High-Throughput Quantitative Screening of Peroxidase-Mimicking

Subscriber access provided by Univ. of Tennessee Libraries

Article

High-throughput quantitative screening of peroxidase-mimicking DNAzymes on a microarray using electrochemical detection Naoto Kaneko, Katsunori Horii, Shintaro Kato, Joe Akitomi, and Iwao Waga Anal. Chem., Just Accepted Manuscript • DOI: 10.1021/ac4002518 • Publication Date (Web): 28 Apr 2013 Downloaded from http://pubs.acs.org on May 3, 2013

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

Analytical Chemistry is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 23

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Analytical Chemistry

High-throughput quantitative screening of peroxidase-mimicking DNAzymes on a microarray by using electrochemical detection Naoto Kaneko, Katsunori Horii, Shintaro Kato, Joe Akitomi, Iwao Waga* *Corresponding Author: E-mail: [email protected] Fax: +81-3-5534-2620 KEYWORDS Peroxidase-mimicking DNAzyme, microarray, electrochemical detection ABSTRACT Some guanine-rich DNA sequences, which are called DNAzymes, can adopt G-quadruplex structures and exhibit peroxidase activity by binding with hemin. Although known DNAzymes show less activity than horseradish peroxidase, they have the potential to be widely used for the detection of target molecules in enzyme-linked immunosorbent assays if sequences that exhibit higher activity can be identified. However, techniques for achieving this have not yet been described. Therefore, we compared the DNAzyme activities of more than 1,000 novel designed

ACS Paragon Plus Environment

1


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 23

sequences with that of the original DNAzyme by using an electrochemical detection system on a 12K DNA microarray platform. To the best of our knowledge, this is the first description of an array-based assessment of peroxidase activity of G-quadruplex-hemin complexes. By using this novel assay system, more than 200 different mutants were found that had significantly higher activities than the original DNAzyme sequence. This microarray-based DNAzyme evaluation system is useful for identifying highly active new DNAzymes that might have potential as tools for developing DNA-based biosensors with aptamers.

Introduction Hemin is an iron-containing porphyrin with peroxidase activity that increases when it is complexed with DNA G-quadruplexes in so-called DNAzymes.1–3 Because there are many advantages associated with the manufacture, storage, and delivery of DNAzymes, they have emerged as promising alternatives to horseradish peroxidase (HRP), which is widely used for colorimetric or chemiluminescent detection in biochemistry applications such as ELISA and immunohistochemistry. Recently, novel DNA-based biosensors comprising a peroxidasemimicking DNAzyme with an aptamer were reported. 4-6 It should be noted that these systems make it possible to detect small molecules directly without labeling.6 In addition, a washing step is not required in the detection process, which allows the development of rapid and convenient sensors. G-quadruplexes contain unique G-tetrad planes where hemin might bind through π-π stacking. These planes adopt parallel, anti-parallel, or hybrid conformations depending on the G-rich sequences and ionic conditions.7 G-quadruplex-hemin complexes that form parallel structures


2

Page 3 of 23

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


were reported to show higher peroxidase activity than those that form anti-parallel structures.8–10 For example, c-Myc (derived from the human c-myc promoter)11 and EAD2 (an artificial sequence)8 with parallel conformations exhibit higher peroxidase activity than the thrombin aptamer (TA)12 with its anti-parallel arrangement.8 Peroxidase activities of G-quadruplex-hemin complexes were reported for 20 kinds of G-rich sequences. However, a sequence that possesses optimal peroxidase activity has not been clearly defined and the potential of such a novel DNAzyme sequence is unknown. Commercially available high density customized DNA microarrays are sometimes used for aptamer studies as, for example, in the systematic optimization of aptamer sequences against a target13, 14 or the evaluation of thousands of candidate sequences in an aptamer selection.15 In most cases, a fluorescent dye-labeled target is required to visualize interactions between the target and various DNA sequences on the array chip.13,15,16 Recently, CombiMatrix Corporation developed a new type of DNA microarray, the ElectraSense® microarray, that has 12,544 individually addressable electrodes. Together with its detection equipment, the ElectraSense® Reader, it is able to measure the current that is generated by an HRP-enhanced electrochemical reaction.13 This array system is generally used for genotyping and gene expression assays.17 In this study, we first describe measurement of the peroxidase activity of G-quadruplex-hemin complexes by DNAzyme-enhanced electrochemical detection by using an ElectraSense® microarray. This approach permits high-throughput quantitative screening of peroxidasemimicking DNAzymes. Moreover, this technique could be a powerful tool for screening a new type of aptameric sensor (aptasensor) that comprises a DNAzyme-aptamer conjugate that can detect a target directly.5,18


