High-Performance Genetic Analysis on Microfabricated Capillary Array

Sciences, The University of Tokushima, CREST, JST, Shomachi, Tokushima 770-8505, Japan, CREST, Japan Science and. Technology Corporation ...
0 downloads 0 Views 522KB Size
Download PDF
Anal. Chem. 2005, 77, 2140-2146

High-Performance Genetic Analysis on Microfabricated Capillary Array Electrophoresis Plastic Chips Fabricated by Injection Molding Fuquan Dang,*,† Osamu Tabata,‡ Masaya Kurokawa,§ Ashraf A. Ewis,† Lihua Zhang,| Yoshihisa Yamaoka,† Shouji Shinohara,⊥ Yasuo Shinohara,† Mitsuru Ishikawa,† and Yoshinobu Baba†,|,#

Single-Molecule Bioanalysis Laboratory, National Institute of Advanced Industrial Science and Technology (AIST), Hayashi-cho 2217-14, Takamatsu 761-0395, Japan, Department of Mechanical Engineering, Graduate School of Engineering, Kyoto University, Yoshida Honmachi, Sakyo-ku, Kyoto 606-8501, Japan, Starlite Co. Ltd., Kusatsu 520-3004, Japan, Department of Molecular and Pharmaceutical Biotechnology, Graduate School of Pharmaceutical Sciences, The University of Tokushima, CREST, JST, Shomachi, Tokushima 770-8505, Japan, CREST, Japan Science and Technology Corporation, Kawaguchi Center Building, 4-1-8 Honcho, Kawaguchi-shi, Saitama 332-0012, Japan, and Department of Applied Chemistry, Graduate School of Engineering, Nagoya University, Furo-cho, Chikusa-ku, Nagoya 464-8603, Japan

We have developed a novel technique for mass production of microfabricated capillary array electrophoresis (µ-CAE) plastic chips for high-speed, high-throughput genetic analysis. The µ-CAE chips, containing 10 individual separation channels of 50-µm width, 50-µm depth, and a 100-µm lane-to-lane spacing at the detection region and a sacrificial channel network, were fabricated on a poly(methyl methacrylate) substrate by injection molding and then bonded manually using a pressure-sensitive sealing tape within several seconds at room temperature. The conditions for injection molding and bonding were carefully characterized to yield µ-CAE chips with well-defined channel and injection structures. A CCD camera equipped with an image intensifier was used to monitor simultaneously the separation in a 10-channel array with laserinduced fluorescence detection. High-performance electrophoretic separations of OX174 HaeIII DNA restriction fragments and PCR products related to the human β-globin gene and SP-B gene (the surfactant protein B) have been demonstrated on µ-CAE plastic chips using a methylcellulose sieving matrix in individual channels. The current work demonstrated greatly simplified the fabrication process as well as a detection scheme for µ-CAE chips and will bring the low-cost mass production and application of µ-CAE plastic chips for genetic analysis. The draft sequence of the human genome completed in early 2001 was undoubtedly the crowning achievement of bioanalysis * To whom correspondence should be addressed. E-mail: [email protected]. phone: +81-87-869-4104. Fax: +81-87-869-4113. † National Institute of Advanced Industrial Science and Technology. ‡ Kyoto University. § Starlite Co. Ltd. | The University of Tokushima. ⊥ CREST, Japan Science and Technology Corp. # Nagoya University.

