (NaBH4, 0.3 M, 1 mL, Sigma-Aldrich) was added drop wise to the reaction mixture to reduce the HAuCl4 on the surface of dithiocarbamate modified SPIONs. The dark-purple solution containing NPs were magnetically separated from the free Au NPs and washed with de-ionized water and redispersed in Mili-Q water for further characterization. 2.4. Immobilization of CM peptide on bare NPs. Bare NPs (0.1 mg/mL, 2 mL) were modified with cystamine (0.07 mg/mL, 6 mL, Sigma-Aldrich). The reaction mixture was incubated for 4 h, followed by separation of NPs, using an external magnetic field and washing

with

distilled

water.

Before

modification

of

cystamine

with

N-[γ-

maleimidobutyryloxy]sulfosuccinimide ester (sulfo-GMBS, Thermo-Scientific), the free amine groups on the surface of cytamine functionalized bare NPs were estimated using a picrate method.10 The cystamine modified core-shell NPs were treated with picric acid (0.1 M) for 10 min, washed five times with dichloromethane (2 min time interval between each washing step) and collected using an external magnet. N,N-diisopropylethylamine (two 2 mL portions intervened by 2 mL of methanol) was added to the NPs pellet. The core-shell NPs 5 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

were collected and the optical absorption of supernatant was measured at 358 nm using ultraviolet-visible (UV-Vis) spectroscopy. The extinction coefficient of the amine-picrate complex was considered to be 14500 M-1cm-1 at 358 nm.10 The concentration of amine group on the surface of bare NPs was estimated by subtracting the concentration obtained in supernatant from original concentration used for the functionalization. The estimated concentration of amine groups was 2 × 10-4 M. For CM immobilization, sulfo-GMBS solution (2 mL, 1 mg/mL in PBS pH 7.2) was added to a suspension of cystamine modified bare NPs (0.1 mg/mL, 2 mL) and incubated for 2 h at room temperature. After incubation, sulfo-GMBS-modified bare NPs were collected and washed 2 times with phosphate buffer. Immediately, a solution of CM peptide (1 mg/mL, in phosphate buffer pH 7.2) having a thiol group at c-terminus (KWKLFKKIGAVLKVLC, Caslo Laboratory, Sweden) was added to sulfo-GMBS modified bare NPs and kept at 4°C for 12 h. The NPs (AMP-NPs) were collected, washed with phosphate buffer to remove unbound CM peptide and finally freeze-dried before antimicrobial evaluation. The direct immobilization of CM peptide on the surface of bare NPs without being surface modified was performed by incubating the CM peptide in bare NPs solution at 4°C for 12 h. CM peptide has a thiol group at c-terminal, which is able to react with gold surface of bare NPs. After incubation, CM peptide conjugated bare NPs (named as CM_no spacer_NPs) were collected using an external magnetic field and washed twice with phosphate buffer to remove unbound CM peptide. The amount of conjugated peptide on NPs (for both AMP-NPs and CM-no spacer_NPs) was estimated using sulfosuccinimidyl-4-o-(4,4-dimethoxytrityl)butyrate (sulfoSDTB) test. Sulfo-SDTB (3 mg) was dissolved in dimethylformamide (1 mL, DMF) followed by addition of sodium bicarbonate buffer (pH 8.5, 50 mM) to bring up to a total volume of 50 mL. Then sodium bicarbonate buffer (1 mL) and sulfo-SDTB solution (1 mL) were added to a 6 ACS Paragon Plus Environment

Page 6 of 39

Page 7 of 39

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


24-well-plate-containing CM peptide-coated surfaces and incubated for 40 min at room temperature on an orbital shaker. CM peptide-coated surfaces were removed after 40 min, washed twice with Milli-Q water and incubated in perchloric acid (2 mL) for 15 min. The absorbance of reaction solution was measured at 498 nm and the amount of amine group on the surface was estimated using extinction coefficient (70,000 M-1cm-1) of sulfo-SDTB.11 AMP-NPs were labeled with fluorescein isothiocyanate (FITC) by the reaction of AMP NPs (1 mg/mL, in phosphate buffer pH 8) with FITC (2 µM) for 24 h, at room temperature, in a dark environment. FITC-labeled AMP-NPs were magnetically separated and washed 3 times with phosphate buffer (pH 7.2) to remove non-conjugated FITC. 2.5. NP characterization. The size and morphology of SPION and bare NPs were analyzed using transmission electron microscopy (TEM; CM200 TEM, Phillips) equipped with an AMT 2 × 2 CCD camera at an accelerating voltage of 200 kV. The sample preparation was carried out by sonicating the samples for 5 min followed by drop casting on a copper grid. The average NP diameter and the standard deviation were calculated by counting approximately 200 NPs. Phase analysis was performed by a Philips X’pert conventional X-ray diffractometer (XRD), in Bragg-Brentano geometry, using Co Kα (λ1=1.788 Å) radiation and operating at 35 mA, 40 kV and with 2θ range of 10-100°. The XRD peaks of NPs were converted to XRD peaks corresponds to Cu Kα source using PowDLL converter, version 2.53.0.0. Additionally, the phase identification in the XRD spectra was conducted using JCPDS-2000 software and the International Center for Diffraction Data (ICDD) database. UV–Vis absorption spectra were recorded using an Uvikon 945 UV-Vis spectrophotometer. The chemical structure of the materials was analyzed by Fourier transform infrared-attenuated total reflection spectroscopy (FTIR-ATR, Equinox 55 Bruker, Germany). Magnetization of the samples at variable temperature was measured using a vibrating sample magnetometer (VSM, Gwynedd, U.K.) with a sensitivity of 10-4 emu and magnetic field up to 4 Oe. 7 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Particle sizes were also determined using Dynamic Light Scattering via Zeta PALS Zeta Potential Analyzer and Zeta Plus Particle Sizing Software, v. 2.27 (Brookhaven Instruments Corporation). NPs suspended in PBS or cell culture medium (endothelial growth factor-2 media (EGM-2) or Dulbecco’s Modified Eagle’s Medium (DMEM) containing 2% and 10% fetal bovine serum (FBS), respectively) and sonicated for short times (< 10 min) were used. Typically, all sizing measurements were performed at 25°C, and all data were recorded at 90°, with an equilibration time of 5 min and individual run times of 60 s (5 runs per measurement). The average diameters described in this work are number-weighted average diameters. The zeta potential of NPs was determined in a KCl solution (1 mM, pH 6 solution), at 25°C. All data were recorded with at least 6 runs with a relative residual value (measure of data fit quality) of 0.03. 2.6. Antimicrobial test. E. coli (ATCC 25922) and S. aureus (ATCC 6538) were grown in lysogeny broth (LB) media while being shaken at 150 rpm for 12 h at 37°C. Part of the bacterial suspension (100 µL) was transferred to a vial containing 5 mL of LB media and incubated for 2 h at 37°C to get mid logarithmic phase growth of bacteria. Finally, the bacterial suspension was diluted using a phosphate buffer saline (PBS, pH 7.2) to achieve 105 bacteria/mL. The number of bacterial colonies was determined using optical density at 600 nm. Bare NPs (8 µg/mL), soluble CM (5 µg/mL) and different concentrations of AMP-NPs (1, 2 and 4 µg/mL) were incubated with 105 bacteria/mL at 37°C in an orbital shaker at 150 rpm speed. An aliquot of E. coli was taken at different times of incubation (0, 30, 60, 90, 120, 240 min) and serially diluted in LB media and plated on LB agar plates. LB plates were incubated at 37°C incubator for 24 h before the visible colonies on plates were counted. Similarly, NPs with CM directly attached (1 µg/mL; CM_no spacer_NPs) were tested against both bacteria as described above. 1, 2 and 4 µg/mL of AMP-NPs have 0.4, 0.8 and 1.6 µg/mL of the immobilized CM peptide, respectively, according to the CM quantification. 8 ACS Paragon Plus Environment

