Highly Stabilized α-Helical Coiled Coils Kill Gram-negative Bacteria by

Subscriber access provided by UNIV AUTONOMA DE COAHUILA UADEC

Biological and Medical Applications of Materials and Interfaces

Highly Stabilized #-Helical Coiled Coils Kill Gram-negative Bacteria by Multi-complementary Mechanisms under Acidic Condition Zhenheng Lai, Peng Tan, Yongjie Zhu, Changxuan Shao, Anshan Shan, and Lu Li ACS Appl. Mater. Interfaces, Just Accepted Manuscript • DOI: 10.1021/acsami.9b04654 • Publication Date (Web): 04 Jun 2019 Downloaded from http://pubs.acs.org on June 4, 2019

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 50 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Applied Materials & Interfaces

Highly Stabilized α-Helical Coiled Coils Kill Gram-negative Bacteria by Multi-complementary Mechanisms under Acidic Condition Zhenheng Laia,‡, Peng Tana,‡, Yongjie Zhua, Changxuan Shaoa, Anshan Shana,*, Lu Lib a

Laboratory of Molecular Nutrition and Immunity, The Institute of Animal Nutrition,

Northeast Agricultural University, Harbin 150030, China; b

College of Life Science, Northeast Agricultural University, Harbin 150030, China.

Author information Corresponding author: * E-mail: [email protected]. Telephone: +86 451 55190685. Fax: +86 451 55103336. Postal address: No. 600 Changjiang Road, Xiangfang District, Harbin 150030, China. ‡ These

authors contributed equally to this work.

1 ACS Paragon Plus Environment

ACS Applied Materials & Interfaces 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ABSTRACT: Although antimicrobial peptides (AMPs) hold tremendous promise in overcoming the threats of multidrug resistance, the main obstacle to successful therapeutic applications is their poor stability. Various synthetic strategies such as unnatural amino acids and chemical modifications have made advances for improving this problem. However, this complicated synthesis often greatly increases the cost of production. Here, we show that a series of novel peptides, designed by combining an α-helical coiled coils model, knowledge of the specificity of proteolysis and major parameters of AMPs, exhibited efficient activity against all tested Gram-negative bacteria under acidic condition and demonstrate low toxicity. Of these α-helical coiled coil peptides, 3IH3 displayed the highest average therapeutic index (GMTI = 294.25) with high stability towards salts, serum, extreme pH, heat as well as proteases. Electron microscopy and biological analytical technique analyses showed that 3IH3 killed bacterial cells via a multi-complementary mechanism at pH 6.0, however, physical membrane disruption as the dominant bactericidal mechanism. These results suggest that 3IH3 shows great stability as an inexpensive and effective antimicrobial activity agent and has the potential for clinical application in the treatment of infections occurring in body sites with acidic pH. KEYWORDS: stability; antimicrobial peptides; multi-complementary mechanism; acidic condition; Gram-negative bacteria.


Page 2 of 50

Page 3 of 50 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


1. INTRODUCTION Antimicrobial peptides (AMPs) have been isolated from animals, plants and invertebrate species; they are a major component of the nonspecific innate defense system and form the first line of defense against invading pathogenic microorganisms.1-5 Certain AMPs also perform functions such as anti-biofilm formation, anti-inflammatory, promotion of tissue or wound repair and even anticancer.6-10 Unlike conventional antibiotics that work on the specific intracellular targets, many AMPs interact with microbial membranes through electrostatic interactions and form pores by “barrel-stave”, “carpet” or “toroidal-pore” mechanisms and then physically and rapidly damage the bacterial morphology.3,

11-12

Thus, AMPs are thought to be less likely to result in

antibacterial resistance. Because of these properties, AMPs show high potential to be a promising alternative to antibiotics. According to statistics, more than 3,000 AMPs have been isolated and characterized.1 However, only a few AMPs are being evaluated as topical applications, primarily due to their high toxicity and poor stability.4, 13 Major obstacles such as protease degradation and physiological electrolyte conditions in plasma or serum leading to rapid inactivation, which limit their development as pharmaceutical compounds.14-16 In addition, the proteases, especially endogenous human proteases including trypsin, chymotrypsin and pepsin are considered as the greatest threats to AMPs.17 Trypsin preferentially cleaves at basic residues (Arg and Lys), and chymotrypsin preferentially cleaves at hydrophobic residues, especially aromatic amino acid residues (Trp, Tyr, and Phe), which are both indispensable residues for AMPs activity.18 Numerous synthetic tactics have 3 ACS Paragon Plus Environment


been proposed to enhance the stability of antimicrobial peptides, such as substituting by unnatural amino acids, peptide cyclization, peptidomimetics, and multimeric peptides.19-22 Disappointingly, these strategies often obviously increase the factory cost of antimicrobial peptides, and the expensive cost of production is another obstacle limiting the widespread clinical uses of AMPs.17 In the present study, we tried to combine multiple strategies and use natural amino acids to design novel peptides with enhanced stability as much as possible (Scheme 1). A previous report has shown that helix stability confers salt resistance upon helical AMPs.23 The α-helical coiled coils would show a sequence periodicity of seven residues (heptad repeat), indicated as “abcdefg”, with hydrophobic residues in the “a” and “d” positions “forming the knobs-into-holes packing interactions and providing the energy needed to distort the mechanical-stabilized α-helices”.24 Hence, we used this sequence motif to design a series of heptad repeat sequence peptides to increase their stability and named these novel peptides as α-helical coiled coil peptides. Subsequently, based on the knowledge of the specificity of proteolysis and the major characteristics of AMPs, we screened out histidine and isoleucine to provide positive charge and hydrophobicity, respectively; Ile is placed at the “a” and “d” positions, and His amino acids are placed at the other stations. Then, at a suitable extent, we adjust the major parameters of antimicrobial peptides, such as net positive charge, hydrophobicity, amphipathicity, and sequence length. More specifically, H at the “g” position was replaced with I, which has higher hydrophobicity and amphipathicity, and the sequences (IHHIHHH) and (IHHIHHI) were repeated n (n = 1, 2, 3 and 4) times to estimate the optimal number of repetitions. 4 ACS Paragon Plus Environment

Page 4 of 50

Page 5 of 50 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Furthermore, the C-terminus of the peptides was aminated to further enhance stabilization.25 The antimicrobial activities of these α-helical coiled coil peptides were tested against a range of Gram-negative bacteria (E. coli, P. aeruginosa and S. typhimurium) at both acidic and neutral pH, while the fungi and probiotics were tested at acidic pH. Then, the stability of the peptides under different conditions (including salts, serum, extreme pH, heat, and proteases) and the cytotoxicity towards mammalian cells were also determined. Finally, the mode of the bactericidal mechanism of the peptides was preliminarily explored. Scheme 1. Schematic illustration depicting the design of novel α-helical coiled coil peptides.

(A) Helical wheel diagram reflecting the position of isoleucine residues at the “a” and “d” positions. (B) Helical wheel projections of the α-helical coiled coil peptides (left: 2IH3, right: 3IH3). (C) Sequence and schematic structure of the α-helical coiled coil peptides 3IH3. (D) 5 ACS Paragon Plus Environment


Page 6 of 50

Three-dimensional structure forecasts of the stability helix of the α-helical coiled coil peptides (left: 2IH3, right: 3IH3).

2. EXPERIMENTAL SECTION 2.1 Bacterial strains and materials. The bacterial strains E. coli ATCC25922, P. aeruginosa ATCC27853, S. typhimurium ATCC14028, E. coli K88, E. coli K99, E. coli 078, E. coli 987P, P. aeruginosa PAO1, S. typhimurium 7731, S. aureus ATCC25923, S. aureus ATCC29213 and S. epidermidis ATCC12228 were obtained from the College of Veterinary Medicine, Northeast Agricultural University (Harbin, China). E. coli UB1005 was kindly provided by the State Key Laboratory of Microbial Technology, Shandong University (Jinan, China). C. albicans cgmcc2.2086, C. tropocalis cgmcc2.1975, and C. parapsilosis cgmcc2.3989 were purchased from the China General Microbiological Culture Collection Center (CGMCC, Beijing, China). L. plantarum 8014 and L. rhamnosus 7469 were obtained from the Key Laboratory of Food College, Northeast Agricultural University. The human red blood cells (hRBCs) and serum were obtained from healthy donors. Human embryonic kidney (HEK293T) cells were kindly provided by the College of Animal Science and Technology, Northeast Agricultural University (Harbin, China). Mueller-Hinton Broth (MHB) and Lactobacilli MRS Broth powder were obtained from AoBoX (China). Trifluoroethanol (TFE) was obtained from Amresco (USA). Trypsin and pepsin were purchased from Biofount (China); proteinase K and chymotrypsin were purchased

from

Sigma-Aldrich

(China).

Bovine

serum

albumin

(BSA),

N-phenyl-1-naphthylamine (NPN), 3,3-dipropylthiadicarbocyanine (DiSC3-5), Triton X-100, 6 ACS Paragon Plus Environment

Page 7 of 50 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


lipopolysaccharide

(LPS)

from

E.