2140 Analytical Chemistry, Vol. 77, No. 7, April 1, 2005

so far.1,2 With the availability of the human genome sequence, increasing emphasis has been focused on technologies for single nucleotide polymorphism analysis, functional genomics, and mutation analysis. These technologies are fundamental to fast genetic diagnosis and form the basis for forensic identification and paternity determination.3 In all the cases, the quality and cost of the data generated is related to the sensitivity, fidelity, throughput, and cost characteristics of analysis systems. Accordingly, further development of analytical technology is urgently required for rapid genetic analysis.4 Microchip capillary electrophoresis (µ-CE) has shown a variety of attractive advantages for DNA analysis, including high-speed separation, minimal sample/reagent consumption, and integration potential.5-10 The inherent characteristic of µ-CE devices is the ability for performing parallel analyses of multiple samples on a microchip to increase throughput. High-throughput analysis is highly desirable for many biological analyses, especially for genetic and proteomic analysis, and for drug discovery. Microfabricated capillary array electrophoresis (µ-CAE) chips coupled with confocal scanning detection systems developed by Mathies and coworkers11-13 have shown a powerful potential in high-throughput (1) Venter, J. C.; et al. Science 2001, 291, 1304-1351. (2) International Human Genome Sequencing Consortium. Nature 2001, 409, 860-921. (3) Baba, Y. Anal. Bioanal. Chem. 2002, 372, 14-15. (4) Zhang, L. H.; Dang, F. Q.; Baba, Y. J. Pharm. Biomed. Anal. 2003, 30, 1645-1654. (5) Zhang, C. X.; Manz, A. Anal. Chem. 2001, 73, 2656-2662. (6) Chiem, N.; Harrison, D. J. Anal. Chem. 1997, 69, 373-378. (7) Khandurina, J.; McKnight, T. E.; Jacobson, S. C.; Waters, L. C.; Foote, R. S.; Ramsey, J. M. Anal. Chem. 2000, 72, 2995-3000. (8) Zhang, B.; Foret, F.; Karger, B. L. Anal. Chem. 2000, 72, 1015-1022. (9) Zhang, L. H.; Dang, F. Q.; Baba, Y. Electrophoresis 2002, 23, 2341-2346. (10) Blom, M. T.; Chmela, E.; Oosterbroek, R. E.; Tijssen, R.; van den Berg, A. Anal. Chem. 2003, 75, 6761-6768. (11) Woolley, A. T.; Sensabaugh, G. F.; Mathies, R. A. Anal. Chem. 1997, 69, 2181-2186. (12) Simpson, P. C.; Roach, D.; Woolley, A. T.; Thorsen, T.; Johnston, R.; Sensabaugh, G. F.; Mathies, R. A. Proc. Natl. Acad. Sci. U.S.A. 1998, 95, 2256-2261. 10.1021/ac0485031 CCC: $30.25