Page 8 of 39

Page 9 of 39

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


2.7. Recyclability of AMP-NPs. AMP-NPs (20 µg/mL) were incubated with E. coli (5 mL of 105 E. coli/mL) for 1 h at 37°C in the orbital shaker. At the end of incubation, an aliquot was taken, serially diluted and plated on LB agar plate. AMP-NPs were magnetically collected and washed with PBS. The recycled NPs were again incubated with 105 E. coli/mL as described above and the procedure was repeated another 3 times. In a separate experiment, the AMPNPs (20 µg/mL), after being incubated for 1 h with E. coli, were collected and then incubated with S. aureus (105 S. aureus/mL) for 1 h. At the end, an aliquot was taken and serially diluted and plated on LB agar plate. 2.8. TEM analyses. E. coli (107 cells/mL) were incubated with AMP-NPs (4 µg/mL) or bare NPs (8 µg/mL) at 37°C, under gentle agitation for 4 h. After incubation time, bacteria suspension was centrifuged at 4,000 rpm for 5 min (to remove the NPs), and fixative (2.5% glutaraldehyde in PBS 0.1 M) was added to the pellet for 2 h at 4ºC. After this step, the fixed cells were centrifuged at 4,000 rpm for 5 min followed by washing twice with PBS 0.1 M. The samples were then post-fixed with 1% OsO4 and 0.8% C6N6FeK4 in 0.1M PBS for 2 h at room temperature, washed with PBS 0.1 M, and finally dehydrated (in a graded concentration of acetone). The dehydrated samples were then embedded in resin and sliced in blocks for visualization. A Tecnai Spirit microscope (FEI, Eindhoven, Netherlands) equipped with a LaB6 cathode was used. Images were acquired at 120 kV and room temperature with a 1376 × 1024 pixel CCD camera (FEI, Eindhoven, Netherlands). 2.9. Scanning electron microscopy (SEM) analyses. Samples were processed as described in section 2.8 until post fixation. Then, samples were dried using the method of critical point. Later, they were mounted on microscope holders with the help of a conductive tape. Finally, samples have been coated with a thin layer of carbon in order to improve their electrical conductivity. For this study, we have used Emitech K850 Critical Point Dryer, Emitech K950X Carbon Evaporator and a J-7100F Scanning Electron Microscope (Jeol). 9 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 10 of 39

2.10. Cell culture. Human umbilical vein endothelial cells (HUVECs, Lonza, USA) were cultured in EGM-2 media (Lonza; containing 2% FBS), while mouse macrophage cell line J774A.1 (CLS Cell Lines Service GmbH, Germany) was cultured in DMEM (Sigma) supplemented with 10% (v/v) of FBS (Gibco, Grand Island, USA) and 1% (v/v) penicillin/streptomycin (Lonza). HUVECs between passage 3 and 7 and J774A.1 cells between passage 40 and 45 were used in the entire work. For all assays, HUVECs and J774A.1 were seeded at a density of 4×104 cells/cm2 and 1.1×105 cells/cm2, respectively. 2.11. Quantification of NP internalization. HUVECs and J774A.1 were seeded in 6-well plates and cultured for 24 h. Bare NPs or AMP-NPs (100 µg/mL) suspended in serumcontaining medium were incubated with cells for 4 h or 24 h. After incubation, cells were washed three times with PBS to remove non-internalized NPs. Cells were then harvested (using trypsin 0.2% (w/v) in PBS, for HUVECs, and a cell scrapper for J774A.1), centrifuged, counted and resuspended in a nitric acid solution (1 mL, 69%, v/v). After acidic digestion, samples (n=2) were diluted to 4 mL in milli-Q water and 56Fe was quantified by ICP-MS. 2.12. Permeability measurements in large unilamellar vesicles (LUVs). The lipids 1palmitoyl, 2-oleoyl-sn-glycero-3-phosphocholine (POPC), 1-palmitoyl-2-oleoyl-sn-glycero-3phosphoserine (POPS), 1-palmitoyl, 2-oleoyl-sn-glycero-3-phosphoethanolamine (POPE), 1,2-dipalmitoyl-sn-glycero-3-phospho-(1'-rac-glycerol)(DPPG), egg-sphingomyelin (SpM) and cholesterol (Chol) were purchased from Avanti Polar Lipids. To estimate the permeability of liposomes, carboxyfluorescein (CBF, 25 mM) encapsulated LUVs were incubated with AMP-NPs, bare NPs or soluble CM and the leakage of CBF was monitored over time using a Cary Eclipse fluorescence spectrophotometer (Varian) equipped with a thermostatted multicell holder accessory. Liposomes mimicking the bacterial membrane (POPE/DPPG, 4:1, molar

ratio),

the

outer

(POPC/SpM/Chol,

1:1:1

molar

ratio)

and

the

inner

(POPC/Chol/POPE/POPS, 4:3:2:1 molar ratio) leaflet of the erythrocyte membrane were prepared by extrusion through polycarbonate filters with a pore size of 100 nm as previously 10 ACS Paragon Plus Environment

Page 11 of 39

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


described.12 After the separation of the non-capsulated dye from the liposomes using a sephadex G75 column with PBS as eluent, the liposomes were maintained on ice and used immediately. To ensure that at the beginning of each experiment LUVs suspensions have approximately the same lipid concentration, LUVs were diluted with the known volume of PBS so that the final absorption value would be approximately similar to 1 mM control solution of POPC LUVs. The leakage measurements were started with 500 µL of CBFencapsulated LUVs (with approximately 1 mM of lipid). The stability of fluorescent signal of LUVs was obtained before adding AMP-NPs or soluble CM. AMP-NPs, bare NPs or soluble CM (100 µL of stock solution) were added in 500 µL of CBF-encapsulated LUVs solution to obtain the final concentration of 200 µg/mL for AMP-NPs and bare NPs and 50 µg/mL for the soluble CM. The measurements were performed in a quartz cell at 25°C with the excitation and emission wavelengths of 490 and 520 nm, respectively. The % CBF leakage at a given time was obtained from the equation given below. IF(t) is the fluorescence intensity at a time t, IF(0) is the initial fluorescence intensity of liposomes and IFmax is the final fluorescence intensity of liposomes upon treatment with Triton X-100. The fluorescence signals were corrected with dilution factor. ⎛ IF (t ) − IF (0) ⎞ %CBFLeakage = ⎜ ⎟ × 100 ⎝ IF max − IF (0) ⎠

2.13. Cellular uptake of NPs by confocal microscopy. HUVECs were plated on a gelatincoated microscope slide (µ-slide angiogenesis, Ibidi, Germany) and left to adhere overnight before adding NPs labeled with FITC (all at 100 µg/mL) in EGM-2 medium. After 4 or 24 h, cells were washed three times 5 min with DMEM containing 10% (v/v) FBS. Endosomes were stained with Lysotracker Red DND-99 (Invitrogen, 1:20 000 in medium) for 20 min, at 37ºC, following the recommendations of the dye manufacturer. Then, cells were fixed with paraformaldehyde (4% (v/v)) for 15 min, at room temperature, and washed two times with PBS. After blocking (PBS solution having 1% BSA and 0.3 M glycine) for 30 min, cells were 11 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 12 of 39