4-(2-hydroxyethyl)piperazine-1-ethanesulfonic

coli acid

O111:B4, (HEPES),

3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT), propidium iodide (PI) and BODIPY-TR-cadaverine (BC) were purchased from Sigma-Aldrich (China). RPMI 1640, medium-high glucose (DMEM) was obtained from Gibco (China). 2.2 Peptides synthesis and Solubility test. All peptides in this study were synthesized by GL Biochem (Shanghai) Ltd. and were analyzed by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS; Linear Scientific Inc, USA) using α-cyano-4-hydroxycinnamic acid as the matrix. The purity and retention time of each peptide was analyzed by RP-HPLC with a column of Gemini-NX C18-5 (4.6×250 mm, 5 µm particle size) and the mobile phase components were 0.1% trifluoroacetic in water/acetonitrile. The peptides solubility was measured by Micro-BCA assay in 10 mM PBS buffer with different pH (6.0 or 7.4) as described by Dagmar Schlenzig et al.26 Briefly, 10 mM PBS was prepared with different pH. Peptides were dissolved in ultrapure water (2.56 mM) and mixed with PBS (peptides solution: PBS buffer = 1:9), one part of the mixture was centrifuged for 30 min at 12000 rpm, then, the absorbance of the supernatant was measured at 562 nm on an F-4500 fluorescence spectrophotometer (Infinite 200 Pro, Tecan, China), another part of the mixture was directly quantitated by the fluorescence spectrophotometer. The concentration of the peptides in the supernatant was converted by the ratio of the absorbance of these two solutions. All results represent the mean of three independent experiments. 7 ACS Paragon Plus Environment


Page 8 of 50

The primary physical and chemical parameters analysis of the peptides was performed

online

with

the

ExPASy

Proteomics

Server

(http://www.expasy.org/tools/protparam.html). The secondary structure content was predicted online by K2D3 (http://www.ogic.ca/projects/k2d3/). The three-dimensional structure

projection

was

estimated

online

with

I-TASSER

(http://zhanglab.ccmb.med.umich.edu/ I-TASSER/). 2.3 Antimicrobial activity assays. The minimum inhibitory concentrations (MICs) of the peptides were determined using a modified standardized broth microdilution method. The bacterial isolates were cultured overnight at 37 °C in MHB and metastasized to new MHB until the growth reached to mid-logarithmic phase. The bacterial solution was then centrifuged and resuspended in MHB (pH=7.4 or 6.0) to a final concentration of 1 × 105 CFU/mL, and aliquots (50 µL) were transferred into a 96-well plate. Then, 50 µL of BSA solution containing different concentrations of peptides with the pH adjusted to match the culture condition was loaded to the bacterial solution on the plate. The final peptide concentrations in 96-well plates ranged from 0.125 to 64 µM. After incubation for 22-24 h at 37 °C, the optical density of the assay solution was measured at 492 nm; the lowest peptide concentration with no optical density increase was defined as the MICs. In addition, fungi colonies incubated in RPMI 1640 medium containing morpholinepropanesulfonic (MOPS) acid (pH = 6.0) and probiotics isolates incubated in MRS medium (pH = 6.0), the MICs of the peptides against fungi and probiotics were also measured by the above method. The assays were conducted in three independent runs. 8 ACS Paragon Plus Environment

Page 9 of 50 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


2.4 Hemolytic activity test. The peptides were dissolved in 10 mM PBS at pH 6.0 or 7.4, and the peptide solution was serially diluted in 10 mM PBS at the same pH. The pH value of the PBS was adjusted with acetic acid. The human red blood cells were washed thrice and diluted in PBS (pH = 6.0 or 7.4). Then, 50 µL of hRBCs (~2% (v/v)) suspension was incubated with 50 µL of peptide solution (2 to 256 µM) at 37 °C for 1 h. The positive control was hRBCs treated with 0.1% Triton X-100, and the negative control was an untreated hRBCs suspension. After incubation, the mixtures were centrifuged at 1,000 g for 10 min, and the supernatant (50 µL) were transferred to a new 96-well plate. The released hemoglobin was recorded by the absorbance of the supernatants at 570 nm with a microplate reader (Tecan, Austria). The percentage of hemolysis was obtained using the formula: Hemolysis (%) = [(OD570 of the treated sample - OD570 of the negative control) / (OD570 of the positive control - OD570 of the negative control)] ×100% The assays were conducted in three independent runs. 2.5 Cytotoxicity assays. HEK293T cells were used to evaluate the cytotoxicity of each peptide. Briefly, 2 × 105 cells/well in high-glucose DMEM (pH adjusted to 6.0 or 7.4) were seeded in 96-well plates; then, varying concentrations of test peptide solutions (4-256 µM) diluted in basal medium (pH = 6.0 or 7.4) were added to the cells, and the mixtures were cultured at 37 °C in 5% CO2 for 4 h. An MTT solution (50 µL, 0.5 mg/mL) was added and further incubated for 4 h at 37 °C. Then, the supernatants were completely removed and the formazan crystals 9 ACS Paragon Plus Environment


were dissolved by 150 µL of dimethyl sulfoxide (DMSO). The absorbance of the solution was measured at 570 nm with a microplate reader (Tecan, Austria). The assays were conducted in three independent runs. 2.6 Circular dichroism (CD) Spectroscopy. The peptides were incubated with 10 mM PBS (pH = 6.0 or 7.4) or 50% TFE (pH = 6.0 or 7.4) for 0, 2, 4, 8 and 16 h with a final concentration of 150 µM. CD spectra (λ195−250nm) were recorded using a J-820 (Jasco, Japan) spectropolarimeter in a 1 mm path length quartz cell at room temperature. The results were expressed as the mean residue ellipticity [θ] in degree square centimeter per decimole. 2.7 Salt and Serum sensitivity assays. E. coli ATCC25922 grown to logarithmic phase in MHB, diluted to 1 × 106 CFU/mL and used to analyze for the salt and serum sensitivity. For the salt sensitivity assays, each salt powder was melted in BSA solution (pH = 6.0) involving the peptide at various concentrations and mixed evenly with the diluted bacterial solution (pH = 6.0) (bacterial diluent: BSA containing peptide and salt = 1: 1), the final salt concentrations and physiological concentrations (150 mM NaCl, 4.5 mM KCl, 6 µM NH4Cl, 8 µM ZnCl2, 1 mM MgCl2, 2 mM CaCl2 and 4 µM FeCl3) were exactly alike. The subsequent steps refer to the measurement method of MIC. For the serum sensitivity assays, peptides were incubated with 100% concentration of human serum for 2, 4, 8, 12, 24 h at 37 °C, then the MICs of these peptides were measured. Three independent runs were conducted for each peptide and concentration. 2.8 Thermal and Acid-base stability assays. 10 ACS Paragon Plus Environment

Page 10 of 50

Page 11 of 50 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


The thermal and acid-base stability of the peptides were assessed using an MIC assay similar to our previous method.27 For the thermal stability assay, the peptides were incubated in boiled water for 30 min and cooled on ice for 15 min. For the acid-base stability assays, the peptides were incubated with different pH values of PBS (pH = 2 or 12) for 4 h at 37 °C. Then, the MIC values at pH 6.0 were determined as described above. Three independent runs were conducted. 2.9 Proteolytic stability assays. Protease stability of these peptides was performed using a modified MIC method and tricine–SDS–PAGE analysis.28 The antimicrobial activities of these peptides were measured under different concentrations of proteases, each peptide (2.56 mM) was incubated with different concentrations of proteases at 37 °C for 1 h. Subsequently, the MIC values at pH 6.0 were measured as described above. Three independent runs were conducted for each peptide and concentration. Subsequently, to confirm the effects of protease incubation time on peptides, 10 µL of each peptide (2.56 mM) was digested with 10 µL of different proteases (2 mg/mL) at 37 °C for 0.5, 2, 4 and 8 h. Then, the reaction solution was diluted 20 times and determined by 16.5% tricine–SDS–PAGE. 2.10 3D-SIM super-resolution microscopy imaging. FITC-labeled peptide and propidium iodide (PI) was used to determine the action sites of the peptide by 3D-SIM super-resolution microscopy.29 E. coli ATCC25922 cells (1 × 106 CFU/mL) were incubated with FITC-labeled peptide at 1 × MIC in PBS (pH = 6.0) at 37 °C for 15 min. Subsequently, the mixture washed three times, resuspended in PBS, 11 ACS Paragon Plus Environment


and then incubated with PI (10 µg/mL) for 15 min at 4 °C. The excess PI dye was removed by centrifugation and then transferred to a sterilized glass slide. The images were observed using a Deltavision OMX system (GE Healthcare, USA) with a 488 and 535 nm bandpass filter for FITC signal and PI signal excitation. 2.11 Peptides binding to E. coli lipopolysaccharide (LPS) assays. The peptides binding affinities to LPS were examined using the fluorescent dye BC (Sigma, USA) displacement assay.30 Fluorescence is quenched when BC is bound to cell-free LPS and released in solution by LPS/peptide binding. BC (5 µg/mL) was incubated with LPS from E. coli O111:B4 in Tris buffer (50 mM, pH = 6.0 or 7.4) in a 96-well plate for 4 h. Subsequently, 50 µL of the peptide (final concentration ranging from 0.5 to 16 µM) was added to equal volumes of LPS-BC mixture. Then, the fluorescence was measured on an F-4500 fluorescence spectrophotometer (Infinite 200 Pro, Tecan, China, λ

emission

= 620 nm, λ

excitation

= 580 nm). The values were converted to %∆F (AU)

using the following formula: %∆F (AU) = [(F test sample - F negative control) / (F positive control - F negative control)] ×100% Where negative control is the initial BC fluorescence with LPS in the absence of peptides, and positive control is the BC fluorescence with LPS upon the addition of polymyxin B (10 mg/mL, a prototype LPS binder). The assays were conducted in three independent runs. 2.12 Outer membrane (OM) permeability assays. OM permeability was converted by the fluorescent dye NPN. Briefly, E. coli ATCC25922 cells were incubated to mid-log phase in MHB and diluted to 0.2 (OD600) in HEPES buffer (pH = 6.0 or 7.4, containing 5 mM glucose). Before a 30 min incubation at 12 ACS Paragon Plus Environment

Page 12 of 50

Page 13 of 50 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


37 °C, 10 µM NPN was added to all bacterial suspensions. Subsequently, 100 μL E. coli cell suspension and 100 μL peptides suspension (final concentration ranging from 0.5 to 16 µM) was sowed in the 96-well plate. The fluorescence was determined with an F-4500 fluorescence spectrophotometer (Hitachi, Japan, λ

emission

= 420 nm and λ

excitation

= 350

nm). Values were converted to percent NPN uptake using the following equation: %NPN uptake = [(F test sample - F negative control) / (F positive control - F negative control)] × 100% Where negative control is the initial NPN fluorescence with E. coli ATCC25922 cells and positive control is the NPN fluorescence with E. coli ATCC25922 cells upon the addition of polymyxin B (10 µg/mL). The assays were conducted in three independent runs. 2.13 Cytoplasmic membrane (CM) depolarization assays. To measure the CM depolarization of bacterial cells, E. coli ATCC25922 cells were cultivated to mid-logarithmic phase in MHB and diluted to 0.05 (OD600) in 5 mM HEPES buffer (pH = 6.0 or 7.4, containing 20 mM glucose and 0.1 M KCl). Then, the bacterial suspensions were incubated with membrane potential-sensitive dye DiSC3-5 (0.4 µM) for 30 min at 37 °C. Fluorescence changes were recorded for 1500 seconds using an F-4500 fluorescence spectrophotometer (Hitachi, Japan, λ emission = 670 nm and λ excitation = 622 nm) after the bacterial suspension was mixed with peptides (0.5 ×, 1 ×, and 2 × MIC). The assays were tested in three independent runs. 2.14 Membrane integrity assays. The E. coli ATCC25922 cells membrane integrity was confirmed by flow cytometer. Briefly, E. coli cells were grown to mid-log phase in MHB at 37 °C, harvested by centrifugation at 5,000 g for 5 min, washed three times with PBS (pH 6.0 or 7.4) and 13 ACS Paragon Plus Environment


