Human Serum Albumin and HER2-Binding Affibody Fusion Proteins

Subscriber access provided by Northern Illinois University

Article

Human serum albumin and HER2-binding affibody fusion proteins for targeted delivery of fatty acid-modified molecules and therapy Daoyuan Dong, Guanjun Xia, Zhijun Li, and Zhiyu Li Mol. Pharmaceutics, Just Accepted Manuscript • DOI: 10.1021/acs.molpharmaceut.6b00265 • Publication Date (Web): 21 Aug 2016 Downloaded from http://pubs.acs.org on August 30, 2016

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

Molecular Pharmaceutics is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 52

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Molecular Pharmaceutics

Human serum albumin and HER2-binding affibody fusion proteins for targeted delivery of fatty acidmodified molecules and therapy Daoyuan Dong†, Guanjun Xia#, Zhijun Li†, and Zhiyu Li*‡ †

Department of Chemistry & Biochemistry, Misher College of Arts and Sciences, ‡Department

of Pharmaceutical Sciences, Philadelphia College of Pharmacy, University of the Sciences, Philadelphia, PA 19104; #Department of Pathology, Drexel University College of Medicine, Philadelphia, PA 19102 KEYWORDS: affibody, albumin, fusion protein, HER2, targeted drug delivery

* Corresponding Author Zhiyu Li. Address: Department of Pharmaceutical Sciences, Philadelphia College of Pharmacy, University of the Sciences, Philadelphia, PA 19104. E-mail: [email protected].

ACS Paragon Plus Environment

1


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 52

ABSTRACT

Human epidermal growth factor receptor 2 (HER2) is a well-studied therapeutic target as well as a biomarker of breast cancer. HER2-targeting affibody (ZHER2:342) is a novel small scaffold protein with an extreme high affinity against HER2 screened by phage display. However, the small molecular weight of ZHER2:342 has limited its pharmaceutical application. Human serum albumin (HSA) and ZHER2:342 fusion protein may not only extend the serum half-life of ZHER2:342 but also preserve the biological function of HSA to bind and transport fatty acids, which can be used to deliver fatty acid-modified therapeutics to HER2-positive cancer cells. Two HSA and ZHER2:342 fusion proteins, one with a single ZHER2:342 domain fused to the C terminus of HSA (rHSA-ZHER2) and another with two tandem copies of ZHER2:342 fused to the C terminus of HSA (rHSA-(ZHER2)2), have been constructed, expressed, and purified. Both fusion proteins possessed the HER2 and fatty acid (FA) binding abilities demonstrated by in vitro assays. Interestingly, rHSA-(ZHER2)2, not rHSA-ZHER2, was able to inhibit the proliferation of SKBR-3 cells at a relatively low concentration and the increase of HER2 and ERK1/2 phosphorylation followed by rHSA-(ZHER2)2 treatment has been observed. HSA fusion proteins are easy and economical to express, purify, and formulate. As expected, HSA fusion proteins and fusion protein-bound fatty acid-modified FITC could be efficiently taken up by cells. These results proved the feasibility of using HSA fusion proteins as therapeutic agents as well as carriers for targeted drug delivery.


2

Page 3 of 52

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


INTRODUCTION Human epidermal growth factor receptor 2 (HER2, neu, or ErbB2), together with EGFR (HER1 or ErbB1), HER3 (ErbB3), and HER4 (ErbB4), belongs to the ErbB receptor tyrosine kinase (RTK) family.1 HER2 is a well-characterized breast cancer biomarker. It is overexpressed in 20-30 % of breast cancers and is related to drug resistance and poor prognosis in cancer treatment.2,3 It forms homodimer or heterodimers with other RTKs to regulate cell proliferation, growth, and survival.4–6 Trastuzumab is an FDA approved monoclonal antibody that specifically targets and eliminates HER2-positive breast and gastric cancers.7 In addition, trastuzumab has been employed as a HER2-targeting carrier to deliver a variety of drugs in formulations of antibody-drug conjugates,8 micelle encapsulations,9 or nanoparticles.10 Among them, trastuzumab and DM1 covalent conjugate (ado-trastuzumab emtansine) has been approved for cancer treatment.11,12 However, full realization of the benefits of antibody therapy is hindered by limited tumor penetration due to the large molecular weight of antibody and the high cost of production and formulation.13 Therefore, many scaffold proteins with smaller molecular size and higher binding affinity have been developed to mimic the target-binding function of antibodies.14 Affibody is one scaffold protein that has been well studied.15