incubated with mouse anti-human CD31 antibody (Dako, dilution 1:50) for 60 min, washed two times 5 min with PBS and incubated with Dylight 649 conjugated donkey anti-mouse IgG (BioPortugal, dilution 1:200) for 60 min. Unbound antibody was removed by washing two times 5 min with PBS before staining with DAPI (Sigma, 1 µg/mL in PBS) for 5 min. Coverslips were mounted and analyzed by confocal microscopy. The confocal images were processed by Image J to assess the co-localization of NPs with endolysosomes. Initially, the confocal images were divided in four-color channels and the channels 2 (green, NPs) and 3 (red, lysotracker) were used for the colocalization studies. The contrast of the images was enhanced (0.2% saturated pixels) and the images were analyzed using the JACoP plugin.13 The threshold was adjusted to highlight all the colored pixels, to match the original channel image. Given these parameters, the JACoP plugin calculated the Manders' coefficient M1 (green pixels colocalized with red pixels), which was used in the bar graph. 2.14. Cell viability and apoptosis. HUVECs and J774A.1 cells were cultured in a 96-well plate for 24 h, after which they were exposed to different concentrations (0 to 200 µg/mL) of soluble CM, bare NPs, AMP-NPs, or Molday Ion NPs (BioPAL Inc.). 5, 25, 100 and 200 µg/mL of AMP-NPs have 2, 10, 40 and 80 µg/mL immobilized CM peptides, respectively (see Section 3) After 24 h, ATP production was quantified using the CellTiter-Glo® luminescent cell viability assay (Promega), according to the supplier instructions. For annexin V/propidium iodide (PI) assay, cells were seeded in 24-well plates and cultured for 24 h. After the incubation time with soluble CM and NPs, the medium with the detached cells was collected and the adherent cells rinsed with PBS and harvested. Both cells were then mixed and centrifuged at 300 g for 3 min. Cells were then resuspended in binding buffer containing Annexin-V-FITC (Molecular Probes, 150 µL containing 3 µL of Annexin V-FITC conjugate) and incubated in the dark at room temperature for 15 min. Finally, the cells were stained with 12 ACS Paragon Plus Environment

Page 13 of 39

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


PI (1 µg/mL final concentration) prior the analysis with the flow cytometer (FACS Calibur, BD Biosciences). 2.15. Effect of NPs on cell membrane potential. HUVECs were seeded in 24-well plates and cultured for 24 h. Soluble CM, bare NPs or AMP-NPs suspended in serum containing medium were then added to cells. After 24 h incubation, cells were harvested, resuspended in medium with 5 nM of DiOC5(3) and incubated for 5 min at room temperature in the dark, prior to the analysis with the flow cytometer (FACS Calibur, BD Biosciences). Cells treated with gramicidin (10 µM) or valinomycin (10 µM) were used as controls for cell depolarization and hyperpolarization, respectively. 2.16. Pro-inflammatory response in macrophages. J774A.1 cells were seeded in 24-well plates and cultured for 24 h. Bare NPs, AMP-NPs, or Molday Ion NPs were suspended in culture medium (100 µg/mL) and incubated with cells for 4 h. Afterwards, cell culture medium was collected for secretomic analysis (Bio-Plex analysis) while cells were harvested for gene expression analysis. Cells incubated with lipopolysaccharide (LPS; 10 ng/mL, 6 h) were used as a positive control. For secretomic analyses, quantification of TNF-α and IL-6 secretion was performed using a multiplex immunoassay (Bio-Plex Pro™ Mouse Cytokine, Bio-Rad), according to supplier’s instructions. For gene expression analyses, RNA was extracted using TRIzol® (Ambion) and RNAeasy mini kit (Qiagen), and cDNA was obtained from 1 µg RNA using TaqMan® reverse transcription reagents (Invitrogen), according to supplier’s instructions. Gene expression levels of TNF-α, IL-6, IL-1β and NOS2 (normalized to β-actin) were quantified with Power SYBR® green PCR master mix using a 7500 fast realtime PCR system (Applied Biosystems, Foster City, USA). Specific primer pairs were GTCTCAGCCTCTTCTCATT

and

ACCTGTCTATACCACTTCAC GCTCCGAGATGAACAACA

and and

AACAATACAAGATGACCCTAAG

CCATTTGGGAACTTCTCATC

for

GGCAAATTTCCTGATTATATCCA

TNF-α, for

IL-6,

GAGAATATCACTTGTTGGTTGA

for

IL-1β,

and

for

NOS2,

GCAAGTGAAATCCGATGT 13

ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 14 of 39

GAGCAAGAGAGGTATCCT and CTCAAACATGATCTGGGTC for β-actin, forward and reverse, respectively. Thermal cycling conditions were 30 s at 94°C, 30 s at 60°C and 33 s at 72 °C, for 40 cycles, followed by a melting curve. 2.17. NP internalization by human peripheral blood. Peripheral blood from a healthy donor was diluted (1:2) with RPMI medium. Diluted blood (250 µL) was incubated for 4 h, at 37ºC and 5% CO2, with bare NPs or AMP-NPs conjugated to FITC (in both cases at 100 µg/mL). Afterwards, the immunophenotype was performed with CD45-Pacific Blue (DakoCytomation, Denmark), CD20-APC-H7, CD14-PerCP-Cy5.5, HLA-DR-APC (BD Biosciences, USA), CD16-PE and CD33-PC7 (Beckman Coulter, USA), for 10 min at room temperature in the dark. After staining, erythrocytes were lysed (FACS lysing buffer, BD; 2 mL, 10 min, room temperature, dark) and cells were washed with PBS prior to cytometer acquisition in the flow cytometer (FACS Canto II, BD Biosciences). Infinicyt™ software, v.1.5 (Cytognos SL, Spain), was used for the identification of classic monocytes (CD14+/CD16-/HLADR+/CD33high/CD45high), monocytes CD16+ (CD14+/CD16+/HLA-DR+/CD33high/CD45high), CD16+CD14-/low dendritic cells (CD16+/CD14-/low/HLA-DRinter/CD33inter/CD45high), myeloid dendritic cells (HLA-DRhigh/CD33high/CD14-/CD45inter/CD16-), B cells (CD20+/HLADR+/CD33-/CD14-/CD45high) and neutrophiles (CD16+/CD14-/HLA-DR-/CD33inter/CD45inter) and quantification of the percentage of NP-FITC+ cells (i.e. percentage of cells, within each population, with internalized NPs). The blood had the following sub-population percentages: 47% of neutrophiles, 4.5% of B cells, 3.4% of classic monocytes, 0.08% of monocytes CD16+, 0.05% of myeloid dendritic cells and 0.12% of CD16+CD14-/low dendritic cells.

3. Results and Discussion 3.1. Preparation of SPION@Au core-shell (bare) NPs and immobilization of CM peptide


Page 15 of 39

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


To prepare bare NPs, initially we have synthesized cubic-shaped SPIONs with an average diameter of 9 ± 2 nm (n=200), using a micro-emulsion methodology previously described by us (Figure 1A1).9 High-resolution transmission electron microscopy (HRTEM) image shows (311) lattice plane of Fe3O4 (Figure 1A2). Selective area electron diffraction (SAED) pattern also demonstrates (422), (620), (622), (642), (822) and (844) lattice planes of Fe3O4, indicating the formation of SPIONs (Figure 1A3). FTIR spectrum of SPIONs shows bands at 621 and 577 cm-1 which can be attributed to the vibrational stretching of Fe-O bonds of magnetite with iron in tetrahedral sites for Fe2+– O2- and Fe3+–O2- bonds respectively (spectrum 1, Figure 1B).14 These SPIONs were then reacted with APTES followed by modification with CS2 (Figure 1C) to yield dithiocarbamate moieties. These moieties act as ligands to cap SPIONs with homogeneous Au coatings. CS2 molecule has superior affinity to Au when compared to regular alkanethiols, as its interatomic S-S distances are nearly ideal for epitaxial adsorption onto Au surfaces.15 The FTIR spectrum of SPIONs functionalized with APTES has the characteristic amine bands at 1266, 1635 and two overlapped bands at 3180 and 3370 cm-1 corresponding to the stretching vibration of C-N, bending and asymmetric stretching vibrations of N-H, respectively (spectrum 2, Figure 1B). The characteristic band of Si-O-Si bonds shows up at 1059 cm-1 (spectrum 2, Figure 1B). The Fe-O characteristic bands of SPIONs upon functionalization shifted to higher wavenumbers and appeared as a broad and overlapped peaks at 667 and 643 cm-1 in spectrum 2 and spectrum 3 respectively (Figure 1B). This phenomenon is due to the formation of Fe-O-Si bonds in coated SPIONs with a characteristic band at 895 cm-1 (Figure 1B).16 The formation of dithiocarbamate layers on SPIONs is confirmed by the presence of C-S and C=S bonds at 660 and 1050-1200 cm-1, respectively (spectrum 3, Figure 1B). Since these two bands are strongly overlapped with characteristic bands of Fe-O and Si-O-Si, the formation of dithiocarbamate moieties are further substantiated regarding compositions by elemental analysis (Table S1).17 The analysis of CHNS elements demonstrates an increase in sulfur 15 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 16 of 39