Page 14 of 50

diluted to 106 CFU/mL. Then, the peptides at the final concentrations of 1 × MIC were incubated with E. coli cells suspension for 90 min at 37 °C. Subsequently, the mixture was incubated with PI at a final concentration of 10 µM for 30 min at 4 °C. The data of viable cells per 10,000 was obtained using a FACS flow cytometer (Becton–Dickinson, USA). 2.15 Scanning electron microscopy (SEM) and Transmission electron microscopy (TEM) characterization. For SEM and TEM sample preparation, E. coli ATCC25922 cells were grown to the mid log phase in MHB and recovered via centrifugation at 5,000 g for 5 min, washed three times, and resuspended in PBS (10 mM, pH = 6.0). Then, the peptides (1 × MIC) were incubated with E. coli cells (OD600 = 0.2) in PBS (pH = 6.0) for 90 min at 37 °C. Bacteria incubated in the absence of peptides served as the control. The subsequent steps were taken based on a previously described protocol.25 2.16 Programmed cell death pathway Assays. The mRNA levels of mazEF, recA and lexA relative to control genes was quantified by quantitative real-time PCR (qRT-PCR). Briefly, the total RNA was isolated from E. coli ATCC25922 (OD600 = 0.4) using an RNAprep pure Cell/Bacteria Kit (Tiangen, China) after being incubated with 3IH3 (1 × MIC or 4 × MIC) at pH 6.0 for 3 h. One microliter of total RNA was reverse transcribed using PrimeScript™RT reagent Kit with gDNA Eraser (Takara, Japan). To amplify cDNA, the following primers were used: MazEF (for) CTTCGTTGCTCCTCTTGC,

(rev)

AGATCCTCTACGGCGAAGGT,

(rev)

CGTTGGGGAAATTCACCG; CCTGCTTTCTCGATCAGCTT;

recA lexA

(for) (for)

GACTTGCTGGCAGTGCATAA, (rev) TCAGGCGCTTAACGGTAACT; 16SrRNA (for) 14 ACS Paragon Plus Environment

Page 15 of 50 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


TGTAGCGGTGAAATGCGTAGA, (rev) CACCTGAGCGTCAGTCTTCGT.31 Real-time PCR was performed using TB Green™ Premix Ex Taq™ (Takara, Japan) in a 7500 Fast real-time PCR system (Applied Biosystems). The gene expression was normalized to the corresponding 16SrRNA level. The relative fold-change of the mRNA expression of the target genes were calculated according to the method of Shu J. Lam.29 The assays were conducted in three independent runs. 2.17 Programmed cell death pathway inhibition Assays. E. coli ATCC25922 cells were grown in MHB at 37 °C to mid-log phase and diluted to 1 × 106 CFU/mL in MHB. Then, 5 mL of the bacterial diluent was mixed with 5 mL of doxycycline hyclate (1 µg/mL). The bacterial cells were recovered via centrifugation (5,000 g, 5 min) after being incubated at 37 °C for 4 h and resuspended in 10 mM PBS (pH = 6.0). Subsequently, the resuspended solution was incubated at 37 °C for 1.5 h in the absence or presence of peptide (0.5 ×, 1 × and 4 × MIC). Then the mixture was incubated with PI at a final concentration of 10 µM at 4 °C for a further 30 min. Each sample was analyzed by FACS flow cytometer (Becton–Dickinson, USA) to determine the ratio of PI-positive cells. The assays were conducted in two independent runs. 2.18 Kinetics of antimicrobial activity. The kinetics of antimicrobial activity was determined by flow cytometry. Briefly, E. coli cells were cultured in MHB to mid-log phase at 37 °C, recovered via centrifugation at 5,000 g for 5 min, washed three times and resuspended in PBS (10 mM, pH = 6.0) buffer. Then, the peptides (1 × MIC) were incubated with E. coli cells (1 × 106 CFU/mL) in PBS (pH = 6.0) at 37 °C. Aliquots were taken at t = 0, 5, 15, 30 and 90 min to record the 15 ACS Paragon Plus Environment


percentage of PI-positive cells using a FACS flow cytometer (Becton–Dickinson, USA). An untreated group was also measured as the control. The experiments were conducted two times independently. 2.19 DNA-binding assays. The DNA-binding assays were performed by gel retardation experiments as previously described.27 In brief, peptide samples were mixed with total genomic DNA (extracted from E. coli ATCC25922 cells) in 20 µL of binding buffer (1 mM EDTA, 10 mM Tris-HCl (pH = 8.0), 1 mM dithiothreitol, 5% glycerol, 20 mM KCl, and 50 µg/mL BSA). Next, the mixtures were incubated at 37 °C for 1 h. Subsequently, the samples were mixed in the native loading buffer (10 mM Tris-HCl (pH = 7.5), 10% Ficoll 400, 50 mM EDTA, 0.25% xylene cyanol and 0.25% bromophenol blue) and analyzed by 1% agarose gel electrophoresis in 0.5 × TFE buffer.

3. RESULTS 3.1 Characterization of the peptides. The measured molecular weights and the retention time of the peptides were confirmed by mass spectrometry and RP-HPLC analyses (as listed in Table 1). All of the measured molecular weights of the peptides were almost identical to their theoretical molecular weights, indicating that the peptides had been successfully synthesized. The retention time of these peptides could effectively reflect their relative hydrophobicity, the retention time of α-helical coiled coil peptides 2IH1, 2IH2, 2IH3, 2IH4, 3IH1, 3IH2, 3IH3 and 3IH4 were 7.395, 10.171, 10.108, 12.804, 14.585, 14.500, 19.958 and 21.735 min, respectively, indicating that the hydrophobicity of these α-helical coiled coil peptides 16 ACS Paragon Plus Environment

Page 16 of 50

Page 17 of 50 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


follows the order 3IH4 > 3IH3 > 3IH1 > 3IH2 > 2IH4 > 2IH2 > 2IH3 > 2IH1. The change in pH from 6.0 to 7.4 led to a sharp reduction in the solubility of 2IH3, 2IH4, 3IH2, 3IH3 and 3IH4. For example, the solubility of 2IH3 and 3IH3 decreased from >256 µM to 188.64 and 135.25 µM, respectively. Table 1. Peptides and their key physicochemical parameters.

Peptides

Sequence

Theoretical

Measureda

Retention

MW

MW

time(min)

Net charge

Solubility (µM) µHrelb

pH=6.0

pH=7.4

pH=6.0

pH=7.4

2IH1

IHHIHHH-NH2

930.04

929.06

7.395

6

1

>256

>256

/

2IH2

IHHIHHHIHHIHHH-NH2

1842.06

1841.10

10.171

11

1

>256

>256

0.403

2IH3

IHHIHHHIHHIHHHIHHIHHH-NH2

2754.09

2753.13

10.108

16

1

>256

188.64

0.393

2IH4

IHHIHHHIHHIHHHIHHIHHHIHHIHHH-NH2

3666.11

3665.16

12.804

21

1

>256

67.06

0.379

3IH1

IHHIHHI-NH2

906.06

905.08

14.585

5

1

>256

>256

/

3IH2

IHHIHHIIHHIHHI-NH2

1794.10

1793.13

14.500

9

1

>256

192.35

0.466

3IH3

IHHIHHIIHHIHHIIHHIHHI-NH2

2682.14

2681.18

19.958

13

1

>256

135.25

0.454

3IH4

IHHIHHIIHHIHHIIHHIHHIIHHIHHI-NH2

3570.19

3569.23

21.735

17

1

>256

42.72

0.438

GIGAVLKVLTTGLPALISWIKRKRQQ-NH2

2846.46

2846.46

15.095

6

6

N/A

N/A

0.394

Melittin

a Molecular

b The

weight (MW) was measured by mass spectroscopy (MS).

relative hydrophobic moment (µHrel) of a peptide is its hydrophobic moment relative

to that of a perfectly amphipathic peptide. “/” indicate that the sequence is too short to calculate (minimum 8). This gives a better idea of the amphipathy using different scales. A value of 0.5 thus indicates that the peptide has about 50% of the maximum possible amphipathy,

the

values

were

calculated

from

http://heliquest.ipmc.cnrs.fr/cgi-bin/ComputParams.py. 3.2 Antimicrobial activity assays. As shown in Table 2 and Table S1, the activity against Gram-negative bacteria of these peptides are highly effective at pH 6.0 but exhibit no detectable bacteriostatic activity at pH 7.4. For Gram-negative bacteria, at pH 6.0, the peptides with 3 repeat units 17 ACS Paragon Plus Environment


Page 18 of 50

showed the best antimicrobial activity among their corresponding series; for example, compared with 2IH1, 2IH2 and 2IH4 with the geometric mean of MIC (GMMIC) values equal to ≥ 128.00, 68.59 and 3.48 µM, respectively, 2IH3 displayed higher antimicrobial activity with a GMMIC value of 2.46 µM; moreover, 3IH3 (GMMIC = 0.87 µM) with 3 repeat units of (IHHIHHI) showed higher activity against Gram-negative bacteria than 2IH3 with 3 repeat units of (IHHIHHH) and even displayed approximately 2-fold higher antimicrobial activity than melittin (GMMIC = 1.41 µM). Peptides 3IH4 (GMMIC=7.46 µM) with an increase in the number of repeating units, but the activity was not further increased. For Gram-positive bacteria, no activity was detected at either pH 6.0 or pH 7.4 (Table S2). In further studies using fungal strains, 3IH3 were also found to be effective against C. albicans 2.2086, C. tropocalis 2.1975 and C. parapsilosis 2.3989 with registering MIC values of 2, 1 and 2 µM at pH 6.0, respectively (Table S3). However, the 3IH3 peptide showed no significant activity against probiotics at pH 6.0 (Table S3). Table 2. The MICsa (µM) of the peptides against Gram-negative bacteria at pH 6.0 P.

