High-Throughput, Combinatorial Engineering of Initial Codons for Tunable Expression of Recombinant Proteins Jin-Ho Ahn,† Jung-Won Keum,‡ and Dong-Myung Kim*,§ Institute of Molecular Biology and Genetics, Seoul National University, Seoul 151-742, Korea, School of Chemical and Biological Engineering, Seoul National University, Seoul 151-742, Korea, and Department of Fine Chemical Engineering and Chemistry, Chungnam National University, Daejeon 305-764, Korea Received December 19, 2007
We describe a high-throughput strategy for tuning the expression of recombinant proteins through engineering their early nucleotide sequences. After randomizing the +2 and +3 codons of the target genes, each of the variant genes was isolated in vivo and subsequently expressed using in vitro protein synthesis techniques. When several hundreds of clones were examined in parallel, it was found that expression levels of target genes varied as much as 70-fold depending on the identity of the codons in the randomized region. This broad and continuous distribution of expression levels enabled the selection of specific codon arrangements for the expression of target genes at a desired level. Furthermore, codon-dependent variations in protein expression were reproduced when the same genes were expressed in vivo. Thus, we expect that the methodology reported here could be utilized as a versatile platform for rapid expression of protein molecules at modulated levels either in vitro or in vivo. Keywords: Reverse proteomics • high-throughput protein synthesis • cell-free translation • downstream box • in vitro protein synthesis
Introduction The discipline of proteomics has been mainly considered as an approach allowing either protein identification from complex mixtures or the characterization of changes at the level of their expression/post-translational modification (PTM). However, this approach, named forward proteomics, is not sufficient for obtaining an integrated understanding of the coordinated functions of the biological components. Instead, functional characterization of the identified proteins is required to complement the data obtained through the forward proteomic studies, which necessarily involves the expression and analysis of the cloned genes using recombinant-based methodologies.1 In these functional approaches named reverse proteomics, technology that allows the precise control of recombinant protein expression levels will provide substantial benefits. While it is often desirable to achieve the maximum expression of target proteins, in certain cases, accumulation of recombinant proteins needs to be controlled to prevent potential toxicity or avoid inefficient folding of highly expressed proteins. Although protein synthesis is a complicated process involving many stages, it is generally accepted that translation of mRNA is mainly controlled at the initiation * To whom correspondence should be addressed. Tel: +82-42-821-5899. Fax: +82-42-823-7692. E-mail:
[email protected]. † Institute of Molecular Biology and Genetics, Seoul National University. ‡ School of Chemical and Biological Engineering, Seoul National University. § Department of Fine Chemical Engineering and Chemistry, Chungnam National University. 10.1021/pr700856s CCC: $40.75
2008 American Chemical Society
and/or early elongation phases.2 In addition to the wellcharacterized Shine-Dalgarno sequence, statistical studies have identified characteristic distributions of nucleotides around initiation and termination codons.3–8 In particular, the sequences of the first few nucleotides in close proximity to the start codon, commonly referred to as the downstream boxes (DB), have been shown to have a significant effect on mRNA translation efficiency.9–11 For example, Stenstro¨m and Isaksson recently demonstrated that the expression level of a lacZ reporter gene could be varied as much as 20-fold depending upon the codon at the +2 position.12 In contrast, it was also shown that the presence of NGG codons (CGG, AGG, GGG, and UGG) in the early region of ORFs significantly repressed the translation of mRNA.13–15 From these results, we speculated that it might be possible to tune the expression level of given genes through proper combinations of ‘stimulatory’ and ‘repressive’ codons in the initial region of the ORFs. In this work, we selected codon arrangements giving the desired expression level of target genes from randomized early codons. We integrated in vivo and in vitro methods to establish an effective strategy for isolation, expression, and analysis of individual variant genes. The +2 and +3 codons of the target genes were randomized and cloned into Escherichia coli cells. Each of the +2/+3-variant genes was then amplified by colony-PCR and analyzed for its expression level in vitro. When several hundred of the +2/+3-variants were examined for different target proteins, a continuous distribution of relative expression levels over a 70-fold range was found, enabling the selection of optimal codon combinations for Journal of Proteome Research 2008, 7, 2107–2113 2107 Published on Web 04/04/2008
research articles
Ahn et al.