content after modification with dithiocarbamate as compared to bare SPIONs and APTES functionalized SPIONs. The estimated loading of dithiocarbamate on APTES functionalized SPIONs is 14 mmol mg-1. The coating of dithiocarbamate-functionalized SPIONs was followed by reduction of the gold salt (Au3+) to form bare NPs (Figure 1C). Despite the coalescence behavior of gold layer18, the average diameter of the bare NPs is 12 ± 2 nm (n=200) and the NPs change their morphology from cubic to quasi-spherical shapes (Figures 1A1 and 1D1). The thickness of the gold layer was theoretically estimated as 3 nm by considering Au3+ concentration for complete and conformal coating of Fe3O4 NPs having 10 nm of average diameter, according to the method described previously.9 The gold layer is thin and shows up lighter than the Fe3O4 core (Figure 1D2), because mass contrast dominates over diffraction contrast despite of higher electron density of Au as compared to Fe3O4.19 Moreover, the interplanar spacing measured for the shell corresponds to the known Au (111) lattice fringes and those measured for the core are in good agreement with the Fe3O4 (311) lattice fringes (Figures 1A2 and 1D2). Also, the SAED patterns indicate crystalline phases for both SPIONs and bare NPs, with ring patterns analogous to those observed with XRD data (Figures 1A3, 1D3 and 2A). XRD pattern of bare NPs shows diffraction peaks (2θ) at 38.2°, 44.3°, 64.67° and 77.54°, which can be indexed to (111), (200), (220) and (311) lattice planes of face centered cubic (FCC) Au respectively (spectrum 2, Figure 2A). The absence of any diffraction peaks belonging to the magnetic core of bare NPs as compared to the diffraction peaks of SPION alone (cf. Figure 2A) is due to the heavy atom effect originated by Au regular shell on SPIONs.19 Finally, UV-Vis spectroscopy was employed to characterize the bare NPs (Figure 2B). These NPs have a surface plasmon resonance (SPR) band at 548 nm (spectrum 3) while Au NPs synthesized by the borohydride method have a SPR band at 528 nm (spectrum 1, Figure 2B). The red shift and broadening of the SPR band on bare NPs relatively to Au NPs also indicates the formation of core-shell NPs (Figure 2B), which is in agreement with 16 ACS Paragon Plus Environment

Page 17 of 39

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


previous studies.19-21 Taken together, our results show that we have developed a relatively simple methodology to prepare bare NPs. Although bare NPs have been prepared before, the methodologies reported required high temperatures19, 22, organic solvents19, 22 and multi-step processes, making these platforms less suitable for large scale production of these NPs. To immobilize CM at the surface of bare NPs, we firstly reacted the NPs with cystamine, in order to create terminal amine groups on the surface of the NPs, followed by the reaction with the heterobifunctional crosslinker sulfo-GMBS (Figure 2C). FTIR results show that bare NPs after reaction with cystamine have an amine band at 1650 cm-1 and the absence of bending vibrations of SH group of cystamine at 760 cm-1 (spectrum 1, Figure 2D). Cystamine functionalized NPs further modified by sulfo-GMBS shows the disappearance of the amine band at 1650 cm-1 and the appearance of a new band at 1760 cm-1, which corresponds to C=O functional group of GMBS (spectrum 2, Figure 2D). CM peptide immobilized on sulfo-GMBS NPs (AMP-NPs) shows the characteristic amide-I (C=O stretching mode) and II bands (N-H bending mode) at 1650 and 1520 cm-1, respectively, which suggests the covalent immobilization of CM peptide (spectrum 3, Figure 2D). CM peptide having thiol group at C-terminus interacts covalently with maleimide functional group of sulfo-GMBS to form a stable thioether bond. AMP-NPs have good optical and magnetic properties. The results obtained by UVVis spectroscopy show that the SPR band of Au shell was shifted from 560 nm to 580 nm after functionalization with CM peptide (Figure 2E). It is likely that this shift is associated with a low level of aggregation or the change in dielectric environment of gold shell.20 Vibration magnetometric measurements were also performed to analyze the magnetic behavior of SPIONs at different stages of functionalization (Figures 2F and 2G). Figure 2F shows the magnetic hysteresis behavior of SPION, bare NPs and AMP-NPs. The maximum magnetization values (66 emu.g-1) of SPIONs decreased with coating of Au layer (10 emu.g1

) and subsequently functionalization with CM peptide (6.9 emu.g-1), which could be due to 17 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 18 of 39

the decreased coupling of the magnetic moments as a result of the increased inter-particle spacing of magnetic cores upon formation of the Au shells for bare NPs and contribution of overall mass from non-magnetic Au and CM peptide.19,23,24 SPION and bare NPs have paramagnetic properties while AMP-NPs show hysteresis at room temperature (Inset in Figure 2F).24 An increased coercivity was also observed for bare NPs and AMP-NPs at near zero magnetization, which could be attributed to the increase in interparticle distance of magnetic core upon the formation of the non-magnetic Au shell. The coercivity of SPIONs is inversely related to particle size and less effective coupling of dipole moment of magnetic NPs.23-25 Figure 2G shows both zero-field-cooled (ZFC) and field-cooled (FC) magnetization curves as a function of temperature for SPION, bare NPs and AMP-NPs. The ZFC curves have a peak at the blocking temperature, at Tb = 81 K, 18.4 K and 18.1 K for SPION, bare NPs and AMP-NPs, respectively. Of great importance is the fact that SPIONs exhibit superparamagnetic behavior after each stage of coating below Tb, suggesting that core-shell NPs after coatings with CM peptide can be useful in biological applications. 3.2. Antimicrobial properties of AMP-NPs Next, we evaluated the antimicrobial properties of AMP-NPs against Gram-positive (S. aureus) and Gram-negative (E. coli) bacteria. No survival was observed for E. coli (Figure 3A) and S. aureus (Figure 3B) treated with 1 and 4 µg/mL of AMP-NPs, respectively, for 1 h. This antimicrobial activity was due to the immobilized CM since bare NPs at a concentration of 8 µg/mL were unable to kill 100% of the bacteria population after 6 h of incubation. Therefore, the minimum inhibitory concentration (MIC) of AMP-NPs for E. coli and S. aureus was 1 and 4 µg/mL, respectively. The amount of immobilized CM peptide on NPs was 0.4 mg in 1 mg of NPs as measured by the sulfosuccinimidyl 4-(4,4-dimethoxytrityl)butyrate (sulfo-SDTB) method.11 Therefore this means that the MIC of the immobilized peptide for E. coli was 0.4 µg/mL. Under the same testing conditions the MIC of soluble CM was 5 µg/mL 18 ACS Paragon Plus Environment