P.

S.

S.

aeruginosa

aeruginosa

typhimurium

typhimurium

27853

PAO1

14028

7731

>64

>64

>64

>64

>64

/

>64

64

8

64

>64

>64

68.59

2

4

2

0.5

1

16

8

2.46

1

4

1

1

1

64

>64

3.48

>64

>64

>64

>64

>64

>64

>64

>64

/

8

4

4

8

2

4

4

32

16

6.06

1

1

1

1

0.5

0.5

1

0.5

2

1

0.87

3IH4

2

4

2

4

4

4

8

4

>64

>64

7.46

Melittin

1

1

1

1

2

1

2

2

2

2

1.41

E. coli

E. coli

E. coli

E. coli

E. coli

E. coli

25922

UB1005

K88

K99

078

987P

2IH1

>64

>64

>64

>64

>64

2IH2

64

64

>64

64

2IH3

2

2

2

2IH4

1

2

4

3IH1

>64

>64

3IH2

4

3IH3

Peptides

a

Minimum inhibitory concentration (μM) is defined as the minimum concentration of an

antimicrobial agent at which no visible microbial growth is observed. Data are 18 ACS Paragon Plus Environment

GMb

Page 19 of 50 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


representative of three independent experiments. b

GMMIC values for the 10 bacteria tested. When no detectable antimicrobial activity was

observed at 64 µM, the geometric mean of MIC values was calculated using 128 µM. “/” indicate the data is meaningless. 3.3 Biocompatibility assays To assess the biocompatibility of peptides, the hemolytic activities of these peptides were performed by measuring their activity against human red blood cells at both pH 6.0 and 7.4, and melittin was also measured as a control. As shown in Figure 1A and Figure 1B, in addition to melittin, the hemolytic activities of these peptides did not appear as pH dependent and induced inappreciable hemolytic activity, not exceeding 5% at all concentrations. The killing effects of the peptides on HEK293T cells under neutral and acidic conditions were further studied (Figure 1C and 1D). Similar to the hemolytic activity, 2IH3 and 3IH3 had no cytotoxicity against HEK293T cells. At the concentration of 128 µM, 2IH3 and 3IH3 inducing more than a statistically 99% cell survival rate at both pH, however, 3IH4 exhibited slight cytotoxicity against HEK293T cells at pH 7.4 with an 80.76% cell survival rate. 2IH4 and 3IH4 also induced slight cytotoxicity at pH 6.0. As shown in Table 3, 3IH3 showed the highest geometric mean therapeutic index (GMTI = 294.25), which implies that it had the highest cell selectivity toward Gram-negative bacteria and excellent biocompatibility towards mammalian cells.



Page 20 of 50

Figure 1. Hemolytic activity and cytotoxicity of these peptides against hRBCs and HEK293T cells. The data were derived from three independent experiments test and presented as the means ± standard deviation. (A, B) Hemolysis ratio of these peptides after a 1h incubation with different concentrations (1-128 μM) of peptides at 37 °C. (C, D) Cytotoxicity of these peptides (2−128 μM) by MTT assay against HEK293T cells at pH 7.4 and 6.0. Table 3. The biocompatibility of these peptides. Peptides

2IH1

HC10a

GMMIC (µM)

/

IC90b

Therapeutic index (TI)c

pH=7.4

pH=6.0

pH=7.4

pH=6.0

Human red blood

HEK293T

>128

>128

>128

>128

/

/


GMTId

/

Page 21 of 50 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


2IH2

68.59

>128

>128

>128

>128

3.73

3.73

3.73

2IH3

2.46

>128

>128

>128

>128

104.07

104.07

104.07

2IH4

3.48

>128

>128

>128

128

73.56

52.02

61.86

3IH1

/

>128

>128

>128

>128

/

/

/

3IH2

6.06

>128

>128

>128

>128

42.24

42.24

42.24

3IH3

0.87

>128

>128

>128

>128

294.25

294.25

294.25

3IH4

7.46

128

>128

128

128

24.27

17.16

20.41

Melittin

1.41

2

4

1

1

2.01

0.71

1.19

a

HC10 is the lowest peptide concentration that results in 10% hemolysis. When no

hemolytic activity was detected at 128 μM, the therapeutic index was calculated using 256 μM. b

IC90 refers to the lowest peptide concentration that results in death in 10% of the cell

population. When >90% cell viability was observed at 128 µM, the therapeutic index (TI) was calculated using 256 μM. c

TI is calculated as HC10/GMMIC (IC90/ GMMIC). Larger values indicate greater cell

selectivity. “/” indicate the data is meaningless. d GM is TI

the geometric mean of TI values for the hRBCs and HEK293T cells.

3.4 Circular dichroism (CD) spectroscopic. The structural changes of α-helical coiled coil peptides with different incubation time in 10 mM PBS (mimicking an aqueous environment, pH = 6.0 or 7.4) and 50% TFE (mimicking the hydrophobic environment of the microbial membrane, pH = 6.0 or 7.4) were shown in Figure S1. The α-helix content of the peptides after different incubation time under different pH conditions were calculated using the K2D3 algorithm and shown in Figure S2. In general, the α-helical coiled coil peptides (except 2IH1, 2IH2 and 3IH1) in 10 mM PBS showed molar residue ellipticity minimum at 220 nm at pH 7.4, which is one of the characteristics of α-helical conformation. Furthermore, these peptides had a molar 21 ACS Paragon Plus Environment


residue ellipticity minimum at 200 nm and a point of inflection at 220 nm when the pH was converted to 6.0, indicating that all the peptides exhibited a nearly unordered conformation. The K2D3 algorithm results showed that incubation time could affect the helix content of the peptide in PBS, but these changes had no obvious regularity. Nevertheless, in 50% TFE, 2IH2, 2IH3, 2IH4, 3IH2, 3IH3 and 3IH4 showed an α-helical conformation that was apparent as characterized by both ellipticity minima at 208 and 222 nm. The helical content of these peptides remained substantially consistent, indicating that the incubation time could hardly cause the changes to the conformation in hydrophobic environment. What's more, for 2IH3 and 3IH3 at pH 6.0, the ratio of [θ]222/[θ]208 is about 0.95:1, which is the characteristic signal of a-helical coiled-coil structure.32-33 3.5 Salt and Serum sensitivity assays. Salt sensitivity was tested by MIC measurements in the presence of physiological concentrations of different salts (Table 4). At pH 6.0, the antimicrobial activities of the peptides against E. coli ATCC25922 had negligible effects in the presence of all of the tested cations except for Na+, which inactivated 2IH3 and reduced the antimicrobial activity of 3IH3 by increasing the MIC value from 1 to 2 µM. In particular, the MIC value of 3IH3 was decreased by Zn2+ from 1 to 0.5 µM. In summary, 3IH3 had the best salt stability and its GMMIC value in the presence of various salts was maintained compared with its MIC. Furthermore, the serum sensitivity was also tested (Figure 2A). The MICs value of the α-helical coiled coil peptides were increased slightly even after incubation with 100% serum for 24 h, but melittin increased the MIC value from 1 to 8 or 16 µM. 22 ACS Paragon Plus Environment

Page 22 of 50

Page 23 of 50 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Table 4. The MIC values (µM) of peptides against E. coli ATCC25922 in the presence of

physiological salts at pH 6.0a.

a

Peptides

Controlb

NaCl

KCl

NH4Cl

MgCl2

ZnCl2

FeCl3

GM

2IH1

>64

>64

>64

>64

>64

>64

>64

/

2IH2

64

>64

64

32

64

32

64

57.02

2IH3

2

>64

2

2

4

1

2

4.00

2IH4

1

>64

2

1

4

2

1

3.56

3IH1

>64

>64

>64

>64

>64

>64

>64

/

3IH2

4

>64

8

8

32

4

4

12.70

3IH3

1

2

1

1

1

0.5

1

1

3IH4

2

8

2

2

4

1

1

2.24

Melittin

1

4

1

1

4

1

1

1.59

The final concentrations of NaCl, KCl, NH4Cl, MgCl2, ZnCl2, and FeCl3 were 150 mM, 4.5

mM, 6 µM, 1 mM, 8 µM, and 4 µM, respectively. The data were derived from three independent experiments. b The

control MIC values were determined in the absence of these physiological salts.

3.6 Protease resistance of the peptides. Protease susceptibility of the peptides has always been an insurmountable barrier in the development of AMPs antibiotics. Therefore, the protease resistance of the peptides was determined by MIC measurements after incubation with different concentrations of protease for 1 h. As shown in Figure 2B and 2C, in addition to the inactivation of peptide 2IH3 in 8 mg/ml chymotrypsin, 2IH3 and 3IH3 maintained their effective antimicrobial activity after incubation with different concentrations chymotrypsin and of trypsin. In a further study (Fig. 2D), we found that 2IH3 and 3IH3 were still effective against E. coli ATCC25922 at pH 6.0 after treatment with pepsin and proteinase K. In contrast, melittin completely lost its activity after treatment with any concentration of these proteases. Furthermore, the tricine–SDS–PAGE results (Figure S3.) shown that 2IH3 and 3IH3 23 ACS Paragon Plus Environment


maintained high molecular integrity of the molecule even after 8 h of incubation. Whereas, melittin was completely degraded by any single protease after 2 h of incubation. This result indicated that 3IH3 had the best resistance to high concentrations of proteases. 3.7 Thermal stability and Acid-base stability assays. The antimicrobial activities of 2IH3, 3IH3 and melittin in high temperature and acid-base environments were shown in Figure 2E. 2IH3, 3IH3 and melittin maintained their antimicrobial activities after heating. Also, they could maintain their antimicrobial activities after being incubated with extremely acidic and alkaline PBS (pH = 2 and 12) for 4 h.