Table 1. Strains, Plasmids, and Primers Used in This Study name
DH5R BL21-Star(DE3)
description
reference or source
Strain F- Φ 80lacZM15 endA recA hsdR(rK- mK-) supE thi gyrA ∆relA (lacZYA-argF)U169 F- ompT hsdSB(rB- mB-) gal dcm rne131
Laboratory stock Invitrogen
a
pK7-DsRed2 pK7-EPO pIVEX2.3d-UK pK7-EGFP
Plasmid KanR, From pDsRed2, NdeI/SalI KanR, NdeI/SalI AmpR, NdeI/XhoI KanR, NdeI/SalI
F-NNN-DsRed2 F-NNN-EPO F-NNN-UK F-NNN-EGFP T715up GTB
Primerb AAGAAGGAGATATACATATGNNNNNNTCCGAGAACGTCATCAC AAGAAGGAGATATACATATGNNNNNNCCACGCCTCATCTGTGA TAGAAGGAGATATACATATGNNNNNNCAACAAGGCTTCCAGTG AAGGAGATATACATATGNNNNNNAAGGGCGAGGAGCTGTTC TCGATCCCGCGAAATTAATACGACTCACTATAGG CAAAAAACCCCTCAAGACCCGTTTA
This study 16 Roche Applied Science 27
a DsRed2 (AAV97910), EPO (human erythropoietin, CAA26095), UK (serine protease domain of murine urokinase, EDL01484), EGFP (AAB02572). sites are underlined, and bold font indicates a start codon.
b
Restriction
Figure 1. Schematic representation of overall procedures. The genes of interests were amplified by PCR using degenerate forward primers which were randomized at +2 and +3 codon position. The PCR products were ligated into a vector and transformed into E. coli. Single colonies were picked and used as templates for colony PCR. The resulting PCR products were directly used as expression templates for cell-free protein synthesis, and expression efficiency was analyzed by radioactivity counting and SDS-PAGE.
desired expression levels. We expect that the method presented here can serve as an effective approach to optimizing protein expression, depending on the characteristics and application of the protein products.
Materials and Methods Materials. ATP, GTP, UTP, CTP, creatine phosphate, creatine kinase, and E. coli total tRNA mixture were purchased from Roche Applied Science (Indianapolis, IN). L-[U-14C]leucine (11.9 GBq/mmol) was obtained from Amersham Biosciences (Uppsala, Sweden). All other reagents were purchased from Sigma and used without additional purifications. The S30 extract was prepared from E. coli strain BL21-Star(DE3) as 2108
Journal of Proteome Research • Vol. 7, No. 5, 2008
previously described.13,16 Oligonucleotides for cloning and PCR were synthesized by Integrated DNA Technologies (Coralville, IA). DeepVent DNA polymerase from New England Biolabs was used for all PCR. Subcloning and Colony-PCR. ORFs of target genes were amplified by PCR using primers with degeneracy against the +2 and +3 codons of the target genes (primers are listed in Table 1). The resulting PCR products were inserted into digested plasmids (pK7 for DsRed2, EPO, and EGFP and pIVEX2.3d for UK) and transformed into E. coli DH5R competent cells. After overnight growth on LB-agar plates, each of the single colonies of transformants was picked and transferred to the PCR mixture containing T715up and GTB primers. The
High-Throughput Codon Engineering for Tunable Protein Expression
research articles
Figure 2. Cell-free expression of colony PCR products. Totally, 300 EPO, 222 DsRed2, and 300 UK 120 EGFP PCR products which were randomized at second and third codon position of each gene were directly used as expression templates for cell-free protein synthesis where expression efficiency was measured. After 3 h for expression, 15 µL of the reaction samples were withdrawn from the reaction mixture, and the [14C]leucine-labeled radioactivity was counted.