Page 19 of 39

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(Figures 3A and 3B). Therefore, our results show that a low concentration of CM peptide on the NP system is suitable to kill E. coli. To study the antimicrobial mechanism of AMP-NPs we have performed SEM and TEM analyses. SEM images show protrusions (indicated by violet arrows) and multiple blisters (indicated with red arrows) in bacteria membrane after incubation with AMP-NPs for 4 h, while no damage is observed for bacteria treated with bare NPs (Figure 3D). The appearance of blisters has been described before for other AMPs belonging to the cathelicidin family.26,27 It is possible that positively charged AMP-NPs replaced Mg2+ ions from LPS layer on the outer membrane of bacteria and destabilized outer surface, leading to penetration of AMP-NPs and therefore locally disrupted the inner membrane, which in turn caused cytoplasmic materials to fill the periplasmic space and the formation of blisters. Signs of bacterial membrane damage after treatment with AMP-NPs were also observed by TEM images (Figure 4). Cross-sectional analyses of bacteria shows that AMP-NP-treated bacteria (Figure 4C) have numerous electron dense materials (black spots in TEM images) in periplasmic space as compared with bacteria alone (Figure 4A) and bare NP- treated bacteria (Figure 4B). This is consistent with previous observations showing the accumulation of electron density material in bacteria cells treated with AMPs. 28,29 Overall, our SEM and TEM results indicate that AMP-NPs damage bacteria membrane. The antimicrobial activity of CM depends on the length of spacer between CM and the NP. CM_no spacer_NPs (1 µg/mL) showed reduced antimicrobial activity even when the amount of attached peptide (0.7 mg of peptide per 1 mg of core-shell NPs) is higher than the one obtained previously for CM attached through cystamine and sulfo-GMBS (Figures 3A and 3B). Therefore, the 8-carbon spacer (formed by cystamine and sulfo-GMBS), between the Au shell and the CM peptide played an important role in maintaining the antimicrobial activity of the covalently immobilized peptide. Although some studies have shown that AMPs 19 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 20 of 39

can preserve their antimicrobial activity after immobilization to a surface without a spacer, in most cases full activity of the immobilized AMP was only observed if a spacer was used.30 In our case a 8-carbon spacer was enough to show the antimicrobial activity of CM; however, the size of the spacer is likely dependent on AMP since in some cases 2-carbon spacers were enough to maintain the activity of the AMPs while in other cases the size of the spacer affected substantially the activity of the AMP.30 AMP-NPs can be easily recycled owing to their fast response to an external magnetic field. AMP-NPs (20 µg/mL) were exposed to 1 ×105 cells of E. coli for 1 h, after which the NPs were isolated by a magnet, washed with PBS and finally reused in another cycle of activity. The antimicrobial efficiency of the NPs remained at 100% up to four cycles (maximum number of cycles tested) (Figure 3C). The same batch of AMP-NPs after being recovered from E. coli suspension (1st cycle) can inhibit the growth of S. aureus, and thereby showing that AMP-NPs can be used to kill a mixed culture of both Gram-positive and Gramnegative bacteria (Table S2). 3.3. Cytotoxicity of AMP-NPs Initially, we studied the zeta potential, size and stability of bare NPs and AMP-NPs in cell culture medium (DMEM medium supplemented with 10% FBS for J774A.1 cells; EGM2 containing 2% FBS for HUVECs) by dynamic light scattering (DLS). It is known that NP sedimentation increases cellular internalization and likely their cytotoxicity31. Although bare and AMP-NPs are positively charged when resuspended in PBS, they are negatively charged after resuspension in cell culture medium due to formation of biomolecule corona on the surface of NPs (Figure S1A). Bare NPs tend to aggregate in EGM-2 medium but not in DMEM medium; however, sedimentation was observed in both media (Figure S1B). In contrast, AMP-NPs do not aggregate for at least 24 h either in DMEM or EGM-2 media; however, they tend to sediment overtime. The sedimentation kinetic depends on the initial 20 ACS Paragon Plus Environment

Page 21 of 39

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


concentration of the NPs and culture medium. For a concentration of 100 µg/mL (concentration used in most of our cell culture experiments), more than 50% of the initial NPs remained in suspension after 3-4 h (Figure S1B). FITC-labeled AMP-NPs (100 µg/mL, used for some studies) have similar stability profile as to non-labeled AMP-NPs, in both EGM2 and DMEM media (Figure S1C). Next, we evaluated the cytotoxicity of the AMP-NPs (Figure 5A). Following intravenous administration, most NPs are rapidly taken up by cells of the mononuclear phagocyte system, while others are endocytosed by endothelial cells, lining the lumen of blood vessels. The mononuclear phagocyte system comprises dendritic cells, blood monocytes and tissue-resident macrophages. J774A.1 cells and HUVECs were selected as models for macrophages and endothelial cells respectively. A large amount of AMP-NPs is internalized by mammalian cells and accumulates preferentially in endolysosomes. HUVECs and J774A.1 cells were exposed to bare NPs or AMP-NPs (100 µg/mL) for 4 and 24 h and the uptake of NPs by both cells was monitored by inductively coupled plasma mass spectrometry (ICP-MS). HUVECs internalized higher concentration of NPs (between 60 and 170 pg of NPs per cell) than J774A.1 (between 18 and 36 pg of NPs per cell) (Figure 5B). The internalization of the NPs occurred essentially during the first 4 h since no significant increase was observed after 24 h. The level of internalization obtained for NPs with or without CM was higher than superparamagnetic iron oxide nanoparticles (Molday NPs, 35 nm), typically used for biomedical applications.32,33 Confocal microscopy results confirm that NPs were predominantly located within the cell and not adhered to the cell surface (Figure 6A). At 24 h, more than 60% of the NPs inside the cells are located in endolysosomes (Figure 6B). Furthermore, the results confirm that more AMP-NPs are internalized than bare NPs. The higher internalization is likely due to the capacity of cationic peptides to interact efficiently with mammalian cell membranes.34 The internalization process is likely mediated by 21 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 22 of 39

endocytosis, as observed in the internalization of other AMPs 34 and the confinement of most of the NPs in the endolysosomal compartment. To assess the biological effect of NPs, cell metabolism was assessed by ATP production and cell viability by flow cytometry using annexin V/ PI staining. Small effect (below 20%) in ATP production or cell viability (Figures 5C-E and Figure S2) was observed for both type of cells exposed to NPs (5 to 200 µg/mL of AMP-NPs correspond to the immobilized concentration of CM between 2 to 80 µg/mL) for 24 h. However, soluble CM at concentrations above 25 or 100 µg was highly cytotoxic against HUVECs and J774A.1 cells, respectively (Figures 5C and 5E). In case of HUVECs, apoptosis is the predominant death pathway for moderate concentrations of CM in solution (as an increase in late apoptosis was observed at 25 µg/mL) while necrosis is the predominant pathway for high concentrations (100 and 200 µg/mL) (Figure 5D). We complemented these studies by measuring the impact of soluble CM and AMPNPs on cell membrane potential. For that purpose, we labeled cell membranes with 3,3´dipentyloxacarbocyanine iodide (DiOC5(3)), a charged lipophilic dye that emits a fluorescent signal proportional to the membrane potential.35 As controls, we used gramicidin (10 µM), a non-selective ionophore that causes cell depolarization, and valinomycin (10 µM), a K+ ionophore that causes cell hyperpolarization (Figure 7A.1). HUVECs become hyperpolarized after 24 h exposure to soluble CM at concentrations below 100 µg/mL, while depolarized for concentrations above 100 µg/mL (Figure 7A.2). On the other hand, the membrane potential of HUVECs is not altered for bare NPs up to concentrations of 200 µg/mL (Figure 7A.3); however, cells exposed to AMP-NPs show a slight depolarization for concentrations of 200 µg/mL (Figure 7A.4). Overall, our results show that AMP-NPs are substantially non-cytotoxic up to 200 µg/mL (50 times the MIC of AMP-NPs against S. aureus). For the same concentration of soluble CM (up to 80 µg/mL), AMP-NPs have less cytotoxicity and impact 22 ACS Paragon Plus Environment

Page 23 of 39

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


on membrane potential than soluble AMP (see below for mechanism).