Figure 2. The stability analysis of the α-helical coiled coil peptides under different conditions. When no detectable antimicrobial activity was detected at 64 µM, the stability 24 ACS Paragon Plus Environment

Page 24 of 50

Page 25 of 50 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


analysis was showed using 128 µM. The data were derived from three independent experimental tests. (A) The MIC values of the peptides after incubation with 100% human serum for 0, 2, 4, 8, 12, 24 h at 37 °C. (B, C) The MIC values of the peptides after incubation with different concentrations (0, 2, 4, 8 mg/mL) of chymotrypsin (B) and trypsin (C). (D) The MIC values of the peptides after incubation with pepsin and proteinase K (2 mg/mL) for 1 h at 37 °C. (E) The MIC values of the peptides after incubation with extreme pH and heat (100 °C). The data were derived from three independent experiments test. 3.8 3D-SIM super-resolution microscopy imaging. 3D structured illumination microscopy was used to initially observe the localization of peptides on bacterial cells. Nucleic acid stain PI can bind to the DNA of dead cells to produce red fluorescence but cannot penetrate a living cell membrane. As revealed in Figure 3, FITC-labeled 3IH3 was observed to localize uniformly around the E. coli membrane; Furthermore, partial FITC-labeled peptide internalization was observed. Simultaneously, the fluorescent signal of the PI was also found.



Figure 3. Optical Deltavision OMX 3D-SIM images of E. coli ATCC25922 after treatment with FITC-labeled 3IH3 and nucleic acid stain PI in PBS at pH 6.0. (A, D) The signal of FITC-peptide (green), (B, E) The signal of PI (red). (C, F) Merged images. 3.9 LPS binding. The ability of 3IH3 to bind LPS at different pH values was evaluated by a fluorescence-based displacement assay with BC, and melittin was measured as a control. At pH 7.4 (Figure 4A), the fluorescence intensity was less than 10% at the highest concentration of 16 µM, which was far less than the fluorescence intensity of melittin under the same conditions. At pH 6.0 (Figure 4B), the results indicate that 3IH3 shows approximately identical fluorescence compared with melittin, with the fluorescence intensity exceeding 60% at a concentration of 2 µM.


Page 26 of 50

Page 27 of 50 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 4. (A, B) the ability of 3IH3 and melittin binding of LPS at pH 7.4 and 6.0. (C, D) Outer membrane permeability induced by different concentrations (0.5-16 µM) of 3IH3 and melittin at pH 7.4 and 6.0. (E, F) Time-dependent depolarization of E. coli ATCC25922 induced by different concentrations (0.5 ×, 1×, 2 × MIC) of 3IH3 and melittin at pH 7.4 and 6.0. All the experiment was repeated three times independently and plot with the means ± standard deviation. 3.10 Outer membrane permeability. To investigate whether 3IH3 binding to LPS on the OM will further cause membrane perturbation, the NPN uptake assay was used to measure the ability of peptides to permeabilize the OM. The results (Figure 4C and 4D) show that 3IH3 was able to permeabilize the OM of E. coli ATCC25922 at pH 6.0, which was slightly higher in the 27 ACS Paragon Plus Environment


percentage of NPN uptake than that of melittin at the same concentration, whereas 3IH3 induced a mild OM permeability at neutral pH, inducing only ~40% leakage at the highest concentration of 16 µM. This indicates that the NPN uptake of 3IH3 is obviously pH dependent. 3.11 Cytoplasmic membrane depolarization. In addition to the permeabilization of the OM, the CM membrane potential changes of the E. coli ATCC25922 CM were further investigated by DiSC3-5 at both pH. The results revealed that, at pH 7.4 (Figure 4E), 3IH3 resulted in slight fluorescence that was far less than that of melittin under the same conditions; at pH 6.0 (Figure 4F), depolarization of the CM caused by 3IH3 was in a time- and dose-dependent manner and the effects were stronger than the corresponding influence caused by melittin. 3.12 Flow cytometry. PI dye was used to further study the effects of peptide treatment on both membrane integrity and viability by flow cytometry. As shown in Figure 5, control at pH 7.4, control at pH 6.0 and 3IH3 at pH 7.4 resulted in 0.1, 1.7 and 4.0% PI-positive cells, respectively. However, with 3IH3 at pH 6.0, melittin at pH 7.4 and 6.0, the percentages of PI-positive cells increased to 98.5, 97.8 and 97.6%, respectively. These results indicate that 3IH3 is obviously pH dependent for antimicrobial actions.


Page 28 of 50

Page 29 of 50 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 5. Membrane permeabilization of E. coli ATCC25922 cells treated with 1 × MIC peptides at 37 °C for 90 min, as measured by an increase of fluorescence intensity of PI (10 µg/mL), the control was done without peptides. The data were representative of three independent experiments. 3.13 Programmed cell death (PCD) assay. In E. coli, two major PCD pathways have been reported: the mazEF pathway and the apoptosis-like death (ALD) pathway mediated by recA and lexA genes.34-35 The mazEF gene encode the degradation prone antitoxin MazE and the stable toxin MazF, When MazE is degraded by the ClpPA protein, the accumulation of MazF can cause some proteins involved in cell death to be selectively synthesized, similarly, the expression product of recA gene leads to the autodigestion of LexA protein, thereby increasing the expression of genes inhibited by the LexA protein, which would trigger apoptosis-like death.36 The results (Figure 6A) show that 3IH3 at 1 × MIC induced a 2.09- and 2.51-fold expression increase in recA and lexA genes, respectively, whereas there is no variation in mazEF levels. The results indicated that 3IH3 could mildly induce ALD responses in E. 29 ACS Paragon Plus Environment


coli ATCC25922. But at 4 × MIC, 3IH3 induced a mildly decrease in recA and lexA expressions. A further experiment investigated the activities of 3IH3 when the ALD pathway was inhibited by incubating E. coli ATCC25922 with doxycycline (a prokaryotic protein synthesis inhibitor). The results (Figure 6B) showed that at all tested concentrations, there was no significant change in the antibacterial activity of 3IH3 when the ALD pathway was inhibited.

Figure 6. (A) 3IH3 induced programmed cell death of E. coli ATCC25922; (B) Percentage of PI-positive (membrane-disrupted) E. coli cells following treatment with various concentrations (0 ×, 0.5 ×, 1 ×, and 4 × MIC) of 3IH3 for 90 min at 37 °C; (C) The bactericidal kinetics of 3IH3 and melittin were treated with peptides (1 x MIC) for various incubation time; All data are expressed as means ± standard deviation. (D) Determination of DNA binding ability of the peptides by gel retardation method. Different concentrations of 3IH3 were incubated with genomic DNA at 37 °C for 1 h. 30 ACS Paragon Plus Environment

Page 30 of 50

Page 31 of 50 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


3.14 Kinetics of antimicrobial activity and DNA-binding assays. Kinetics of antimicrobial activity was investigated by the percent of PI-positive cells after peptide (1 × MIC) treatment. As shown in Figure 6C, 3IH3 exhibited similar killing speed to that of melittin at pH 6.0, which can kill over 98% of the E. coli cells after incubation for 90 min. In addition, about 70% of E. coli cells were killed after incubation with 3IH3 for 5 min. Furthermore, the DNA binding assays investigated the possibility of intracellular effects. The results show (Figure 6D) that 3IH3 showed DNA binding activity at sur-32 µM concentrations. 3.15 SEM and TEM. Then, we used SEM and TEM to directly observe the action of 3IH3 act on E. coli ATCC25922 cells morphological and ultrastructural changes. Under SEM, the control untreated with 3IH3 had an intact membrane morphology (Figure 7A), the E. coli cells surface incubated with 3IH3 at pH 6.0 appeared to show pore formation (Figure 7B), corrugation (Figure 7C), and broken fragments (Figure 7D). Under TEM, the control E. coli cells (Figure 7E) with an integrated surface and dense cytoplasm; but the E. coli cells surface treated with 3IH3 at pH 6.0 presented obvious CM and OM separation (Figure 7F and 7G) and had pore formation that traversed the OM, peptidoglycan (PG) layer and CM (Figure 7G), which leaded to the leakage of cytoplasmic content, thus resulting in obvious clear areas (Figure 7F, 7G and 7H).



Figure 7. SEM and TEM micrographs of E. coli ATCC25922 treated with 3IH3 for 90 min at pH 6.0. (A) SEM Control; (B-D) 3IH3 treated; (E) TEM Control; (F-H) 3IH3 treated. The control did not contain peptide and all the data were representative of the three independent experiments.

4. DISCUSSION In this study, a series of peptides based upon the α-helical coiled coils model were designed for the purpose of improving their stability and biological activity. The antimicrobial assays demonstrated that, at pH 7.4, no activity was detected in all peptides except melittin, but 2IH2, 2IH3, 2IH4, 3IH2, 3IH3 and 3IH4 possessed effective antimicrobial activities against Gram-negative bacteria and fungi at pH 6.0, which was most likely because of the low pH leading to protonation of histidine residues, thus yielding positively charged 2IH2, 2IH3, 2IH4, 3IH2, 3IH3 and 3IH4.37 AMPs are generally believed to bind to the anionic bacterial membranes by electrostatic interactions, and cations are the crucial driving force.38 However, all α-helical coiled coil peptides were effectively inactive against Gram-positive bacteria at pH 6.0, this possibly stems from pH-dependent changes in Gram-positive bacteria.39-41 At pH 6.0, the activity of the peptides varies with the number of repeat units, peptides with n = 3 repeat units have the 32 ACS Paragon Plus Environment