3


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 4 of 23

Experimental Section Chemicals and reagents Porcine hemin and ferrocene methyl alcohol (FMA) were purchased from Sigma-Aldrich (St. Louis, MO, United States) and Tokyo Chemical Industry (Tokyo, Japan), respectively. Hydrogen peroxide (30%) was obtained from Wako Pure Chemical Industries (Osaka, Japan). All DNAzyme oligonucleotides were synthesized by Integrated DNA Technologies (Coralville, IA, United States). 3,3′,5,5′-Tetramethylbenzidine with enhancer (TMBE) was obtained from Moss Inc. (Pasadena, MD, United States). UltraPure™ DNase/RNase-free distilled water (Invitrogen, Carlsbad, CA, United States) was used for all experiments. All other chemicals and reagents were molecular research grade. Customized ElectraSense® microarrays were purchased from Recenttec K. K. (Tokyo, Japan). Hybond-N+ was obtained from Amersham Biosciences. L-012 was purchased from Wako Chemicals USA Inc. (Richmond, VA, United States).

Chip design for optimization of experimental conditions The CombiMatrix 4 × 2K ElectraSense® chip consists of 4 sub-arrays of 2,240 positions of which 2,000 are customizable. The sequences of EAD2 and part of the streptavidin-binding aptamer (SA) 19 were used as positive and negative probes, respectively, for peroxidasemimicking DNAzymes. To investigate the effect of linker lengths between the probes and the matrix on the electrodes, various lengths of polydeoxy thymidine (poly-dT) spacers (0, 8, 16, and


4

Page 5 of 23

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


24 bases) were inserted at the 3′-ends of the probes. The probes were designed and synthesized on 250 independent electrodes at random positions on the 4 sub-arrays.

Chip design for DNAzyme screening The CombiMatrix 12K ElectraSense® chip contains 12,544 positions of which 544 are dedicated to fabrication and quality control. The probe sequences were designed by systematically introducing mutations in the loop regions of the DNAzymes EAD2, c-Myc, and TA (Table 1), which had 63, 1023, and 1232 mutants, respectively. Poly-dT (24) was inserted as a linker at the 3′-ends of the probes. Positive (EAD2, c-Myc, and TA) and negative (SA) controls were synthesized directly on 100 independent electrodes. In a preliminary experiment, each mutant was statistically estimated to be capable of distinguishing between the electrochemical signals from the activity of EAD2 and c-Myc. Each mutant was then present on 5 independent electrodes.

Electrochemical detection of DNAzyme activity by using a microarray DNAzyme-enhanced electrochemical reactions were detected on an ElectraSense® Reader (CombiMatrix) according to the manufacture’s protocol with some modifications. Briefly, the microarray chip was immersed in 200 µL of DNAzyme buffer (50 mM Tris-HCl, 20 mM KCl, and 0.05% [w/v] Triton X-100, pH 7.4), and incubated for 10 min at 75°C. The chip was then cooled down slowly to room temperature for more than 1 h in order to allow the probes to fold into their correct conformations. The buffer was replaced with hemin solution (5 µM hemin in


5


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 6 of 23

DNAzyme buffer containing 0.1% [v/v] DMSO) and incubated for 30 min at room temperature with gentle rocking in the dark. Finally, the hemin solution was replaced with the substrate solution (2 mM H2O2 and 0.1 mg/mL FMA in hemin solution) and mixed gently by repeated pipetting before scanning the microarrays.

Microarray data analysis The Kolmogorov–Smirnov one-way test was applied to test the normality of the signal intensities for each sequence. After checking the normality, Welch’s t-test was used to compare the signals from the novel sequences and the known sequences (such as c-Myc or EAD2). To avoid the problem of multiple comparisons, p-values were recalculated by using the false discovery rate controlling procedure. R software (v 2.12.0, R development core team (2008)) was used for all microarray data analyses.