3.4. Hemocompatibility of AMP-NPs A strategy for the delivery of the antimicrobial NPs is by injection into the bloodstream with subsequent control of their fate by a magnetic field. Such approach has been used in the design of drug delivery systems.36,37 Initially, we evaluated the internalization of the NPs conjugated with FITC by leukocytes. Upon 4 h of contact, cells were characterized by flow cytometer (Figure 7B and Figure S3). We monitored NP internalization in phagocytic competent cells (approximately 55% of the total number of leukocytes) such as classic monocytes, monocytes CD16+, CD16+CD14-/low dendritic cells, myeloid dendritic cells, B cells and neutrophiles (Figure 7B and Figure S3). The remaining cells (non-phagocytic T cells and NK cells) had little capacity to internalize NPs (only 1% of the cells were labeled with NPs) and were not considered in this study. A large amount of AMP-NPs (zeta potential of – 10.6 ± 1.5 mV) was internalized by monocytes (2-fold), B cells (>20-fold) and neutrophiles (4-fold) than bare NPs (zeta potential of – 14.7 ± 2.8 mV), while no significant difference was observed in dendritic cells (Figure 7B). To understand whether the internalization profile was different from other NPs, we compared the results obtained for AMP-NPs with Molday magnetic NPs.32,33 Our results show that monocytes (classic and CD16+) and CD16+CD14-/low dendritic cells and neutrophiles internalized higher levels of Molday NPs than AMP-NPs or bare NPs (Figure 7B). Because a larger amount of AMP-NPs is internalized by monocytes as compared to bare NPs, we decided to investigate their pro-inflammatory effect in the macrophage cell line J774A.1. Gene expression of the pro-inflammatory cytokines TNF-α, IL-1β and IL-6 and the inducible nitric oxide synthase (NOS2) was evaluated in cells treated with bare NPs, AMPNPs and Molday NPs (Figure 8A). Cells treated with E. coli LPS, a pro-inflammatory agent, were used as a positive control. No statistical differences were observed for non-treated cells 23 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 24 of 39

and cells treated with bare NPs or AMP-NPs (100 µg/mL for 4 h), showing that the presence of AMP does not induce a pro-inflammatory response in J774A.1 macrophages. We further confirmed these results at protein level, specifically for the secretion of TNF-α and IL-6, confirming that our NPs are substantially non-inflammatory (Figure 8B).

3.5. Insights about the effect of AMP-NPs against bacterial membrane but not eukaryotic cells It is known that AMPs such as magainins or cecropins act preferentially on bacterial cells while other AMPs act in both bacteria and eukaryotic cells.30,38,39 Bacterial selectivity is believed to be correlated with the ability of AMPs to discriminate between different membrane types.39-41 Therefore, we studied the effect of AMP-NPs, bare NPs and soluble CM in the permeability of negatively charged LUVs with a lipid composition mimicking the bacterial membrane (1-palmitoyl, 2-oleoyl-sn-glycero-3-phosphoethanolamine (POPE): 1,2dipalmitoyl-sn-glycero-3-phospho-(1'-rac-glycerol)(DPPG)

80:20).12

To

estimate

the

permeability of LUVs, they were loaded with CBF and the leakage of CBF was monitored by spectrophotometry. CBF is self-quenched in intact LUVs at the high concentration (25 mM) used in the experiment. Disruption of the membrane by AMPs allows CBF to be released from LUVs, eliminating the self-quenching effect and consequently the increase in the fluorescence. This method has been widely used to demonstrate membrane integrity.42,43 Our results show that AMP-NPs (200 µg/mL) disturb the membrane integrity, which leads to 40% CBF leakage from vesicles within 15 min, while no effect is observed for the bare NPs (Figure 9A). On the other hand, 50 µg/mL of soluble CM, which is 10 times higher than MIC of CM peptide against E. coli, also rapidly damage LUVs (Figure 9A). Next, we studied the effect of soluble CM and AMP-NPs on the permeability of LUVs with membrane compositions mimicking the inner (IM) and outer (OM) leaflets of 24 ACS Paragon Plus Environment

Page 25 of 39

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


erythrocyte cells.12 AMP-NPs (200 µg/mL) do not significantly affect the structural integrity of both OM and IM of erythrocytes (Figure 9B), while soluble CM (50 µg/mL) destabilizes both the IM and OM membranes. In addition, more leakage of CBF is observed after stronger electrostatic interaction of cationic AMP peptides with the negatively charged IM in comparison with a lesser negatively charged OM. This result shows that the soluble peptide interacts strongly with erythrocyte lipid membranes as compared to the AMP-NPs, leading to a higher leakage of the CBF upon disruption of the membrane. It is possible that soluble CM peptides, having higher degree of freedom to adopt secondary conformations, interact strongly with membrane while immobilized CM peptides have not such degree of freedom. This expectation is somehow confirmed by a significant decrease in the membrane potential (depolarization) after the exposure of mammalian cells to soluble CM peptides (Figure 7A.2) but not AMP-NPs (Figure 7A.4). It is also likely that the variations in LUV compositions of both bacteria and erythrocyte membranes play an important role in the binding and mechanism of soluble CM and AMP-NP.39-41 This issue deserves further investigation in the near future.

4. Conclusions Here, we have synthesized SPION@Au core shell NPs functionalized with CM that have a diameter of 12 ± 2 nm, a zeta potential of +24.2 ± 3.5 mV (in PBS), and 0.4 mg of CM per 1 mg of NPs. The AMP-NPs have a lower MIC than soluble CM (0.4 versus 5 µg/mL) likely due to the synergetic effect of multiple CM peptides on the surface of the NP. AMPNPs are highly internalized by endothelial and macrophage cells and accumulate primarily in the endolysosomal compartment. They are relatively non-cytotoxic for concentrations up to 200 µg/mL and do not exert an inflammatory reaction once internalized by macrophages. Therefore, the magnetic antimicrobial nanomaterial developed in this work opens new 25 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 26 of 39

opportunities for infection site targeting, useful for multiple therapeutic applications.

Acknowledgments This work was funded by FEDER through the Program COMPETE and by Portuguese fund through FCT in context of the project PTDC/Qui-Qui/105000/2008. The work was also funded by COMPETE in the context of the project “Stem cell based platforms for Regenerative and Therapeutic Medicine” (Centro-07-ST24-FEDER-002008). AR wishes to thank FCT for a BPD fellowship (SFRH/BPD/73211/2010). Supporting information: Supplementary tables for CHNS analysis and for recyclability study of NPs, stability and zeta potential of bare NPs, AMP-NPs and FITC labeled AMP-NPs in EGM2 and DMEM media, Annexin V/PI test of HUVECs in the presence of FITC labeled AMP-NPs and flow cytometer data of AMP-NPs internalized leukocyte cells. This material is available free of charge via the Internet at http://pubs.acs.org.