Page 32 of 50

Page 33 of 50 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


highest activity. Meanwhile, 3IH3 had higher antibacterial activity than 2IH3 at pH 6.0, most likely because 3IH3 has a high hydrophobicity (retention time = 19.958) and amphipathicity.42 These observations thus clearly demonstrate that the antibacterial activity of AMPs is associated with the collective effect of net charge, sequence length, hydrophobicity, amphipathicity, and other parameters.43 Furthermore, the antibacterial activity of 2IH3 and 3IH3 is selective, showing an excellent bactericidal effect against Gram-negative bacteria and fungi but no inhibition of the growth of probiotics. This indicates that the peptides have a selective killing effect on harmful bacteria. The solubility of the α-helical coiled coil peptides also showed a pH dependence, at pH 6.0, the solubility of 2IH3 and 3IH3 was greater than 256 µM and it was much larger than their GMMIC value. However, changes in pH of the reaction environment can cause changes in cation-hydrophobic balance and could thus alter the biocompatibility of peptides.44 Thus, the hemolytic activities and the cytotoxicity of HEK293T cells were assessed (Figure 1). At all the tested concentrations and pH levels, both 2IH3 and 3IH3 had negligible hemolytic activity and cytotoxicity to human cells. This is due to mammalian cells are usually composed of zwitterionic phosphatidylcholines, while bacterial cell membranes are usually

composed

of

a

large

amount

of

negatively

charged

phospholipids

(phosphatidylglycerol), therefore cationic peptides target bacterial membranes through charge interaction.45 The secondary structures of 2IH3 and 3IH3 predicted online by I-TASSER indicated that they all exhibited α-helix stable structures (Scheme 1D). Thus, CD spectroscopy results (Figure S1) show that, under pH 6.0, 2IH3 and 3IH3 had a disordered structure in 33 ACS Paragon Plus Environment


PBS and exhibited a helical structure in TFE, which provides evidence that AMPs displayed antimicrobial activity by interacting with the bacterial membrane.46 We found that the changes in incubation time and pH has inappreciable effect on the conformation, this was probably because all of the α-helical coiled coil peptides (except 2IH1 and 3IH1) formed stable helical structures in 50% TFE and it is hardly affected by environmental pH.47-48 Though peptides show significant activity against bacteria, this activity would be decreased or even lost under proteases, salts, serum, thermal and acid-base conditions. Poor stability severely limits the potential clinical application of AMPs. To determine the stability of these peptides, we first measured the influences of the antimicrobial activities under physiological concentrations of salts at pH 6.0, as shown in Table 4; the antimicrobial activities of 2IH3 and 3IH3 were only negligibly influenced by the various salt ions except for Na+. These results are consistent with the previous studies showing that a steady helix structure is conducive to salt resistance.23 Interestingly, the antimicrobial activities of 2IH3 and 3IH3 were increased 1-fold under Zn2+ ions, which has also been found in other histidine-rich peptides and may be caused by facilitating contact between peptides and lipid membranes before their final fusion.49-50 Additionally, 3IH3 (nine Ile residues) shows superior salt stability to that of 2IH3 (six Ile residues) could be explained by the fact that the increased hydrophobic residue number in a suitable range has led to higher membrane binding affinity.51 It is well known that serum has a detraction effect on the antimicrobial activity of AMPs mainly by serum protease degradation.52-53 The serum sensitivity results (Figure 2A) showed that serum has a slight influence on the 34 ACS Paragon Plus Environment

Page 34 of 50

Page 35 of 50 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


antimicrobial activities of 2IH3 and 3IH3, indicated that our AMPs design method effectively increases the stability of the peptides resistance to serum. Poor protease stability is an inevitable issue in the clinical use of AMPs.54 The proteases concentration of 8 mg/mL for chymotrypsin and 2 mg/mL for pepsin, which was greatly approaching to the content of intestinal fluids (SIF) and simulated gastric fluids (SGF) in the US Pharmacopoeia.55 As shown in Figure 2B and 2C, 3IH3 exhibited excellent protease stability in four enzyme solutions, 2IH3 was not hydrolyzed by trypsin, pepsin, proteinase K as well as chymotrypsin that less than 8 mg/mL. Interestingly, 2IH3 was digested by 8 mg/mL of chymotrypsin, we suspect that this may be because chymotrypsin has a lesser hydrolysis capacity at His in position P1, while 2IH3 has more histidine residues.18 However, melittin as a control, unlike 2IH3 and 3IH3, was completely inactivated after 1 h of incubation; the band corresponding to melittin gradually disappeared as the incubation time increased and became invisible after 2 h of incubation (Figure S3). This could be explained by the fact that melittin has Leu, Trp, Lys and Arg residues that are potentially vulnerable to chymotrypsin, trypsin or pepsin digestion.18 The designed α-helical coiled coil peptides 2IH3 and 3IH3 were also resistant to degradation by proteinase K (Figure 2D), which could also be explained by the fact that we skillfully avoided the position of protease cleavages. Moreover, 2IH3 and 3IH3 exhibited thermal and acid-base stability (Figure 2E), which is important for many processes of production such as food or feed processing.56 Taken together, 3IH3 shows the best stability and has potential in clinical therapy as a novel antimicrobial agent. Based on the above results, 3IH3 had the best cell selectivity and stability. Thus, 35 ACS Paragon Plus Environment


3IH3 was taken further to assess the antimicrobial mechanism of pH dependence and the antimicrobial model at pH 6.0. As 3D-structured illumination microscopy (Figure 3) results shown, the FITC-labeled 3IH3 was associated at the membrane and interior of E. coli cells. Based on these studies, we hypothesized that 3IH3 peptides primarily localize on the bacterial membrane surface and could also inactivate bacteria by binding intracellular targets (e.g., DNA). Previous reports indicate that the OM of most Gram-negative bacteria is an asymmetric bilayer of phospholipid and lipopolysaccharides (LPS) and that AMPs can bind to LPS by electrostatic interactions.57-58 The LPS binding assay (Figure 4A and 4B) shows that 3IH3 produced markedly dose- and pH-dependent responses in binding ability; these results suggest that 3IH3 could bind to LPS on the OM at pH 6.0 and further inserted into the membrane. Subsequently, the OM permeability and CM depolarization were measured; the dates (Figure 4C-4F) indicate that 3IH3 caused sufficient permeabilization of OM and effective depolarization of CM at pH 6.0. Moreover, at acidic pH, the damage of both the OM and CM of E. coli bacterial cells was indicated by flow cytometry analysis (Figure 5). Summarily, the interaction of 3IH3 with the E. coli ATCC25922 cell membrane may result in OM permeabilization and CM perturbations that lead to ion channel and pore formation, thus leading to dissipation of this potential and cytoplasmic content leakage, finally resulting in facilitating E. coli cell death. However, these phenomena have not been detected under neutral conditions, which could be the reason for the disappearance of antimicrobial activity of 3IH3 at pH 7.4. To more directly and visually observe the active mechanism, SEM and TEM further 36 ACS Paragon Plus Environment

Page 36 of 50

Page 37 of 50 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


investigated the morphologic change of E. coli cells caused by 3IH3 (Figure 7) at pH 6.0. After treatment with 3IH3 at its MIC concentration, the formation of the holes, damage of the bacterial membrane, and isolation of bacterial fragments were clearly observed by SEM; meanwhile, significant cytoplasmic atrophy, leakage of the intracellular contents and pore formation that traversed the CM, PG layer and OM were detected by TEM. We deem that these physical membrane damages are the main reason leading to cell death. Previous studies have shown that, under stressful conditions such as DNA damage and

membrane

depolarization,

bacteria

could

trigger

programmed

cell

death

pathways.34-35 The results show that there was no change in the mazEF level at either low (1 × MIC) or high (4 × MIC) concentrations (Figure 6A); however, at 1 × MIC, 3IH3 induced a super-2-fold increase in both recA and lexA. These results suggest that 3IH3 could slightly induce ALD responses in E. coli at MIC concentration.29 Furthermore, a 1- to 2-fold decrease in recA and lexA expression could be seen at 4 × MIC. This result is most likely because 3IH3 peptides have rapid kinetics of killing bacteria, for example, about 70% of the E. coli cells were killed after incubation with 3IH3 for 5 min (Figure 6C); thus, the bacteria were killed without effective expression of ALD pathway. Additionally, E. coli translation inhibition test showed no change in the antimicrobial activity of 3IH3 when the ALD pathway was inhibited. (Figure 6B), this suggests that the ALD pathway is just a supplemental antimicrobic mechanism of 3IH3 at MIC concentration. Based on the 3D-SIM results, the internalization of 3IH3 to bacterial cells was also observed, we postulate that 3IH3 has DNA binding activity as previously reported.59 The result (Figure 6D) shows that 3IH3 bound DNA at concentrations above 32 µM, which was much higher 37 ACS Paragon Plus Environment


than its MIC concentration at pH 6.0. This suggested that the action of DNA binding maybe act as a supplemental bactericidal mechanism at high concentrations of 3IH3. Taken together, we postulate that the α-helical coiled coil peptide 3IH3 induce bacterial cell death by multiple complementary mechanisms at pH 6.0 (Figure 8). Initially, 3IH3 bind to LPS via electrostatic interactions and amplify the permeability of OM, then they concentrate in CM membrane until an implicit threshold is reached, subsequently coiled coils are formed spanning the membrane and induce CM depolarization, further they lead to the formation of holes and loss of the physical integrity of the CM, causing leakage of cytoplasmic content and leads to cell death in E. coli.60-62 Furthermore, the actions of slightly induced ALD at low concentrations and bound to DNA at high concentrations act as supplemental mechanisms for killing bacteria. Thus, the pH-dependent antimicrobial activity and multiple bactericidal mechanisms of 3IH3 have the potential to specifically treat the infection under acidic pHs, such as lung-lining fluids in cystic fibrosis, vagina, gastric mucosa, and skin, while, it is safe for commensal bacteria under physiological pH.


Page 38 of 50

Page 39 of 50 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 8. The possible mechanism of 3IH3 against E. coli ATCC25922 at pH 6.0. 3IH3 bound to LPS via electrostatic interactions, then they concentrate in CM membrane until an implicit threshold is reached, subsequently coiled coils are formed spanning the membrane and induce CM depolarization, further disrupt the CM by the formation of holes, causing leakage of cytoplasmic content and eventually leads to cell death in E. coli. Slightly inducing ALD pathway at low AMP concentrations and binding to DNA at high AMP concentrations act as a supplement mechanism to kill bacterias.



5. CONCLUSIONS In this study, we demonstrate that the pH-dependent antimicrobial activity of α-helical coiled coil peptides is caused by the protonation/deprotonation of histidine residues in peptide molecules under different pH environment, then leads to the gain or loss of the binding ability of LPS and membranes. We also systematically elucidated the multi-complementary mechanisms of 3IH3 under slightly acidic condition, using physical membrane disruption as the major bactericidal mechanism makes it difficult for bacteria to develop resistance to it. Among these α-helical coiled coil peptides, 3IH3 had the highest average biological activities (GM = 0.87 µM) and therapeutic index (TI = 294.25) and was extraordinary stable under various proteases, physiological concentrations of salts, serum and other adverse impacts. These features of 3IH3 suggest that it undoubtedly has the potential to develop into a novel antimicrobial agent for use in the treatment of Gram-negative bacterial and/or fungal infections occurring inside the body with acidic pH.