temperature and time settings for the colony-PCR were as follows: 5 min at 95 °C, 30 s at 95 °C, 1 min at 55 °C, 1 min at 72 °C for 30 cycles for amplification, and 7 min for workup extension. Cell-Free Expression of the Variant Genes Amplified by Colony-PCR. The standard reaction mixture for cell-free protein synthesis reactions consisted of the following components in a total volume of 15 µL: 57 mM Hepes-KOH (pH 8.2); 1.2 mM ATP; 0.85 mM each of CTP, GTP, and UTP; 2 mM DTT; 0.64 mM cAMP; 90 mM potassium glutamate; 80 mM ammonium acetate; 12 mM magnesium acetate; 34 µg/mL L-5formyl-5,6,7,8-tetrahydrofolic acid (folinic acid); 1 mM each of 20 amino acids; 0.17 mg/mL E. coli total tRNA mixture (from strain MRE600); 2% PEG (8000); 67 mM creatine phosphate (CP), 5.6 µg/mL creatine kinase; 10 µM L-[U-14C] leucine (11.3 GBq/mmol, Amersham Biosciences); 4 µL of the S30 extract and 1 µL of colony-PCR products. Cell-free synthesized protein was quantified by measuring TCA-precipitated radioactivity with a liquid scintillation counter (WALLAC 1410), as described previously.17 In Vivo Expression of the Selected Variant Genes. According to the results of the cell-free synthesis using the colony-PCR products, colonies of BL21-Star(DE3) that had been transformed with pET24ma constructs of the mutant genes were grown in 5 mL of LB media in the presence of kanamycin (50 µg/mL). When OD600 reached 0.6, the expression of T7 RNA polymerase was induced with 1 mM IPTG for 4 h. After
harvesting the culture broth, the expressed protein was analyzed on a 13% Tricine-SDS-PAGE gel.18 Analysis of mRNA Level. Five microliters samples were withdrawn during the reaction mixture of the cell-free protein synthesis and immediately mixed with equal volumes of RNAprotect bacterial reagent (Qiagen). The total RNA in each sample was extracted and purified using a commercial kit (RNeasy Mini, Qiagen). The size of the isolated mRNA was analyzed on a 1.2% formaldehyde agarose gel. Analysis of EGFP Activity. To confirm the biological activity of the expressed EGFP, the amplified EGFP genes were expressed in 96-well plates in a total volume of 80 µL and the fluorescence of the synthesized EGFP was measured using fluorescence spectrometer (excitation, 488 nm; emission, 555 nm; cutoff, 515 nm) (Gemini XPS, Molecular Devices). The fluorescent intensity of EGFP was monitored every minute for 3 h at 37 °C. A fluorescent image was captured by irradiating UV light after completion of the expression reaction.
Results Modulation of Protein Expression through Combinatorial Replacement of Early Codons. We examined how the expression levels of four different proteins (DsRed2, hEPO, UK, and EGFP) varied when the two consecutive codons downstream of the start codon (AUG) were randomly changed based upon previous results demonstrating that the identity of early codons substantially affects mRNA translation efficiency.13,19 Journal of Proteome Research • Vol. 7, No. 5, 2008 2109
research articles
Ahn et al. Table 2. Correlation between the Identities of the Initial Codons and the Efficiency of Translationa
Figure 3. Electrophoretic analysis of cell-free synthesized proteins. On the basis of the result of [14C] leucine incorporation, 2 µL of the reaction mixture showing high, medium, or low expression level was analyzed on a 13% Tricine-SDS-polyacrylamide gel. Expressed proteins (arrows) were visualized by Coomassie Blue staining.