Chemiluminescence assay DNAzyme solutions (5 pmol DNAzyme in 25 µL of DNAzyme buffer [50 mM Tris-HCl and 0.05% [w/v] Triton X-100, pH 7.4]) were denatured for 5 min at 95°C. The solutions were then cooled down slowly to room temperature in order to fold the DNAzymes into their proper conformations. To form DNAzyme-hemin complexes, hemin and KCl (final concentration of 20 mM KCl) were added, filled up to 45 µL with distilled water, and incubated for 1 h at room temperature in the dark. Next, 2.5 µL of L-012 as a luminol derivative (final concentration of 25 µM) and 2.5 µL of H2O2 (final concentration of 25 µM) were injected into the DNAzyme


6

Page 7 of 23

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


solution. The chemiluminescent reaction was measured after 1 min of incubation. Hemin solution (100 nM hemin in DNAzyme buffer without a DNAzyme oligonucleotide) was used as a negative control.

Colorimetric method by using slot blotting DNAzyme solutions (0.01–100 pmol) in 100 µL DNAzyme buffer (50 mM Tris-HCl, 20 mM KCl, and 0.05% [w/v] Triton X-100, pH 7.4) were denatured for 10 min at 95°C. The solutions were then cooled down slowly to room temperature in order to allow the DNAzymes to fold into their proper conformations. The solutions were blotted onto a positively charged membrane, which was scanned after incubation for 30 min at room temperature with substrate solution (10 µM hemin in TMBE).

Results and discussion Electrochemical detection of DNAzyme activity The ElectraSense® system enables the detection of the redox reaction of HRP with a tetramethylbenzidine (TMB) substrate. This reaction is generally used in genotyping and gene expression assays.17 In this study, the system was used to evaluate the peroxidase activity of DNAzyme sequences. By using FMA as an electron donor instead of TMB, the array reproducibility was greatly improved as a result of reducing the bias of the surface irregularities that are created by insoluble oxidized TMB. Thus, the activities of the DNAzymes were


7


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 8 of 23

measured in Tris-buffered saline at pH 7.4 containing 20 mM KCl, which is a buffer that has been shown to give a high signal/background ratio with FMA as a substrate (data not presented). The array reproducibility was analyzed by using a sub-array of the 4 × 2K chip that contained EAD2 and SA probes (n = 250). As shown in Fig. 1, the electrochemical signals with hemin and oligonucleotides exhibited extremely high reproducibility that was similar to that of the usual fluorescence detection system (Pearson’s correlation coefficient was > 0.99). All readout data from the array showed a normal distribution for every measurement and probe in Fig. S1 (Supporting Information). Therefore, the mean values of the signals were used for statistical analyses by methods such as Welch’s t-test to compare the DNAzyme activities. As estimated from the standard deviations of the EAD2 probe (n = 250), a difference of more than 0.18 on a log2 scale between the mean values of 2 probes (calculated from 5 signal readouts) was defined as being significant.

Effect of spacer length on signal intensity To investigate the influence of the spacer length on the synthesis of DNAzymes on microarray electrodes, poly-dT spacers of various lengths (up to 60-mer in 5-mer steps) were attached to the 3′-end of the EAD2 probes and peroxidase activity measured by electrochemical detection. Interestingly, the signal increased almost linearly with spacer length (Fig. 2). The same phenomenon has been reported for another aptamer microarray based on fluorescence detection.13,16 The spacer length might influence the structural stability of DNAzymes or prevent interactions between probes and the matrix of the DNA array because the effect was reduced in


8

Page 9 of 23

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


the presence of 100 mM NaCl (data not shown). A 24-mer poly-dT spacer was used for screening DNAzymes owing to probe synthesis limitations on the microarray.

Screening of novel DNAzyme sequences by using a microarray The screening process is shown in scheme 1. Various probes were designed by systematically introducing mutations (A, T, G, or C) into the loop region of the known DNAzymes (EAD2, cMyc, and TA; see Table 1) to find novel sequences with high peroxidase activities. All of the mutants, EAD2, and c-Myc were synthesized on the microarray in quintuplicate. In the case of TA, 1,232 mutants were randomly selected from a large number of mutants. The electrochemical intensities from the known DNAzymes, such as EAD2 and c-Myc sequences with hemin, were significantly higher than those for TA (Fig. 3). This result is consistent with a report on the colorimetric detection of DNAzyme activity.8 From the sets of novel EAD2 mutants, 7 were found to have higher signals than the original EAD2 (Fig. 4a). Moreover, 213 c-Myc mutants produced higher signals than the original c-Myc DNAzyme sequence (Fig. 4b). These comprehensive experiments allow novel, more active DNAzyme sequences to be identified with high reproducibility in a systematically designed DNA array. From the t-test results, the 13 novel mutants of the c-Myc sequence gave stronger HRP-like signals than native c-Myc with more than 95% confidence (Fig. 3, P < 0.05 by Welch’s t-test). Thus, this experimental method can be used to identify improved DNAzyme sequences. This technology also has the potential to find novel DNAzymes not only from DNAzymes with known mutations but also from comprehensive DNA sequence designs.