Page 40 of 50

Page 41 of 50 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


ASSOCIATED CONTENT Author Contributions Z.H.L and P.T contributed equally to this work, and they are both co-first-authors. Z.H.L and A.S.S designed and conceived the experiments. Z.H.L and P.T and Y.J.Z and L. L conducted the main experiments assay. Z.H.L wrote the main manuscript text. C.X.S and A.S.S supervised the work and revised the final version of the manuscript. All of the authors have read and approved the final version of the manuscript.

Supporting Information Available The supporting information includes the CD spectra of the peptides, the quantitative degradation of the peptides vs incubation time, 16.5% tricine–SDS–PAGE analysis for protease stability of the peptide, the MICs of the peptide against Gram-negative and Gram-positive bacteria at pH 7.4, the MICs of the peptides against Gram-positive bacteria, fungi and probiotics at pH 6.0.

Notes The authors declare no competing financial interest.

Acknowledgments Funding: This work is supported by the National Natural Science Foundation of China (31672434, 31472104 and 31872368), and the China Agriculture Research System (CARS-35).



REFERENCES (1) Guangshun, W.; Xia, L.; Zhe, W. APD3: the Antimicrobial Peptide Database as a Tool for Research and Education. Nucleic Acids Res. 2016, 44, 1087-1093. (2) Boman, H. G. Peptide Antibiotics and Their Role in Innate Immunity. Annu. Rev. Immunol. 1995, 13, 61-92. (3) Zasloff, M. Antimicrobial Peptides of Multicellular Organisms. Nature 2002, 415, 389–395. (4) Fjell, C. D.; Hiss, J. A.; Hancock, R. E.; Schneider, G. Designing Antimicrobial Peptides: Form follows Function. Nat. Rev. Drug Discovery 2012, 11, 37-51. (5) Hancock, R. E.; Brown, K. L.; Mookherjee, N. Host Defence Peptides From Invertebrates-emerging Antimicrobial Strategies. Immunobiology 2006, 211, 315-322. (6) Subramanian, S.; Ross, N. W.; MacKinnon, S. L. Myxinidin, A Novel Antimicrobial Peptide from the Epidermal Mucus of Hagfish, Myxine glutinosa L. Mar. Biotechnol. 2009, 11, 748-757. (7) Tellez, G. A.; Zapata, J. A.; Toro, L. J.; Henao, D. C.; Bedoya, J. P.; Rivera, J. D.; Trujillo, J. V.; Rivas Santiago, B.; Hoyos, R. O.; Castano, J. C. Identification, Characterization, Immunolocalization, and Biological Activity of Lucilin Peptide. Acta Tropica 2018, 185, 318-326. (8) Xian Chun, Z.; San Xia, W.; Yan, Z.; Shun Yi, Z.; Wen Xin, L. Identification and Functional Characterization of Novel Scorpion Venom Peptides with No Disulfide Bridge from Buthus Martensii Karsch. Peptides 2004, 25, 143-150. (9) Bellamy, W.; Takase, M.; Wakabayashi, H.; Kawase, K.; Tomita, M. Antibacterial Spectrum of Lactoferricin B, a Potent Bactericidal Peptide Derived From the N-terminal


Page 42 of 50

Page 43 of 50 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Region of Bovine Lactoferrin. J. Appl. Bacteriol. 1993, 73, 472-479. (10) Cuixia, C.; Yucan, C.; Cheng, Y.; Ping, Z.; Hai, X.; Fang, P.; Jian, R. L. High Selective Performance of Designed Antibacterial and Anticancer Peptide Amphiphiles. ACS Appl. Mater.

Interfaces 2015, 7, 17346-17355. (11) Brogden, K. A. Antimicrobial Peptides: Pore Formers or Metabolic Inhibitors in Bacteria?

Nat. Rev. Microbiol. 2005, 3, 238-250. (12) Kohanski, M. A.; Dwyer, D. J.; Collins, J. J. How Antibiotics Kill Bacteria: from Targets to Networks. Nat. Rev. Microbiol. 2010, 8, 423-435. (13) Jiajun, W.; Shuli, C.; Lin, X.; Xin, Z.; Na, D.; Anshan, S.; Zhihui, C. High Specific Selectivity and Membrane-Active Mechanism of The Synthetic Centrosymmetric Alpha-helical Peptides with Gly-Gly Pairs. Sci. Rep. 2015, 5, 15963. (14) Maisetta, G.; Di Luca, M.; Esin, S.; Florio, W.; Brancatisano, F.; Bottai, D.; Campa, M.; Batoni, G. Evaluation of the Inhibitory Effects of Human Serum Components on Bactericidal Activity of Human Beta Defensin 3. Peptides 2008, 29, 1-6. (15) Goldman, M. J.; Anderson, G. M.; Stolzenberg, E. D.; Kari, U. P.; Zasloff, M.; Wilson, J. M. Human beta-Defensin-1 is a Salt-sensitive Antibiotic in Lung That is Inactivated in Cystic Fibrosis. Cell 1997, 88, 553-560. (16) Bergsson, G.; Reeves, E. P.; McNally, P.; Chotirmall, S. H.; Greene, C. M.; Greally, P.; Murphy, P.; O'Neill, S. J.; McElvaney, N. G. LL-37 Complexation with Glycosaminoglycans in Cystic Fibrosis Lungs Inhibits Antimicrobial Activity, Which Can be Restored by Hypertonic Saline. J. Immunol. 2009, 183, 543-551. (17) Zhan, Y. O.; Wiradharma, N.; Yi Yan, Y. Strategies Employed in the Design and



Optimization of Synthetic Antimicrobial Peptide Amphiphiles with Enhanced Therapeutic Potentials☆ (☆ This review is part of the Advanced Drug Delivery Reviews theme issue on “Emergence of multidrug resistance bacteria: Important role of macromolecules as a new drug targeting microbial membranes”). Adv. Drug Delivery Rev. 2014, 78, 28-45. (18) Keil, B. Specificity of Proteolysis. Springer Science & Business Media. 1992. (19) Jacob, B.; Rajasekaran, G.; Kim, E. Y.; Park, I. S.; Bang, J. K.; Shin, S. Y. The Stereochemical Effect of SMAP-29 and SMAP-18 on Bacterial Selectivity, Membrane Interaction and Anti-inflammatory Activity. Amino Acids 2016, 48, 1241-1251. (20) Min, K. R.; Galvis, A.; Williams, B.; Rayala, R.; Cudic, P.; Ajdic, D. Antibacterial and Antibiofilm Activities of a Novel Synthetic Cyclic Lipopeptide Against Cariogenic

Streptococcus mutans UA159. Antimicrob. Agents Chemother. 2017, 61, e00776-17. (21) Murugan, R. N.; Jacob, B.; Ahn, M.; Hwang, E.; Sohn, H.; Park, H. N.; Lee, E.; Seo, J. H.; Cheong, C.; Nam, K. Y.; Hyun, J. K.; Jeong, K. W.; Kim, Y.; Shin, S. Y.; Bang, J. K. De Novo Design and Synthesis of Ultra-short Peptidomimetic Antibiotics Having Dual Antimicrobial and Anti-inflammatory Activities. Plos One 2013, 8, e80025. (22) Nikken, W.; Shao Qiong, L.; Yi Yan, Y. Branched and 4-arm Starlike α-Helical Peptide Structures with Enhanced Antimicrobial Potency and Selectivity. Small 2012, 8, 362-366. (23) Park, I. Y.; Cho, J. H.; Kim, K. S.; Kim, Y. B.; Kim, M. S.; Kim, S. C. Helix Stability Confers Salt Resistance upon Helical Antimicrobial Peptides. J. Biol. Chem. 2004, 279, 13896-13901. (24) Lupas, A. N.; Bassler, J. Coiled Coils - A Model System for the 21st Century. Trends

Biochem. Sci. 2017, 42, 130-140. 44 ACS Paragon Plus Environment

Page 44 of 50

Page 45 of 50 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(25) Changxuan, S.; Haotian, T.; Tianyu, W.; Zhihua, W.; Shuli, C.; AnShan, S.; Baojing, C. Central beta-turn Increases the cell Selectivity of Imperfectly Amphipathic alpha-Helical Peptides. Acta Biomater. 2018, 69, 243-255. (26) Schlenzig, D.; Manhart, S.; Cinar, Y.; Kleinschmidt, M.; Hause, G.; Willbold, D.; Funke, S. A.; Schilling, S.; Demuth, H. U. Pyroglutamate Formation Influences Solubility and Amyloidogenicity of Amyloid Peptides. Biochemistry 2009, 48, 7072-7078. (27) Na, D.; Shuli, C.; Jiawei, L.; Chenyu, X.; Xinran, L.; BaoJing, C.; AnShan, S. Short Symmetric-End Antimicrobial Peptides Centered on beta-Turn Amino Acids Unit Improve Selectivity and Stability. Front. Microbiol. 2018, 9, 2832. (28) Kim, H.; Jang, J. H.; Kim, S. C.; Cho, J. H. De Novo Generation of Short Antimicrobial Peptides with Enhanced Stability and Cell Specificity. J. Antimicrob. Chemother. 2014, 69, 121-132. (29) Lam, S. J.; O'Brien Simpson, N. M.; Pantarat, N.; Sulistio, A.; Wong, E. H.; Chen, Y. Y.; Lenzo, J. C.; Holden, J. A.; Blencowe, A.; Reynolds, E. C.; Qiao, G. G. Combating Multidrug-resistant Gram-negative Bacteria with Structurally Nanoengineered Antimicrobial Peptide Polymers. Nat. Microbiol. 2016, 1, 16162. (30) Zhi, M.; Dandan, W.; Ping, Y.; Xin, Z.; AnShan, S.; Zhongpeng, B. Characterization of Cell Selectivity, Physiological Stability and Endotoxin Neutralization Capabilities of α-helix-based Peptide Amphiphiles. Biomaterials 2015, 52, 517-530. (31) Moritz, E. M.; Hergenrother, P. J. Toxin-antitoxin Systems are Ubiquitous and Plasmid-encoded in Vancomycin-resistant Enterococci. Proc. Natl. Acad. Sci. U. S. A. 2007,

104, 311-316. 45 ACS Paragon Plus Environment


(32) Vagt, T.; Zschornig, O.; Huster, D.; Koksch, B. Membrane Binding and Structure of De Novo Designed Alpha-helical Cationic Coiled-coil-forming Peptides. Chemphyschem 2006, 7, 1361-1371. (33) Lau S. Y.; Taneja A. K.; S., H. R. Synthesis of a Model Protein of Defined Secondary and Quaternary Structure. Effect of Chain Length on the Stabilization and Formation of two-Stranded alpha-Helical Coiled-coils. J. Biol. Chem. 1984, 259, 13253–13261. (34) Erental, A.; Kalderon, Z.; Saada, A.; Smith, Y.; Engelberg Kulka, H. Apoptosis-like Death, an Extreme SOS Response in Escherichia coli. mBio 2014, 5, e01426-14. (35) Bayles, K. W. Bacterial Programmed Cell Death: Making Sense of a Paradox. Nat. Rev.