© 2005 American Chemical Society Published on Web 02/09/2005

genetic analysis. Recently, several improvements have been explored to increase the performance of µ-CAE devices using optically gated injection technique, an acoustooptic deflectionbased laser beam scanning detection technique, and a CCD-based transmission imaging spectrograph.14-16 Four-color DNA sequencing with an average read length of 460 bp with 99% accuracy has been achieved on 16-channel µ-CAE microchips within 17 min using a laser-excited galvoscanner.17 Silica-based materials have been a preferred choice for the fabrication of µ-CAE chips so far, because the photolithography technology used for silicon materials can be readily adapted to fabricate channel networks in a glass substrate. However, silica-based materials have limited potential in further miniaturization of channel width and cost reduction because the fabrication technology typically utilized, i.e., photolithography, wet etching combined with thermal bonding, is a lowyield, time-consuming, and thus expensive process.18 The cost of producing glass µ-CE devices has led to increasing use of polymer materials in the preparation of µ-CE devices. Compared to silica-based materials, polymers are less expensive and easier to use in mass production of µ-CE devices with replicate techniques such as imprinting, hot embossing, and injection molding at a cost-effective basis.19-21 Several polymers such as poly(dimethylsiloxane),22,23 poly(methyl methacrylate) (PMMA),24-26 and polycarbonate27 are explored in fabrication of replica µ-CE devices. However, the fabrication of high-density µ-CAE plastic chips by the replication process still remains challenging. To address this issue, we developed a novel technique for largevolume fabrication of µ-CAE plastic chips for high-throughput genetic analysis. The strategy involved development of moving mask deep X-ray lithography (M2DXL) technology28 to fabricate a 10-channel PMMA master chip with a slight inclination of channel sidewalls. Then, the µ-CAE chips with a high-aspect ratio (13) Medintz, I.; Wong, W. W.; Berti, L.; Shiow, L.; Torm, J.; Skolnick, J.; Sensabaugh, G. F.; Mathies, R. A. Genome Res. 2001, 11, 413-421. (14) Xu, H.; Roddy, T. P.; Lapos, J. A.; Ewing, A. G. Anal. Chem. 2002, 74, 55175522. (15) Huang, Z.; Munro, N.; Huhmer, A. F. R.; Landers, J. P. Anal. Chem. 1999, 71, 5309-5314. (16) Simpson, P. C.; Ruiz-Martinez, M. C.; Mulhern, G. T.; Berka, J.; Latimer, D. R.; Ball, J. A.; Rothberg, J. M.; Went, G. T. Electrophoresis 2000, 21, 135149. (17) Liu, S.; Ren, H.; Gao, Q.; Roach, D. J.; Loder, R. T. J.; Armstrong, T. M.; Mao, Q.; Blaga, I.; Barker, D. L.; Jovanovich, S. B. Proc. Natl. Acad. Sci. U.S.A. 2000, 97, 5369-5374. (18) Kaji, N.; Tezuka, Y.; Takamura, Y.; Ueda, M.; Nishimoto, T.; Nakanishi, H.; Horiike, Y.; Baba, Y. Anal. Chem. 2004, 76, 15-22. (19) Martynova, L.; Locasico, L. E.; Gaitan, M.; Kramer, G. W.; Christensen, R. G.; MacCrehan, W. A. Anal. Chem. 1997, 69, 4783-4789. (20) Xu, J.; Locascio, L. E.; Gaitan, M.; Lee, C. S. Anal. Chem. 2000, 72, 19301933. (21) Ford, S. M.; Kar, B.; McWhorter, S.; Davies, J.; Soper, S. A.; Klopf, M.; Calderon, G.; Saile, V. J. Microcolumn Sep. 1998, 10, 413-422. (22) Muck, A., Jr.; Wang, J.; Jacobs, M.; Chen, G.; Chatrathi, M. P.; Jurka, V.; Vyborny, Z.; Spillman, S. D.; Sridharan, G.; Schoning, M. J. Anal. Chem. 2004, 76, 2290-2297. (23) McDonald, J. C.; Duffy, D. C.; Anderson, J. R.; Chiu, D. T.; Wu, H.; Schueller, O. J. A.; Whitesides, G. M. Electrophoresis 2000, 21, 27-40. (24) Effenhauser, C. S.; Bruin, G. J. M.; Paulus, A.; Ehrat, M. Anal. Chem. 1997, 69, 3451-3457. (25) Dang, F. Q.; Zhang, L. H.; Jabashini, M.; Kaji, N.; Baba, Y. Anal. Chem. 2003, 75, 2433-2439. (26) Dang, F. Q.; Zhang, L. H.; Hagiwara, H.; Mishina, Y.; Baba, Y. Electrophoresis 2003, 24, 714-721. (27) Liu, Y.; Ganser, D.; Schneider, A.; Liu, R.; Grodzinski, P.; Kroutchinina, N. Anal. Chem. 2001, 73, 4196-4201. (28) Tabata, O.; You, H.; Shiraishi, H.; Nakanishi, H.; Nishimoto, T.; Yamamoto, K.; Baba, Y. Proc. µTAS 2000, 143-146.