9


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 10 of 23

Sequence analysis of DNAzymes This analysis clearly shows that the signal intensities of EAD2 mutants can be classified into 3 clusters on the basis of the number of guanine residues (Fig. 4a). Increasing the number of guanines resulted in decreased signal intensities, which suggests that guanines in the loop region influence G-quadruplex folding. Conceivably, G-quadruplex conformation activity could be reduced by heterogeneous conformations that are caused by extra guanines in a DNAzyme sequence. A similar tendency was observed for the c-Myc mutants. One of these (c-Myc-0584: TGAGGGGTGGGAGGGGCGGGAA; underlines indicate mutation sites) exhibited the highest signal observed in this study (Fig. 3). To analyze the sequence features of highly active DNAzymes, the sequences of 13 c-Myc mutants with activities that were higher than that of cMyc were compared (Fig. 5). The results showed that G is most commonly found at position 7 (over 80%), which indicates that in the first loop one base (as in EAD2) is preferable to 2 bases. In contrast, G is rarely found at positions 8, 12, and 16, which suggests that G in those positions is unfavorable for activity. This is also true for EAD2. Interestingly, A is abundant at position 12 in the middle loop, which implies that this is important to the folding or stability of the Gquadruplex. The length of the third loop—whether 1 or 2 bases—seems to be less critical from our observations.

Comparison of the peroxidase activities of DNAzymes under other conditions


10

Page 11 of 23

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


In order to validate the results of microarray screening, we measured the DNAzyme activity in solution by using a chemiluminescence assay. We compared the screened DNAzyme c-Myc0584, control DNAzymes (SA, TA, c-Myc, and EAD2) and PS2.M, a reported artificial DNAzyme.1–3 As shown in Fig. 6a, the results indicate that the c-Myc-0584 activity was higher than that of c-Myc, which was in agreement with the microarray screening (P < 0.0012 by using Welch’s t-test). Only EAD2 gave a different result from the microarray screening result. It is possible that the EAD2 DNAzyme activity was an effect of its immobilized condition in the microarray. To investigate whether c-Myc-0584 is suitable for other applications, c-Myc-0584 and each DNAzyme were blotted onto a membrane and their activities were compared by the colorimetric method. The immobilization sites of the DNAzymes on the membrane were different from the 3′-end attachment on the microarray and they were also non-uniform. The results show that the c-Myc-0584 activity was higher than the activities of native c-Myc and PS2.M, but not of EAD2 (Fig. 6b). This suggests that c-Myc-0584 is better suited to the development of a highly sensitive sensor where it would be in an immobilized condition that is similar to the one for the microarray. PS2.M is a designed DNAzyme that is widely used in aptamer sensor applications.2,5 Because the level of activity of each DNAzyme is dependent upon the experimental conditions (pH, potassium concentration, and saline concentration),2 the new, highly active DNAzyme will not be useful for all aptamer sensors. In our study, screening was done at neutral pH (pH 7.4) in an immobilized state. Changes in the screening procedure will be necessary to identify DNAzymes that are suitable for other applications. For example, screening at a higher pH may be necessary to isolate mutants that are more active under basic conditions.


11


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 12 of 23

Conclusions Herein, we reported the first detailed study of high-throughput quantitative screening of Gquadruplex-based peroxidase-like DNAzymes on a microarray that enables the detection of their activities by monitoring electrochemical signals. We evaluated the activities of various Gquadruplex DNA sequences that were designed by introducing mutations systematically into their loop regions that may play an important role in their structural stabilities.20 We found more than 100 kinds of novel DNA sequences that exhibit better activity than known DNAzymes. The activity of the best novel DNAzyme was also analyzed under other conditions i.e., colorimetric detection on a membrane and chemiluminescence detection in solution without immobilization, and compared with those of known DNAzymes. The results show that the microarray data is almost identical to the data on a membrane but is different from the in solution data. This suggests that the influence of immobilization of the DNAzyme on its activity cannot be ignored and that this is a limitation of DNAzyme screening by using a microarray. In addition, the direction of the immobilization might be important in terms of the activity: Zhang et al. previously reported that adding poly-dT to the 5′-end of DNAzyme improves their activities activity but that addition to the 3′-end decreases them.21 Although these limitations of DNAzyme screening exist, our microarray system is a powerful tool for developing not only DNAzymes but also aptamer sensors that consist of a DNAzyme and various aptamers.5,18 In general, the development of aptamer sensors requires a continuous process of trial and error. However, our screening system enables the evaluation of more than 1,000 kinds of candidate sequences of an aptamer sensor at once under any measurement condition at a reasonable cost and within a reasonable time. Thus, the high-throughput screening strategy that is described here could be


12

Page 13 of 23

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


used as a general approach for the development of aptamer sensors that can be used to detect various targets such as small molecules, nucleic acids, proteins, virus, and bacteria. Acknowledgments This work was supported by the Bio-oriented Technology Research Advancement Institution (BRAIN).