The procedures for the preparation and expression of the genes with randomized +2/+3 codons are outlined in Figure 1. Briefly, after randomizing the +2 and +3 codons through PCR, using degenerated primers (Table 1), the PCR products were cloned into a plasmid vector and transformed into competent E. coli cells (DH5R). Following overnight growth of the transformed cells on an agar plate, the cloned ORFs in each of the colonies were amplified by colony-PCR, and subsequently expressed in reaction mixture for in vitro protein synthesis as described in the Materials and Methods. When the synthesized proteins were quantified by measuring the amounts of the incorporated 14C-leucine, as shown in Figure 2, a wide and almost continuous distribution of expression levels was observed for each target protein. For example, while the PCR products from the original hEPO sequence produced 72 µg/ mL, the productivity of its +2/+3-variants spanned from 8 to 509 µg/mL (Figure 2A), demonstrating the impact initial codons have on gene expression efficiency. Similar patterns were observed when the same experiments were repeated with other proteins (Figure 2B-D). Colony-PCR products from the isolated variant genes yielded 11-706% (hEPO), 12-422% (UK), 12-834% (DsRed2) and 31-767% (EGFP) of the target proteins compared to their wild-type sequences. Target proteins were confirmed to be the correct size with the expected relative band intensities when reactions with high, medium, and low levels of 14Cleucine incorporation were analyzed on a Coomassie Bluestained SDS-PAGE gel (Figure 3). Although no universal codon pairs were found to enhance or repress protein synthesis, it appeared that the clones 2110
Journal of Proteome Research • Vol. 7, No. 5, 2008
a Five clones for high-level expression, three clones for medium-level expression, and three clones for low-level expression clones were sequenced and are indicated in red, blue, and black font, respectively. Second and third codons are represented in bold. b Values are means of three independent experiments. Standard error was less than 10% in all cases.
research articles
High-Throughput Codon Engineering for Tunable Protein Expression 22
using the Mfold program did not indicate any substantial changes in the secondary structure of mRNA by the substitution of the +2/+3 codons (Supplementary Figure 2). Simmons and Yansura reported previously that alteration of the translational initiation region (TIR) of the STII signal sequence at +2 to +6 codon position resulted in a 10-fold range of translational strengths among variants.23 It was presumed that altered TIR sequences affect the binding efficiency of the 30S ribosomal subunit during the translational initiation process.
Figure 4. Expression of EGFP variants. A total of 96 EGFP clones, which were randomized at the second and third codon positions, were expressed in cell-free systems in 96-well plates for 3 h at 37 °C. The fluorescence intensity in each well was measured in real-time with a fluorescence microplate reader. Inset: After 3 h of incubation, the fluorescent activity was imaged with UV irradiation of the reaction mixture. Statistic analysis showed a good correlation between the [14C]Leu incorporation and EGFP fluorescence (R2 value ) 0.971). Table 3. Relative Expression Efficiency by Codon Swap translational level (µg/mL)a 2nd and 3rd codon gene
TGC-AAT
TTG-CAT
TTG-ATA
AAG-AGT
wild-type control
DsRed2 EPO UK EGFP
726 (8.3) 308 (4.3) 229 (2.8) 135 (1.1)
155 (1.8) 509 (7.1) 252 (3.0) 95 (0.8)
210 (2.4) 220 (3.1) 351 (4.2) 179 (1.5)
137 (1.6) 209 (2.9) 178 (2.1) 629 (5.1)
87 (1.0) 78 (1.0) 83 (1.0) 82 (1.0)
a The figure in brackets represents the relative expression efficiency compared to the wild-type gene. The translational level, in bold, represents the codon arrangement that gave the highest expression level among the four mutant genes.