channel array of 50-µm width, 50-µm depth, and 100-µm lane-tolane spacing were fabricated by injection molding without obvious imperfections. The bonding of µ-CAE chips was achieved by manual lamination of a pressure-sensitive sealing tape at room temperature. High-performance electrophoretic separations of φX174 HaeIII DNA restriction fragments and PCR products were successfully demonstrated on replica µ-CAE PMMA chips with laser-induced fluorescence detection. EXPERIMENTAL SECTION µ-CAE Chip Design and Fabrication. The fabrication procedure for production of µ-CAE plastic chips is shown in Figure 1. The µ-CAE chips with 10 independent separation channels and 31 reservoirs of 2.0 mm in diameter were fabricated in a 27 mm × 65 mm PMMA plastic substrate by injection molding. The channels were designed to have a rectangular cross section with 50-µm width, 50-µm depth, and 100-µm pitch at detection point. The distances from the channel crossing point to the centers of reservoirs 1-4 were 7.5, 3.0, 1.5, and 55 mm, respectively. To obtain a nickel mold for plastic injection molding, we developed a M2DXL technology28 to fabricate a 10-channel PMMA master chip with a channel sidewall inclination of 85° via a precise mask movement controlled by a computer (step 1 in Figure 1A). An automated electroplating apparatus was developed to form a thin Ni seed layer on the PMMA master chip by electroless plating, followed by electroplating of Ni with a thickness of several millimeters (step 2 in Figure 1A). The replica µ-CAE plastic chips with well-defined channel and intersection structures were successfully fabricated by injection molding using a superprecision injection molding machine (UH1000-60/TM, Nissei Plastic Industrial Co. Ltd., Hanishina, Japan) (step 3 in Figure 1A). The optical grade PMMA (Sumitomo Chemical Co. Ltd., Tokyo, Japan) was used for injection molding. The injection molding conditions were as follows: cavity temperature of 110 °C, core temperature of 95 °C, injection pressure of 150 MPa, and cooling time of 60 s. The sealing of µ-CAE plastic chips was done manually by lamination of a pressure-sensitive sealing sheet (3M advanced polyolefin microplate sealing tape, 3M Co.) within seconds at room temperature (step 4 in Figure 1A). Reagents and Samples. A φX174 HaeIII digest (Takara Shuzo Co., Ltd., Shiga, Japan) and a 100-bp DNA ladder (GenSura Laboratories, Inc., Del Mar, CA) were used to evaluate the performance of plastic µ-CAE chips. All DNA samples were diluted to predefined concentrations using DNase- and RNase-free water (ICN Biomedicals, Inc.). A 50 mM boric acid-Tris buffer containing 3-4% MC (Sigma Chemical Co., St. Louis, MO) and 10-6 M YO-PRO-1 (Molecular Probes, Eugene, OR) was used as a separation medium. PCR for SP-B Polymorphism. The SP-B gene segments derived from chromate lung cancer samples and from blood samples of normal individuals were analyzed to investigate the relationship between the polymorphism of SP-B gene and the susceptibility to the development of chromate-related lung cancer among Japanese chromate workers. For all lung cancer samples, DNA was extracted from formalin-fixed, paraffin-embedded specimens by proteinase K treatment, phenol-chloroform extraction, and ethanol precipitation. For controls, DNA was extracted from blood samples using Generation capture disk kits (Gentra Systems, Tokyo, Japan). The concentration of template DNA was Analytical Chemistry, Vol. 77, No. 7, April 1, 2005

2141

Figure 1. (A) Schematic of injection molding fabrication and lamination bonding processes. (B) Ten-channel µ-CAE chip design. (C-F) SEM images of the separation and injection channels, reservoirs and a sacrificial channel network fabricated on a PMMA substrate by injection molding. (G) Optical image of separation channels of a bonded µ-CAE chip filled with red ink. The separation channels were 50 µm wide and 50 µm deep, and the sacrificial channels were 100 µm wide and 50 µm deep.

adjusted for all samples to be at 100 ng/µL. The SP-B gene segments were amplified in 20-µL PCR reaction mix containing 67 mM Tris-HCl (pH 8.3), 16.6 mM (NH4)2SO4, 3 mM MgCl2, 1 mM dNTPs, 1 unit of Taq gold DNA polymerase, and 0.25 µM of each primer (SP-B sense, CTGGTCATCGACTACTTCCA; SP-B antisense, TGTGTGTGAGAGTGAGGGTGTAAG) by 30 cycles of PCR (94, 59, and 72 °C for 0.5, 1.0, and 1.0 min, respectively). These cycles were followed by a final extension step at 72 °C for 10 min. PCR for β-Globin Gene. Eight DNA fragments in the β-globin gene were amplified on LightCycler (Roche Diagnostics GmbH, Mannheim, Germany) using template DNA extracted from human blood samples and the human β-globin gene primer set (Takara Shuzo Co., Ltd., Shiga, Japan) under the above PCR conditions. 2142

Analytical Chemistry, Vol. 77, No. 7, April 1, 2005

All PCR products were kept at -20 °C and diluted 10 times with deionized water before use. Electrophoresis and Fluorescence Measurement. The CAE chip experiments were carried on the stage of an inverted fluorescence microscope (Olympus IX70, Olympus, Tokyo, Japan) using the 457-nm line of 5 mW from a diode solid-state laser (model 58-BLD-301, Melles Griot Laser Group, Carlsbad, CA) for excitation (Figure 2). A separation medium was introduced into all the microchannels through reservoir 4 using a syringe. All reservoirs on the microchip were filled with either matrix or sample by pipet prior to analysis. A HV488 high voltage sequencer (LabSmith) was used to provide voltages from 0 to 1500 V for CAE experiments. A laser beam was expanded into ∼2 cm using a set of expander optics and then focused vertically on the