Figures

Figure 1. Array reproducibility. The plot indicates repeat measurement values for the 8 probes (n = 250) on a 4 × 2 K sample chip. The 8 probes were EAD2 and SA with poly-dT spacers of 0, 8, 16, or 24 bases. The straight line represents the regression line that was obtained from the plot.


13


25000

20000

Signal

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 14 of 23

15000

10000

5000

0

dT 0

5

10 15 20 25 30 35 40 45 50 55 60

Length of spacer

Figure 2. Dependence of electrochemical signal on poly-DT spacer length for EAD2. The average signal for each probe (n = 5) is shown with its standard deviation. “dT” represents the signal for a poly-dT 80-mer.

Figure 3. Summary of the electrochemical signal data for the redox reaction for each probe. The bottoms and tops of the gray boxes indicate the lower and upper quartiles, respectively. The thick black lines indicate the median and the open circles represent outliers. The x-axis label refers to the control and the c-Myc mutant probes. The numeric label refers to the ID of the c-Myc mutants with higher activities than that of wild-type c-Myc.


14

Page 15 of 23

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 4. (a) EAD2 mutants and wild-type DNAzymes. (b) c-Myc mutants and wild-type DNAzymes. The black dots indicate the signal intensity for individual DNAzymes that are graphed against the y-axis on the left side of the graph. The gray bars show the number of guanines in the corresponding DNAzyme that are graphed against the y-axis on the right side of the graph. The arrows indicate the signals for the wild-type DNAzymes.

Figure 5. Frequencies of sequences at the mutation sites for the 13 c-Myc mutants that generated higher signals than c-Myc. The major sequence of the mutants was TGAGGGG(A/T)GGGAGGG(A/T)(C/G)GGGAA (underlines indicate the mutation sites).


15


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 16 of 23

Figure 6. (a) Chemiluminescence assay. The kinetics of each DNAzyme with hemin are shown in the graph with relative light units (RLU) on the y-axis. The bars show the average of the measured values (n = 3). The error bars represent the standard deviations of the RLU. “Buffer” indicates hemin mixture without DNAzyme. (b) Colorimetric method that was employed by using slot blotting. The y-axis indicates the amount of DNAzyme in each row of bands. SA: part of a streptavidin aptamer;19 TA: thrombin aptamer;12 PS2.M: designed sequence;2 c-Myc: a promoter sequence of human c-Myc gene;11 EAD2: designed sequence;8 and c-Myc-0584: sequence from microarray screening.


16

Page 17 of 23

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure S-1. Distribution of the signal intensities for EAD2 probes with various lengths of polydT spacers ((a) 0, (b) 8, (c) 16, and (d) 24 bases; n = 250) in an intra-array. The x-axis represents the signal intensity and the height of the bar represents the frequency of occurrence.

Schemes

Scheme 1. High-throughput quantitative screening of a DNAzyme. The predicted structure is the reported DNAzyme (EAD2). The blue circles indicate the base of the reported DNAzyme’s predicted loop regions. The letters G with black circles show guanine nucleotides of G-tetrad planes. The over 2,000 candidate DNAzymes were designed by systematically mutating the predicted loop regions and synthesizing them on the microarray chip, after which they were analyzed by using an electrochemical detection microarray scanner. The best DNAzyme was


17


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 18 of 23

isolated from the results of the microarray screening. The letter N of the improved DNAzyme indicates any base (A, T, G, or C).