showing high expression level were generally A and T rich (Table 2), which is in accordance with previous reports.20,21 The codon substitution effect appeared to result from altered translation efficiency rather than from changes in synthesis and/or degradation of the transcripts. No significant difference was observed in the relative amounts of mRNAs expressed among the selected genes showing different expression levels (Supplementary Figure 1). In addition, computational analysis
In Vitro Expression and in Situ Analysis of +2/+3Variant EGFP. In vitro expression and analysis of EGFP genes carrying randomized +2/+3 codons was conducted in a 96well plate with a fluorescence spectrophotometer. When the reaction mixture for in vitro protein synthesis was programmed with each of the colony-PCR products of the +2/+3 variants, a time-dependent fluorescence increase was observed following a short period of maturation (Figure 4). Each well produced a different rate of fluorescence increase and the relative intensity of the EGFP fluorescence was in good correlation with the results of 14C-leucine incorporation (Figure 2D), indicating that the random change of +2/+3 codons did not substantially affect the specific activity of the synthesized protein. The Effect of Early Codons Was Specific to Target Gene Sequences. To examine if a given +2/+3 codon arrangement had a similar effect on different proteins, the +2/+3 codons that gave the highest expression levels were swapped between target proteins (EPO, DsRed2, UK, and EGFP). As summarized in Table 3, all of the examined proteins exhibited their highest expression level with different codon arrangements and crossstimulation by each of the selected codons had no significant effect. In Vivo Effects of the Initial Codons on the Translational Efficiency of the Target Proteins. To examine if the effect of the early codons observed during the in vitro protein expression can be reproduced in vivo, the variant genes that showed high, medium, or low levels of in vitro expression were cloned into the pET24ma plasmid, and their expression in E. coli cells (BL21-Star(DE3)) was analyzed. As shown in Figure 5, the in vitro codon-dependent variations in relative expression levels were reproduced in the in vivo expression experiments and the relationship between the relative expression level and codon identity was in good agreement with the results of in vitro assay.
Figure 5. In vivo expression of selected clones. Each selected high, medium, and low clone from the target proteins was subcloned into an expression plasmid, transformed into E. coli cells BL21-Star(DE3), and cultured as described in the Materials and Methods. Subsequently expression levels were analyzed by Tricine-SDS-PAGE and Coomassie Brilliant Blue staining. Journal of Proteome Research • Vol. 7, No. 5, 2008 2111
research articles Discussion In this study, it was attempted to finely modulate the expression level of recombinant proteins by engineering the early codons of the target genes. The +2 and +3 codons of different proteins were changed in a combinatorial manner, and the relationship between the identities of the changed codons and the expression level of the corresponding genes was analyzed. While the most straightforward route to do this would be by scanning each position of the 61 codons, the immense time and labor requirements make this approach unrealistic, particularly with the conventional in vivo expression technology. For complete coverage of all the possible variant, 3721 (61 × 61) variants genes would have to be constructed and the subsequent isolation and analysis of the expressed proteins from the same number of cell cultures would also be a daunting task. In this study, we used the strategy of combining in vivo and in vitro tactics for screening the expression level from the library of target genes having randomly changed early codons. Large-scale expression cloning was conducted using highthroughput in vitro protein expression techniques for the selection of the codon pairs that gave the desired level of protein synthesis. When the individual variants of the +2/+3randomized target genes were expressed, both enhancement and reduction in protein yield were observed. Moreover, the variant genes had almost a continuous distribution in their expression level between the highest and lowest values, indicating that the expression level of a given target protein can be adjusted precisely by choosing appropriate combinations of +2 and +3 codons. As pointed out by Gonzalez de Valdivia and Isaksson,14,15 the effects of the initial codons might be related to the dropoff frequency of peptidyl-tRNA from the translating ribosomes. Considering that the translational ribosome complex is known to be less stable at the beginning of a translated mRNA,24–26 codon-dependent peptidyl-tRNA drop-off at the very beginning of the coding region in mRNA can lead to a wide range of expression levels. However, the results of this study show that the initial codons per se did not determine the expression level of the downstream sequence. Instead, it appears that the effect of a given codon is projected in combination with other factors involving the entire sequence of the target genes, which highlights the importance of a high-throughput strategy for screening optimal arrangements of early codons. The codon dependence of gene expression was not limited to in vitro experiments. The relative expression levels of the +2/+3 variant genes were reproduced when they were expressed in vivo. The codon pairs selected for high expression in vitro remarkably increased protein accumulation in E. coli cells, and the medium or low level in vivo expression was also achieved with the in vitro-screened clones. Therefore, our results provide an effective means for systematic and precise control of protein production. In addition, same strategy can be applied for the modulation of translation strengths of signal peptide sequences. As was already shown by Simmons and Yansura,23 secretion of heterologous proteins can be substantially enhanced by optimizing the translational level of a given protein which is determined by translation initiation region (TIR) of signal peptides. By use of the presented method, a large repertoire of signal peptides can be created covering a wide range of translation strength. Through the high-throughput generation of functional proteins at desired levels, this method will provide an integrated 2112
Journal of Proteome Research • Vol. 7, No. 5, 2008
Ahn et al. approach for comprehensive understanding of complicated protein networks, complementing the data generated through forward proteomics. In addition, combined with appropriate screening schemes, this method may also be usefully implemented for engineering and/or evolving the properties of a protein.