References: (1) Armstead, A. L. and Li, B. Y., Nanomedicine as an Emerging Approach Against Intracellular Pathogens. Int. J. Nanomed. 2011, 6, 3281-3293. (2) Briones, E., Colino, C. I. and Lanao, J. M., Delivery Systems to Increase the Selectivity of Antibiotics in Phagocytic Cells. J. Control. Release 2008, 125, 210-227. (3) Busscher, H. J., Van der Mei, H. C., Subbiahdoss, G., Jutte, P. C., Van den Dungen, J. J., Zaat, S. A., Schultz, M. J. and Grainger, D. W., Biomaterial-Associated Infection: Locating the Finish Line in the Race for the Surface. Sci. Transl. Med. 2012, 4, 153rv10. (4) Taylor, E. N. and Webster, T. J., The Use of Superparamagnetic Nanoparticles for Prosthetic Biofilm Prevention. Int. J. Nanomed. 2009, 4, 145-152. (5) Subbiahdoss, G., Sharifi, S., Grijpma, D. W., Laurent, S., Van der Mei, H. C., Mahmoudi, M. and Busscher, H. J., Magnetic Targeting of Surface-Modified Superparamagnetic Iron Oxide Nanoparticles Yields Antibacterial Efficacy against Biofilms of Gentamicin-Resistant Staphylococci. Acta Biomater. 2012, 8, 2047-2055. (6) Hancock, R. E. and Sahl, H. G., Antimicrobial and Host-Defense Peptides as New Anti-Infective Therapeutic Strategies. Nat. Biotechnol. 2006, 24, 1551-1557. (7) Merrifield, R. B., Juvvadi, P., Andreu, D., Ubach, J., Boman, A. and Boman, H. G., Retro and Retroenantio Analogs of Cecropin-Melittin Hybrids. Proc. Natl. Acad. Sci. U. S. A. 1995, 92, 3449-3453. (8) Bhargava, K. and Feix, J. B., Membrane Binding, Structure, and Localization of Cecropin-Mellitin Hybrid Peptides: A Site-Directed Spin-Labeling Study. Biophys. J. 2004, 86, 329-336. 26 ACS Paragon Plus Environment

Page 27 of 39

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(9) Maleki, H., Simchi, A., Imani, M. and Costa, B. F. O., Size-Controlled Synthesis of Superparamagnetic Iron Oxide Nanoparticles and Their Surface Coating by Gold for Biomedical Applications. J. Magn. Magn. Mater. 2012, 324, 3997-4005. (10) Lee, C. C. Y. and Loudon, G. M., Quantitative Determination of Amino Groups on Derivatized Controlled Pore Glass: A Comparison of Methods. Anal. Biochem. 1979, 94, 6064. (11) Gabriel, M., Nazmi, K., Veerman, E. C., Nieuw Amerongen, A. V. and Zentner, A., Preparation of LL-37-Grafted Titanium Surfaces with Bactericidal Activity. Bioconjugate Chem. 2006, 17, 548-550. (12) Ziegler, A., Thermodynamic Studies and Binding Mechanisms of Cell-Penetrating Peptides with Lipids and Glycosaminoglycans. Adv. Drug Delivery Rev. 2008, 60, 580-597. (13) Bolte, S. and Cordelieres, F. P., A Guided Tour into Subcellular Colocalization Analysis in Light Microscopy. J. Microsc. 2006, 224, 213-232. (14) Pedrosa, J., Costa, B. F. O., Portugal, A. and Duraes, L., Controlled Phase Formation of Nanocrystalline Iron Oxides/Hydroxides in Solution - an Insight on the Phase Transformation Mechanisms. Mater. Chem. Phys. 2015, 163, 88-98. (15) Zhao, Y., Perez-Segarra, W., Shi, Q. C. and Wei, A., Dithiocarbamate Assembly on Gold. J. Am. Chem. Soc. 2005, 127, 7328-7329. (16) Bini, R. A., Marques, R. F. C., Santos, F. J., Chaker, J. A. and Jafelicci, M., Synthesis and Functionalization of Magnetite Nanoparticles with Different Amino-Functional Alkoxysilanes. J. Magn. Magn. Mater. 2012, 324, 534-539. (17) Khdary, N. H. and Ghanem, M. A., Highly Dispersed Platinum Nanoparticles Supported on Silica as Catalyst for Hydrogen Production. RSC Adv. 2014, 4, 50114-50122. (18) Wang, Y. Q., Liang, W. S. and Geng, C. Y., Coalescence Behavior of Gold Nanoparticles. Nanoscale Res. Lett. 2009, 4, 684-688. (19) Robinson, I., Tung, L. D., Maenosono, S., Walti, C. and Thanh, N. T. K., Synthesis of Core-Shell Gold Coated Magnetic Nanoparticles and Their Interaction with Thiolated DNA. Nanoscale 2010, 2, 2624-2630. (20) Aslam, M., Fu, L., Su, M., Vijayamohanan, K. and Dravid, V. P., Novel One-Step Synthesis of Amine-Stabilized Aqueous Colloidal Gold Nanoparticles. J. Mater. Chem. 2004, 14, 1795-1797. (21) Lyon, J. L., Fleming, D. A., Stone, M. B., Schiffer, P. and Williams, M. E., Synthesis of Fe Oxide Core/Au Shell Nanoparticles by Iterative Hydroxylamine Seeding. Nano Lett. 2004, 4, 719-723. (22) Lee, W. R., Kim, M. G., Choi, J. R., Park, J. I., Ko, S. J., Oh, S. J. and Cheon, J., Redox-Transmetalation Process as a Generalized Synthetic Strategy for Core-Shell Magnetic Nanoparticles. J. Am. Chem. Soc. 2005, 127, 16090-16097. (23) Boal, A. K., Frankamp, B. L., Uzun, O., Tuominen, M. T. and Rotello, V. M., Modulation of Spacing and Magnetic Properties of Iron Oxide Nanoparticles through Polymer-Mediated "Bricks and Mortar" Self-Assembly. Chem. Mater. 2004, 16, 3252-3256. (24) Kumar, C. S. S. R. and Mohammad, F., Magnetic Gold Nanoshells: Stepwise Changing of Magnetism through Stepwise Biofunctionalization. J. Phys. Chem. Lett. 2010, 1, 3141-3146. (25) Vestal, C. R. and Zhang, Z. J., Atom Transfer Radical Polymerization Synthesis and Magnetic Characterization of MnFe2O4/Polystyrene Core/Shell Nanoparticles. J. Am. Chem. Soc. 2002, 124, 14312-14313. (26) Skerlavaj, B., Benincasa, M., Risso, A., Zanetti, M. and Gennaro, R., Smap-29: A Potent Antibacterial and Antifungal Peptide from Sheep Leukocytes. FEBS Lett. 1999, 463, 58-62. (27) Tiozzo, E., Rocco, G., Tossi, A. and Romeo, D., Wide-Spectrum Antibiotic Activity of Synthetic, Amphipathic Peptides. Biochem. Biophys. Res. Commun. 1998, 249, 202-206. 27 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 28 of 39