18

Page 19 of 23

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Tables

Table 1. DNAzyme sequences. The underlines indicate the mutation sites. EAD2: designed sequence;8 c-Myc: human c-myc gene;11 TA: thrombin aptamer;12 and SA: part of a streptavidin aptamer.19

AUTHOR INFORMATION Corresponding Author *Tel.: +81-3-5534-2619; E-mail: [email protected] Present Addresses 1-18-7, Shinkiba, Koto-ku, Tokyo 136-8627, Japan, NEC Soft, Ltd. Author Contributions The manuscript was written as a result of the contributions of all of its authors. All of the authors have given their approval of the final version of the manuscript. ‡These authors contributed equally. (Match statement to author names with a symbol) Funding Sources


19


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 20 of 23

Any funds that were used to support the research that is described in this manuscript should be placed here (per journal style). Notes Any additional relevant notes should be placed here.

ABBREVIATIONS HRP, horseradish peroxidase; TA, thrombin aptamer; FMA, ferrocene methyl alcohol; TMBE, 3,3′,5,5′-Tetramethylbenzidine with enhancer; poly-dT, polydeoxy thymidine; TMB, 3,3′,5,5′Tetramethylbenzidine; SA, streptavidin-binding aptamer.

REFERENCES 1.

Li, Y.; Sen, D. Nat. Struct. Biol. 1996, 3, 743–747.

2.

Travascio, P.; Li, Y.; Sen, D. Chem. Biol. 1998, 5, 505–517.

3.

Li, Y.; Geyer, R.; Sen, D. Biochemistry. 1996, 35, 6911–6922.

4.

Li, D.; Shlyahovsky, B.; Elbaz, J.; Willner, I. J. Am. Chem. Soc. 2007, 129, 5804–5805.

5.

Teller, C.; Shimron, S.; Willner, I. Anal. Chem. 2009, 81, 9114–9119.

6.

Du, Y.; Li, B.; Guo, S.; Zhou, Z.; Zhou, M.; Wan, E.; Dong, S. Analyst. 2011,136, 493–

497. 7.

Burge, S.; Parkinson, G. N.; Hazel, P.; Todd, A. K.; Neidle, S. Nucleic Acids Res. 2006,

34, 5402–5415.


20

Page 21 of 23

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


8.

Cheng, X.; Liu, X.; Bing, T.; Cao, Z.; Shangguan, D. Biochemistry. 2009, 48, 7817–

7823. 9.

Kong, D. M.; Yang, W.; Wu, J.; Li, C. X.; Shen, H. X. Analyst. 2010, 135, 321–326.

10.

Nakayama, S.; Wang, J.; Sintim, H. O. Chemistry. 2011, 17, 5691–5698.

11.

Phan, A. T.; Modi, Y. S.; Patel, D. J. J. Am. Chem. Soc. 2004, 126, 8710–8716.

12.

Macaya, R. F.; Schultze, P.; Smith, F. W.; Roe, J. A.; Feigon, J. Proc. Natl. Acad. Sci. U.

S. A. 1993, 90, 3745–3749. 13.

Katilius, E.; Flores, C.; Woodbury, N. W. Nucleic Acids Res. 2007, 35, 7626–7635.

14.

Fischer, N. O.; Tok, J. B.; Tarasow, T. M. PLOS One. 2008, 3, e2720.

15.

Knight, C. G.; Platt, M.; Rowe, W.; Wedge, D. C.; Khan, F.; Day, P. J.; McShea, A.;

Knowles, J.; Kell, D. B. Nucleic Acids Res. 2009, 37, e6. 16.

Lao, Y. H.; Peck, K.; Chen, L. C. Anal. Chem. 2009, 81, 1747–1754.

17.

Ghindilis, A. L.; Smith, M. W.; Schwarzkopf, K. R.; Roth, K. M.; Peyvan, K.; Munro, S.

B.; Lodes, M. J.; Stover, A. G.; Bernards, K.; Dill, K. Biosens. Bioelectron. 2007, 22, 1853– 1860. 18.

Pelossof, G.; Tel-Vered, R.; Elbaz, J.; Willner, I. Anal. Chem. 2010, 82, 4396–4402.

19.

Benjamini, Y.; Hochberg, Y. J. Roy. Statist. Soc. Ser. B. 1995, 57, 289–300.


21


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

20.

Page 22 of 23

Oliver, S.; Linda, P.; Jean-Louis, M.; David, J. C. M.; Julian, L. Bioinformatics. 2009, 25,

i375–i382. 21.

Ming, Z.; Haiqun, L.; Minggang, D.; Xiaocheng, W.; Heng, M.; Shuo, F.; Yangyang, Z.;

Xiang, Z. Chem. Biodiv. 2012, 9, 170–180.


22

Page 23 of 23

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


TOC

For Table of Contents Only


23

High-Throughput Quantitative Screening of Peroxidase-Mimicking

Recommend Documents