Acknowledgment. This work was supported by a grant from the Basic Research Program of the Korea Science & Engineering Foundation (Grant No. R01-2007-000-20980-0). Supporting Information Available: Supplementary Figure 1 showing analysis of steady-state mRNA levels and Supplementary Figure 2 showing prediction of mRNA secondary structure. This material is available free of charge via the Internet at http://pubs.acs.org. References (1) Palcy, S.; Chevet, E. Integrating forward and reverse proteomics to unravel protein function. Proteomics 2006, 6 (20), 5467–5480. (2) Laursen, B. S.; Sorensen, H. P.; Mortensen, K. K.; Sperling-Petersen, H. U. Initiation of protein synthesis in bacteria. Microbiol. Mol. Biol. Rev. 2005, 69 (1), 101–123. (3) Ikemura, T. Correlation between the abundance of Escherichia coli transfer RNAs and the occurrence of the respective codons in its protein genes. J. Mol. Biol. 1981, 146 (1), 1–21. (4) Nakamura, Y.; Gojobori, T.; Ikemura, T. Codon usage tabulated from international DNA sequence databases: status for the year 2000. Nucleic Acids Res. 2000, 28 (1), 292. (5) Niimura, Y.; Terabe, M.; Gojobori, T.; Miura, K. Comparative analysis of the base biases at the gene terminal portions in seven eukaryote genomes. Nucleic Acids Res. 2003, 31 (17), 5195–5201. (6) Poole, E. S.; Brown, C. M.; Tate, W. P. The identity of the base following the stop codon determines the efficiency of in vivo translational termination in Escherichia coli. EMBO J. 1995, 14 (1), 151–158. (7) Stenstro¨m, C. M.; Jin, H. N.; Major, L. L.; Tate, W. P.; Isaksson, L. A. Codon bias at the 3′-side of the initiation codon is correlated with translation initiation efficiency in Escherichia coli. Gene 2001, 263 (1-2), 273–284. (8) Tats, A.; Remm, M.; Tenson, T. Highly expressed proteins have an increased frequency of alanine in the second amino acid position. BMC Genomics 2006, 7, 28. (9) Etchegaray, J. P.; Inouye, M. Translational enhancement by an element downstream of the initiation codon in Escherichia coli. J. Biol. Chem. 1999, 274 (15), 10079–10085. (10) Etchegaray, J. P.; Xia, B.; Jiang, W.; Inouye, M. Downstream box: a hidden translational enhancer. Mol. Microbiol. 1998, 27 (4), 873– 874. (11) Sprengart, M. L.; Fatscher, H. P.; Fuchs, E. The initiation of translation in E. coli: apparent base pairing between the 16s rRNA and downstream sequences of the mRNA. Nucleic Acids Res. 1990, 18 (7), 1719–1723. (12) Stenstro¨m, C. M.; Isaksson, L. A. Influences on translation initiation and early elongation by the messenger RNA region flanking the initiation codon at the 3 ′ side. Gene 2002, 288 (1-2), 1–8. (13) Ahn, J. H.; Hwang, M. Y.; Lee, K. H.; Choi, C. Y.; Kim, D. M. Use of signal sequences as an in situ removable sequence element to stimulate protein synthesis in cell-free extracts. Nucleic Acids Res. 2007, 35 (4), e21. (14) de Valdivia, E. I. G.; Isaksson, L. A. A codon window in mRNA downstream of the initiation codon where NGG codons give strongly reduced gene expression in Escherichia coli. Nucleic