Figure 2. Schematic of a laser-induced fluorescence detection system for a µ-CAE PMMA chip. The optical image shows a focused lineshape laser beam on the surface of a µ-CAE chip.

detection part of 10 separation channels using a cylindrical lens (f ) 150 mm; Melles Griot). The central part of the laser beam of ∼50-µm width and 1.0-mm length with nearly even energy distribution was used for excitation to minimize variation in excitation intensity among 10 channels. A 10×/0.3 NA objective lens (Olympus, Tokyo, Japan) and a 510-nm long-pass filter (HQ510lp, Chroma Technology Corp., Rockingham, VT) were used for fluorescence imaging. Fluorescence images of a DNA separation were captured by a CCD camera (C5985; Hamamatsu Photonics, Hamamatsu, Japan) equipped with an image intensifier (C8600; Hamamatsu Photonics), recorded on a hard-disk video recorder at an acquisition rate of 30 frames/s. The video images were analyzed later by an image-processing software (Aquacosmos 2.5, Hamamatsu Photonics). RESULTS AND DISCUSSION Figure 1A shows the schematic of the microfabrication and bonding processes. Significant strategies involved the development of M2DXL technology28 and the chip design with a sacrificial channel network. The M2DXL technology enables us to fabricate a master PMMA chip with a slight inclination of channel sidewalls and then build a Ni mold with a similar feature, which is crucial to avoiding a warp or imperfection in high-aspect ratio channels or wells typically encountered in the demolding step. A sacrificial channel network, designed to remove air bubbles and the accumulated adhesive during the bonding process, was incorporated to obtain the ideal sealing of replica PMMA chips using an adhesive sealing tape. Figure 1B shows the µ-CAE chip design with a 10 separation and injection channels of 50-µm depth and 50-µm width, 31 reservoirs of 2-mm diameter combined with a sacrificial channel network of 50-µm depth and 100-µm width. Figure 1C-F shows that a µ-CAE chip with above structures can be fabricated simultaneously on a PMMA substrate using the Ni mold built with M2DXL technology without obvious defects in 1 min when the inclination angle of channel sidewalls was in a range of 80-86°. Enclosure of the microfluidic channel network without any imperfection is required to perform electrophoresis on µ-CAE chips because any buffer leakage among channels or wells will

definitely lead to poor electrophoretic performance, no separation either in several channels or in all channels. The thermal bonding technique is a well-used technique for both glass and plastic µ-CE devices. However, this bonding technique, relying on hightemperature annealing by a gradual temperature ramp up to and then down from the soften temperature of materials used, is a slow and low-yield process. In addition, we found that the hightemperature treatment that allows bonding also tends to deform the high-aspect ratio microstructures, and more seriously, leakages are frequently found on µ-CAE plastic chips. Thus, several other bonding techniques including adhesive printing and lamination of an adhesive sealing tape were explored to achieve the ideal bonding of µ-CAE PMMA chips. Previous work29 shows that an adhesive on most lamination films tends to ooze into microchannels, block the fluidic flow, and interfere with separation. To prevent an adhesive from accumulating and oozing into the separation channels, a new µ-CAE chip design with a sacrificial channel network was proposed, and a pressure-sensitive sealing tape was explored for sealing of µ-CAE PMMA chips with complex structures. A sacrificial channel network with various widths was designed to expel air bubbles, receive the fallen adhesive, and release boundary tension generated in bonding process. After preliminary experiment, we found that the ideal bonding without leakage or blockage in separation channels was achieved by manual lamination of a pressure-sensitive adhesive tape at room temperature using a sacrificial channel network with the same depth and doubled width as separation channels (Figure 1G). The current work also demonstrates that only a thin wall of 50-µm width is enough to obtain the ideal sealing of µ-CAE PMMA chips. Therefore, space can be saved for more separation channels and reservoirs using a sacrificial channel network, allowing the further miniaturization of µ-CAE plastic chips. Until now, the confocal scanning fluorescence detection systems are widely used in monitoring separations on multichannels due to its high sensitivity. However, the scanning detection systems do suffer from fundamental limitations in maintenance (29) McCormick, R. M.; Nelson, R. J.; Alonso-Amigo, M. G.; Benvegnu, D. J.; Hooper, H. H. Anal. Chem. 1997, 69, 2626-2630.