Microbiol. 2014, 12, 63-69. (36) Peeters, S. H.; de Jonge, M. I. For the Greater Good: Programmed Cell Death in Bacterial Communities. Microbiol. Res. 2018, 207, 161-169. (37) Kacprzyk, L.; Rydengård, V.; Mörgelin, M.; Davoudi, M.; Pasupuleti, M.; Malmsten, M.; Schmidtchen, A. Antimicrobial Activity of Histidine-rich Peptides is Dependent on Acidic Conditions. Biochim. Biophys. Acta, Biomembr. 2007, 1768, 2667-2680. (38) Shuli, C.; Changxuan, S.; Jiajun, W.; Anshan, S.; Lin, X.; Na, D.; Zhongyu, L. Short, Multiple-stranded β-hairpin Peptides have Antimicrobial Potency with High Selectivity and Salt Resistance. Acta Biomater. 2016, 30, 78-93. (39) Chaili, S.; Cheung, A. L.; Bayer, A. S.; Xiong, Y. Q.; Waring, A. J.; Memmi, G.; Donegan, N.; Yang, S. J.; Yeaman, M. R. The GraS Sensor in Staphylococcus aureus Mediates Resistance to Host Defense Peptides Differing in Mechanisms of Action. Infect. Immun. 2015,


Page 46 of 50

Page 47 of 50 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(40) Kolar, S. L.; Nagarajan, V.; Oszmiana, A.; Rivera, F. E.; Miller, H. K.; Davenport, J. E.; Riordan, J. T.; Potempa, J.; Barber, D. S.; Koziel, J.; Elasri, M. O.; Shaw, L. N. NsaRS is a Cell-envelope-stress-sensing Two-component System of Staphylococcus aureus.

Microbiology 2011, 157, 2206-2219. (41) Yang, S. J.; Bayer, A. S.; Mishra, N. N.; Meehl, M.; Ledala, N.; Yeaman, M. R.; Xiong, Y. Q.; Cheung, A. L. The Staphylococcus aureus Two-component Regulatory System, GraRS, Senses and Confers Resistance to Selected Cationic Antimicrobial Peptides. Infect. Immun. 2012, 80, 74-81. (42) Jianbo, S.; Yuqiong, X.; Dong, L.; Quan, D.; Dehai, L. Relationship Between Peptide Structure and Antimicrobial Activity as Studied by De Novo Designed Peptides. Biochim.

Biophys. Acta, Biomembr. 2014, 1838, 2985-2993. (43) Jiajun, W.; Xiujing, D.; jing, S.; Yinfeng, L.; Xin, Z.; Lin, X.; Weizhong, L.; Anshan, S. Antimicrobial Peptides: Promising Alternatives in the Post Feeding Antibiotic Era. Med. Res.

Rev. 2018, 39, 831-859. (44) Hong, S.; Takahashi, H.; Nadres, E. T.; Mortazavian, H.; Caputo, G. A.; Younger, J. G.; Kuroda, K. A Cationic Amphiphilic Random Copolymer with pH-Responsive Activity against Methicillin-Resistant Staphylococcus aureus. Plos One 2017, 12, e0169262. (45) Paterson, D. J.; Tassieri, M.; Reboud, J.; Wilson, R.; Cooper, J. M. Lipid Topology and Electrostatic Interactions Underpin Lytic Activity of Linear Cationic Antimicrobial Peptides in Membranes. Proc. Natl. Acad. Sci. U. S. A. 2017, 114, E8324-E8332. (46) Zhan, Y. O.; Junchi, C.; Yuan, H.; Kaijin, X.; Zhongkang, J.; Weimin, F.; Yi Yan, Y. Effect of Stereochemistry, Chain Length and Sequence Pattern on Antimicrobial Properties of Short



Synthetic β-sheet Forming Peptide Amphiphiles. Biomaterials 2014, 35, 1315-1325. (47) Tu, Z.; Young, A.; Murphy, C.; Liang, J. F. The pH Sensitivity of Histidine-containing Lytic Peptides. J. Pept. Sci. 2009, 15, 790-795. (48) McDonald, M.; Mannion, M.; Pike, D.; Lewis, K.; Flynn, A.; Brannan, A. M.; Browne, M. J.; Jackman, D.; Madera, L.; Power Coombs, M. R.; Hoskin, D. W.; Rise, M. L.; Booth, V. Structure-function Relationships in Histidine-rich Antimicrobial Peptides from Atlantic Cod.

Biochim. Biophys. Acta, Biomembr. 2015, 1848, 1451-1461. (49) Rydengard, V.; Nordahl, E.; Schmidtchen, A. Zinc Potentiates the Antibacterial Effects of Histidine-rich Peptides Against Enterococcus Faecalis. FEBS J. 2006, 273, 2399-2406. (50) Binder, H.; Arnold, K.; Ulrich, A. S.; Zschörnig, O. The Effect of Zn2+ on the Secondary Structure of a Histidine-rich Fusogenic Peptide and its Interaction with Lipid Membranes.

Biochim. Biophys. Acta, Biomembr. 2000, 1468, 345-358. (51) Hui Yuan, Y.; Chih Hsiung, T.; Bak Sau, Y.; Heng Li, C.; Hsi Tsung, C.; Kuo Chun, H.; Hsiu Jung, L.; Jya Wei, C. Easy Strategy to Increase Salt Resistance of Antimicrobial Peptides. Antimicrob. Agents Chemother. 2011, 55, 4918-4921. (52) Ya Han, C.; Siou Ying, W.; Bak Sau, Y.; Kuang Ting, C.; Su Ya, H.; Chih Lung, W.; Hui Yuan, Y.; Jya Wei, C. Dependence on Size and Shape of Non-nature Amino Acids in The Enhancement of Lipopolysaccharide (LPS) Neutralizing Activities of Antimicrobial Peptides. J.

Colloid Interface Sci. 2019, 533, 492-502. (53) Atefyekta, S.; Pihl, M.; Lindsay, C.; Heilshorn, S. C.; Andersson, M. Antibiofilm Elastin-like Polypeptide Coatings-Functionality, Stability, and Selectivity. Acta Biomater. 2019,


Page 48 of 50

Page 49 of 50 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(54) Vlieghe, P.; Lisowski, V.; Martinez, J.; Khrestchatisky, M. Synthetic Therapeutic Peptides: Science and Market. Drug Discovery Today 2010, 15, 40-56. (55) Convention, T. U. S. P. United States Pharmacopeial (USP) Convention 2013, 36 NF 31. (56) QingQuan, M.; Na, D.; AnShan, S.; YinFeng, L.; Yu Zhi, L.; ZhiHui, C.; BaoJing, C.; ZhongYu, L. Biochemical Property and Membrane-peptide Interactions of De Novo Antimicrobial Peptides Designed by Helix-forming Units. Amino Acids 2012, 43, 2527-2536. (57) Delcour, A. H. Outer Membrane Permeability and Antibiotic Resistance. Biochim.

Biophys. Acta, Proteins Proteomics 2009, 1794, 808-816. (58) Avitabile, C.; Netti, F.; Orefice, G.; Palmieri, M.; Nocerino, N.; Malgieri. G.; D'Andrea, L. D.; Capparelli, R.; Fattorusso, R.; Romanelli, A. Design, Structural and Functional Characterization of a Temporin-1b Analog Active Against Gram-negative Bacteria. Biochim.

Biophys. Acta, Gen. Subj. 2013, 1830, 3767-3775. (59) Nam, J.; Yun, H.; Rajasekaran, G.; Kumar, S. D.; Kim, J. I.; Min, H. J.; Shin, S. Y.; Lee, C. W. Structural and Functional Assessment of mBjAMP1, an Antimicrobial Peptide from Branchiostoma japonicum, Revealed a Novel alpha-Hairpinin-like Scaffold with Membrane Permeable and DNA Binding Activity. J. Med. Chem. 2018, 61, 11101-11113. (60) Melo, M. N.; Ferre, R.; Castanho, M. A. Antimicrobial Peptides: linking Partition, Activity and High Membrane-bound Concentrations. Nat. Rev. Microbiol. 2009, 7, 245-250. (61) Lorenzon, E. N.; Piccoli, J. P.; Santos Filho, N. A.; Cilli, E. M. Dimerization of Antimicrobial Peptides: A Promising Strategy to Enhance Antimicrobial Peptide Activity.

Protein Pept. Lett. 2019, 26, 98-107. (62) Song, C.; Weichbrodt, C.; Salnikov, E. S.; Dynowski, M.; Forsberg, B. O.; Bechinger, B.;



Steinem, C.; de Groot, B. L.; Zachariae, U.; Zeth, K. Crystal Structure and Functional Mechanism of a Human Antimicrobial Membrane Channel. Proc. Natl. Acad. Sci. U. S. A. 2013, 110, 4586-4591.

TOC graphic


Page 50 of 50

Highly Stabilized α-Helical Coiled Coils Kill Gram-negative Bacteria by

Recommend Documents