(28) Ferreira, L.; Langer, R. S.; Loose, C. R.; O´Shaughnessy, W. S.; Stephanopolous, G.; Zumbuehl, A. Medical Devices and Coatings with Non-Leaching Antimicrobial Peptides In PCT, editor. 2008. (29) Ibrahim, E. H., Sherman, G., Ward, S., Fraser, V. J. and Kollef, M. H., The Influence of Inadequate Antimicrobial Treatment of Bloodstream Infections on Patient Outcomes in the ICU Setting. Chest. 2000, 118, 146-155. (30) Steiner, H., Hultmark, D., Engstrom, A., Bennich, H. and Boman, H. G., Sequence and Specificity of Two Antibacterial Proteins Involved in Insect Immunity. Nature 1981, 292, 246-248. (31) Cho, E. C., Zhang, Q. and Xia, Y., The Effect of Sedimentation and Diffusion on Cellular Uptake of Gold Nanoparticles. Nat. Nanotechnol. 2011, 6, 385-391. (32) Yilmaz, A., Dengler, M. A., van der Kuip, H., Yildiz, H., Rosch, S., Klumpp, S., Klingel, K., Kandolf, R., Helluy, X., Hiller, K. H., Jakob, P. M. and Sechtem, U., Imaging of Myocardial Infarction Using Ultrasmall Superparamagnetic Iron Oxide Nanoparticles: A Human Study Using a Multi-Parametric Cardiovascular Magnetic Resonance Imaging Approach. Eur. Heart J. 2013, 34, 462-475. (33) Corot, C., Robert, P., Idee, J. M. and Port, M., Recent Advances in Iron Oxide Nanocrystal Technology for Medical Imaging. Adv. Drug Delivery Rev. 2006, 58, 1471-1504. (34) Hopp, L., RNS President's Message: 'Simple Does' Is Not 'as Simple Is'. Perspect. Respir. Nurs. 1995, 6, 8. (35) Yount, N. Y., Kupferwasser, D., Spisni, A., Dutz, S. M., Ramjan, Z. H., Sharma, S., Waring, A. J. and Yeaman, M. R., Selective Reciprocity in Antimicrobial Activity Versus Cytotoxicity of Hbd-2 and Crotamine. Proc. Natl. Acad. Sci. U. S. A. 2009, 106, 14972-14977. (36) Teply, B. A., Tong, R., Jeong, S. Y., Luther, G., Sherifi, I., Yim, C. H., Khademhosseini, A., Farokhzad, O. C., Langer, R. S. and Cheng, J., The Use of ChargeCoupled Polymeric Microparticles and Micromagnets for Modulating the Bioavailability of Orally Delivered Macromolecules. Biomaterials 2008, 29, 1216-1223. (37) Arruebo, M., Fernandez-Pacheco, R., Ibarra, M. R. and Santamaria, J., Magnetic Nanoparticles for Drug Delivery. Nano Today 2007, 2, 22-32. (38) Katsu, T., Kuroko, M., Morikawa, T., Sanchika, K., Fujita, Y., Yamamura, H. and Uda, M., Mechanism of Membrane Damage Induced by the Amphipathic Peptides Gramicidin S and Melittin. Biochim. Biophys. Acta 1989, 983, 135-41. (39) Glukhov, E., Stark, M., Burrows, L. L. and Deber, C. M., Basis for Selectivity of Cationic Antimicrobial Peptides for Bacterial Versus Mammalian Membranes. J. Biol. Chem. 2005, 280, 33960-33967. (40) McHenry, A. J., Sciacca, M. F., Brender, J. R. and Ramamoorthy, A., Does Cholesterol Suppress the Antimicrobial Peptide Induced Disruption of Lipid Raft Containing Membranes? Biochim. Biophys. Acta 2012, 1818, 3019-3024. (41) Matsuzaki, K., Sugishita, K., Fujii, N. and Miyajima, K., Molecular Basis for Membrane Selectivity of an Antimicrobial Peptide, Magainin 2. Biochem. 1995, 34, 34233429. (42) Barbet, J., Machy, P., Truneh, A. and Leserman, L. D., Weak Acid-Induced Release of Liposome-Encapsulated Carboxyfluorescein. Biochim. Biophys. Acta 1984, 772, 347-356. (43) Hashizaki, K., Taguchi, H., Sakai, H., Abe, V., Saito, Y. and Ogawa, N., Carboxyfluorescein Leakage from Poly(Ethylene Glycol)-Grafted Liposomes Induced by the Interaction with Serum. Chem. Pharm. Bull. 2006, 54, 80-84.


Page 29 of 39

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 1. Morphological characterization of NPs. TEM (A.1), HRTEM (A.2) images and selective area diffraction patterns (A.3) of SPIONs. (B) FTIR spectra of SPIONs (spectrum 1), SPIONs functionalized with APTES (spectrum 2) followed by CS2 (spectrum 3). (C) Schematic representation of the chemical steps required to make bare NPs. TEM (D.1), HRTEM (D.2) images and selective area diffraction pattern (D.3) of bare NPs.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 30 of 39

Figure 2. Physico-chemical characterization of NPs. (A) XRD spectra of SPIONs (spectrum 1) and bare NPs (spectrum 2). JCPDS data of Au and Fe3O4 is also shown. (B) UVVis spectra of Au NPs synthesized using sodium borohydride (spectrum 1), SPIONs (spectrum 2) and bare NPs (spectrum 3). (C) Schematic representation of the chemical steps to immobilize CM onto bare NPs. (D) FTIR spectra of cystamine functionalized bare NPs (spectrum 1) followed by modification with sulfo-GMBS (spectrum 2) and CM peptide (spectrum 3). (E) UV-vis spectra of bare NPs (spectrum 1) followed by functionalization with cystamine (spectrum 2) and CM peptide (spectrum 3). (F-G) Hysteresis (F) and ZFC/FC (G) measurements of SPIONs (curve 1), bare NPs (curve 2) and AMP-NPs (curve 3).


Page 31 of 39

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 3. Antimicrobial activity of AMP-NPs. (A) Time course antimicrobial activity of soluble CM (MIC of CM peptide is 5 µg/mL), AMP-NPs (1 to 4 µg/mL), bare NPs (8 µg/mL), or CM_no spacer_NPs (1 µg/mL) against 1 × 105 E. coli (A) or S. aureus (B). (C) Antimicrobial activity of NPs after several cycles of reuse (n=1). (D) SEM images of E. coli treated with AMP-NPs (4 µg/mL; D.1 and D.2) or bare NPs (8 µg/mL; D.3 and D.4) for 4 h. Red and purple arrows indicate blisters-like structures and protrusions of membrane, respectively. Scare bar for D.1 is 100 nm and for D.2 to D.4 is 1000 nm.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 32 of 39

Figure 4. TEM analyses of bacteria exposed to AMP-NPs. TEM images of E. coli (A), E. coli treated with 8 µg/mL of bare NPs (B) and 4 µg/mL of AMP-NPs (C) for 4 h. Orange stars indicate electron dense materials.


Page 33 of 39

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 5. Internalization and cytotoxicity of AMP-NPs. (A) Schematic representation of the analyses performed to characterize the cytotoxicity of different NPs. (B) ICP-MS quantification of NPs (100 µg/mL) uptake by HUVECs and J774A.1 after 4 and 24 h. Results are Mean ± SEM, n=2. HUVECs metabolism (C) was assessed by ATP evaluation while HUVECs viability (D) was assessed by flow cytometry using annexin V/PI staining (live 33 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 34 of 39

cells: annexin-/PI-; early apoptotic: annexin+/PI-; late apoptotic: annexin+/PI+; necrotic: annexin-/PI+). Carbonyl cyanide m-chlorophenyl hydrazone (CCCP, 100 µg/mL, 1 h), a compound that interferes with mitochondrial function, was used as apoptotic agent (positive control). HUVECs were exposed for 24 h to different concentrations of soluble CM (C.1, D.1), bare NPs (C.2, D.2), AMP-NPs (C.3, D.3) and Molday NPs (C.4, D.4). Results are average ± SEM, n=3. Macrophage cells were exposed for 24 h to different concentrations of soluble CM (E.1), bare NPs (E.2), AMP-NPs (E.3) and Molday NPs (E.4), followed by the quantification of ATP by an ATP kit. Results are average ± SEM, n=3.


Page 35 of 39

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 6. Intracellular localization of NPs as assessed by confocal microscopy. (A) Cells were incubated with FITC-conjugated bare NPs or FITC-conjugated AMP-NPs (100 µg/mL) for 4 or 24 h. After incubation the cells were washed to remove NPs not taken up by cells, and the endolysosomes, cell membrane and nuclei were stained with Lysotracker Red DND-99, anti-human CD31 and DAPI, respectively. Bar corresponds to 20 µm. (B) Percentage of 35 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 36 of 39

colocalization of NPs with endolysosomes (stained with lysotracker). Results are mean ± SEM, n=4.

Figure 7. Membrane potential of endothelial cells after exposure to AMP-NPs and NP internalization by human peripheral blood leukocytes. (A) Alterations on HUVEC membrane potential upon exposure to gramicidin or valinomycin (10 µM, A.1) and to different concentrations of soluble CM (A.2), bare NPs (A.3) or AMP-NPs (A.4) for 24 h. Results are Mean ± SEM, n=3. * and *** denotes statistical significance of P

High Antimicrobial Activity and Low Human Cell Cytotoxicity of Core

Recommend Documents