Analytical Chemistry, Vol. 77, No. 7, April 1, 2005

2143

Figure 3. Fluorescent image of a separation of φX174 HaeIII NDA digest fragments (2.5 ng/µL) on a 10-channel µ-CAE PMMA chip. Conditions: Esep ) 120 V/cm; 0.4% MC in a 50 mM boric acid-Tris buffer containing 10-6 M YO-PRO-1.

Figure 4. Electropherograms of a separation of φX174 HaeIII NDA digest fragments (2.5 ng/µL) on a 10-channel µ-CAE PMMA chip derived from the image shown in Figure 3.

and manipulation, especially with µ-CAE chips containing a large number of separation channels. To avoid the mechanical moving parts, an ICCD camera combined with a line-shape laser beam was used to monitor separations in 10 separation channels simultaneously. A 457-nm laser beam was focused into a line-shape laser beam of ∼50-µm width and ∼2-cm length using a set of expander optics and a cylindrical lens, and only the central part with the minimal uneven energy distribution (the inset optical image in Figure 2) was used to illuminate separations in a 10-channel array. Figure 3 presents a fluorescence image of a separation of φX174 HaeIII DNA restriction fragments on a 10-channel µ-CAE plastic chip. All fragments of a φX174 HaeIII DNA digest were well separated within 200 s in all 10 channels, and no cross-talk was found between adjacent channels. The 2144 Analytical Chemistry, Vol. 77, No. 7, April 1, 2005

fluorescence intensities were determined randomly among 10 channels, mainly caused by the nonuniform amounts of injected samples, indicating the uneven energy distribution of the laser beam at the central part is negligible. Compared with the scanning detection systems, the present detection approach is much more simple in manufacture and operation and capable of monitoring a more density channel array with a 100% duty cycle. Here, the duty cycle is defined as a fraction of the time that analyte in any channel is illuminated. Because only limited by detector readout rate, the data acquisition rate was quite high, thus enabling highthroughput electrophoresis. Figure 4 presents the electropherograms of φX174 HaeIII DNA restriction fragments generated from the image in Figure 3. The migration times were consistent with relative standard deviation

Figure 5. Electropherograms of a fast separation of PCR products related to the human β-globin gene and a 100-bp DNA ladder on a 10channel µ-CAE PMMA chip. Conditions: Esep ) 120 V/cm; 0.3% MC in a 50 mM boric acid-Tris buffer.

Figure 6. Electropherograms of a fast separation of PCR products related to SP gene and a 100-bp DNA ladder on a 10-channel µ-CAE PMMA chip. Conditions: Esep ) 120 V/cm; 0.3% MC in a 50 mM boric acid-Tris buffer.

values (RSD) of less than 1.99% in all 10 channels. Separation performance of µ-CAE plastic chips was obviously better than our previous reports using the commercially available single-channel PMMA chips;9 e.g., baseline resolution of φX174 HaeIII DNA restriction fragments was achieved in all 10 channels, the resolution of 271- and 281-bp fragments was 1.28 ( 0.17 (N ) 10), and the resolution of 1078- and 1353-bp fragments was 1.33 ( 0.19 (N ) 10). Fluorescent intensities of identical fragments in a φX174 HaeIII DNA restrict were relatively consistent from channel to channel, exhibiting the smallest RSD of 20.9% (N ) 10) for the 271-bp fragment, while the largest one of 29.1% (N ) 10) for the 827-bp fragment. The variations in both migration times and

fluorescent intensities were comparable to those obtained on µ-CAE glass chips.11-13 There are various kinds of mutations in the human β-globin gene, and some of them are related to genetic diseases such as β-thalassemia.30 A fast analysis method for the human β-globin gene is of significance in clinical diagnostics. In the current work, the analysis of eight fragments in the human β-globin gene was finished within 16 min using only 3 µL of human blood sample: 5 min for the extraction and purification, 9 min for microscale PCR, and 2 min for the confirmation of PCR products. Figure 5 (30) Kukreti, R.; Dash, D.; Chakravarty, S.; Das, S. Kr.; De, M.; Talukder, G. Am. J. Hematol. 2002, 70, 269-277.