Acids Res. 2004, 32 (17), 5198–5205. (15) de Valdivia, E. I. G.; Isaksson, L. A. Abortive translation caused by peptidyl-tRNA drop-off at NGG codons in the early coding region of mRNA. FEBS J. 2005, 272 (20), 5306–5316. (16) Ahn, J. H.; Chu, H. S.; Kim, T. W.; Oh, I. S.; Choi, C. Y.; Hahn, G. H.; Park, C. G.; Kim, D. M. Cell-free synthesis of recombinant proteins from PCR-amplified genes at a comparable productivity to that of plasmid-based reactions. Biochem. Biophys. Res. Commun. 2005, 338 (3), 1346–1352. (17) Kim, D. M.; Kigawa, T.; Choi, C. Y.; Yokoyama, S. A highly efficient cell-free protein synthesis system from Escherichia coli. Eur. J. Biochem. 1996, 239 (3), 881–886.
research articles
High-Throughput Codon Engineering for Tunable Protein Expression (18) Scha¨gger, H.; von Jagow, G. Tricine-sodium dodecyl sulfatepolyacrylamide gel electrophoresis for the separation of proteins in the range from 1 to 100 kDa. Anal. Biochem. 1987, 166 (2), 368– 379. (19) Son, J. M.; Ahn, J. H.; Hwang, M. Y.; Park, C. G.; Choi, C. Y.; Kim, D. M. Enhancing the efficiency of cell-free protein synthesis through the polymerase-chain-reaction-based addition of a translation enhancer sequence and the in situ removal of the extra amino acid residues. Anal. Biochem. 2006, 351 (2), 187–192. (20) Voges, D.; Watzele, M.; Nemetz, C.; Wizemann, S.; Buchberger, B. Analyzing and enhancing mRNA translational efficiency in an Escherichia coli in vitro expression system. Biochem. Biophys. Res. Commun. 2004, 318 (2), 601–614. (21) Nishikubo, T.; Nakagawa, N.; Kuramitsu, S.; Masui, R. Improved heterologous gene expression in Escherichia coli by optimization of the AT-content of codons immediately downstream of the initiation codon. J. Biotechnol. 2005, 120 (4), 341–346. (22) Zuker, M. Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids Res. 2003, 31 (13), 3406–3415.
(23) Simmons, L. C.; Yansura, D. G. Translational level is a critical factor for the secretion of heterologous proteins in Escherichia coli. Nat. Biotechnol. 1996, 14 (5), 629–634. (24) Chen, G. F.; Inouye, M. Suppression of the negative effect of minor arginine codons on gene expression; preferential usage of minor codons within the first 25 codons of the Escherichia coli genes. Nucleic Acids Res. 1990, 18 (6), 1465–1473. (25) Gao, W.; Tyagi, S.; Kramer, F. R.; Goldman, E. Messenger RNA release from ribosomes during 5′-translational blockage by consecutive low-usage arginine but not leucine codons in Escherichia coli. Mol. Microbiol. 1997, 25 (4), 707–716. (26) Rosenberg, A. H.; Goldman, E.; Dunn, J. J.; Studier, F. W.; Zubay, G. Effects of consecutive AGG codons on translation in Escherichia coli, demonstrated with a versatile codon test system. J. Bacteriol. 1993, 175 (3), 716–722. (27) Ahn, J. H.; Choi, C. Y.; Kim, D. M. Effect of energy source on the efficiency of translational termination during cell-free protein synthesis. Biochem. Biophys. Res. Commun. 2005, 337 (1), 325–329.
PR700856S
Journal of Proteome Research • Vol. 7, No. 5, 2008 2113