Analytical Chemistry, Vol. 77, No. 7, April 1, 2005

2145

represents the electropherograms of eight fragments in the β-globin gene and a 100-bp DNA ladder on a µ-CAE plastic chip. Simultaneous analysis of eight fragments in the human β-globin gene was finished within 100 s with 0.3% methylcellulose (MC) as the sieving matrix, according to an analysis rate of 10 s/sample. This performance demonstrates the potential capability of µ-CAE plastic chips for rapid analysis of biologically relevant samples. The surfactant protein system (SP), composed of several members such as SP-A, -B, -C, and -D, is very important for normal lung function, for mediating local airway conditions, and in the clearance of the upper respiratory tract from the occupational and environmental dusts.31 Thus, SP genes may represent good candidates in the study of etiologic factors and susceptibility for lung cancer. Seifart et al.32 reported the SP-B intron 4 variants may enhance susceptibility to squamous cell carcinoma (SCC) of lungs of German patients. We also hypothesize that SP-B gene variants may be associated with increased risk for developing lung cancer in general and in chromate-exposed workers because more than 90% of chromate lung cancer are of the SCC pathological type.33 We analyzed polymorphism of the SP-B gene in the chromate-related lung cancer samples and their matched controls using µ-CAE plastic chips. Figure 6 exhibits the representative electropherograms of polymorphism analysis of the SP-B gene in samples from the chromate-related lung cancer in Japanese patients and from healthy Japanese individuals. Wild type of SP-B gene exhibits a fragment at ∼600 bp, while the variants show two fragments, insertion at ∼700 bp and deletion at ∼350 bp, respectively. The fragment of 300 bp detected in channels 1 and 2 was the glyceraldehyde-3-phosphate dehydrogenase gene, serving as a control for the procedure of DNA extraction and PCR amplification. Wild-type SP-B was detected in channels 5 and 6, deletion variants with a fragment of 346 bp in channels 3 and 4, and insertion variant with a fragment of 716 bp in channel 7. The (31) Stringer, B.; Kobzik, L. Am. J. Respir. Cell. Mol. Biol. 1996, 14, 155-160. (32) Seifart, C.; Seifart, U.; Plagens, A.; Wolf, M.; Von Wichert, P. Br. J. Cancer 2002, 87 (2), 212-217. (33) Ewis, A.; Kondo, K.; Lee, J.; Tsuyuguchi, M.; Hashimoto, M.; Yokose, T.; Mukai, K.; Kodama, T.; Shinka, T.; Monden, Y.; Nakahori, Y. Am. J. Ind. Med. 2001, 40, 92-97.

2146

Analytical Chemistry, Vol. 77, No. 7, April 1, 2005

genotypes in channels 8 and 9 were found to be heterozygous cases, having the wild-type SP-B allele (600 bp) with a deletion variant (355 bp) and the wild-type SP-B allele (600 bp) with an insertion variant (716 bp), respectively. Our results suggest that SP-B gene may be involved in mechanisms that enhance cancer susceptibility in lungs of workers who are exposed to chromaterelated processes. The CAE genotyping analysis using plastic microchips will provide a rapid and cost-effective method for rapid population screening of diseases with genetic susceptibility. CONCLUSIONS A µ-CAE PMMA chip with a 10-channel array, 31 wells, and a sacrificial channel network was successfully fabricated by injection molding and then bonded manually using a pressure-sensitive sealing tape at room temperature. The separation of a 10-channel array was monitored simultaneously using a CCD camera equipped with an image intensifier with laser-induced fluorescence detection. High-speed and high-throughput separations of φX174 HaeIII DNA restriction fragments and PCR products related to the β-globin gene and SP-B gene have been achieved on the µ-CAE plastic chips. The current work greatly simplifies fabrication of a µ-CAE chip and establishes the feasibility of low-cost mass production of a high-density µ-CAE plastic chip for genetic analysis. ACKNOWLEDGMENT The present work is supported in part by the CREST program of the Japan Science and Technology Corp. (JST); a grant from the New Energy and Industrial Technology Development Organization (NEDO) of the Ministry of Economy, Trade and Industry, Japan; a Grant-in-Aid for Scientific Research from the Ministry of Health and Welfare, Japan; and a Grant-in-Aid for Scientific Research from the Ministry of Education, Science and Technology, Japan. Received for review October 10, 2004. Accepted January 6, 2005. AC0485031