Affibody is derived from the Z domain of staphylococcal protein A. The 58 amino acids of Z domain form 3 helical bundles. Thirteen residues on the surface of helices 1 and 2 have been selected to change randomly in a phage display library that displays the scaffold of Z domain.15 Through several rounds of rigorous panning against HER2 extracellular domain and further maturation, affibody ZHER2:342 with a high affinity against HER2 has been obtained.16


3


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 4 of 52

Disappointingly, monomeric ZHER2:342 cannot inhibit the proliferation of HER2-positive cells.17 Hence, ZHER2:342 has been applied as a targeting molecule to modify drug carriers and as an imaging probe.18,19 Interestingly, dimeric HER2-specific affibody, (ZHER2:342)2, is able to inhibit the proliferation of HER2-positive SK-BR-3 cells.17 However, due to the low molecular weight, affibodies will be quickly eliminated from the body. Therefore, constructing (ZHER2:342)2 and human serum albumin fusion protein is a feasible approach to target and eliminate HER2positive cancers via a different mechanism from that of trastuzumab.

Albumin fusion protein approach has been successfully applied to develop long-lasting protein drugs due to the ideal biological and biophysical properties of albumin.20–23 First, the right molecular size (67 kDa) and neonatal Fc receptor (FcRn) binding activity allow albumins to possess a long serum half-life.24 Second, albumin, folded dominantly by helices and constrained by 17 pairs of disulfide bond,25 is extremely stable and easy to produce and formulate. Third, cancer cells preferably take albumins as a nutrient source,26,27 which makes albumin a good carrier to deliver therapeutic payloads to cancer cells. Fast dividing tumor cells rely on abnormal metabolic pathways to gain survival advantages over normal cells. Tumor cells act as “nitrogen traps” and around 70% overall transportable nitrogen in blood is from albumins.28 Therefore, tumor cells showed increased albumin uptake29,30 and used albumins as nutrient and energy source.26 It has been reported that albumins made up 19% of the soluble proteins of certain breast cancer cells.31 Ras-transformed cells acquired amino acid supply via macropinocytosis to generate glutamines for central carbon metabolism.27 Finally, a natural biological function of albumin is to transport long chain fatty acid (LCFA).32 One albumin can bind up to 6 LCFAs with high affinity.33 Albumin fusion protein usually keeps the fatty acid binding activity and can


4

Page 5 of 52

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


be formulated with fatty acid-modified drugs through non-covalent binding. This novel formulation approach can deliver payloads without sophisticated chemical modification. In addition, it is possible to deliver multiple therapeutics with different functions to the same target for synergistic effect. In this study, monomeric and dimeric ZHER2:342 have been fused to the C terminus of human serum albumin, respectively (denoted rHSA-ZHER2 and rHSA-(ZHER2)2).

Although both fusion proteins bound to HER2 proteins as well as HER2-positive cells, only rHSA-(ZHER2)2 showed obvious anti-proliferation activity. Apparently, rHSA-(ZHER2)2 and trastuzumab exerted their anti-proliferation functions through different mechanisms manifested by different cellular signaling profiles. It provides an opportunity to use rHSA-(ZHER2)2 to treat trastuzumab-resistant HER2-positive breast cancers. As expected, all fusion proteins kept good fatty acid binding activity comparable with that of a wild type albumin. In addition, SK-BR-3 cells were able to efficiently take albumin fusion proteins and fusion protein-bound fatty acidmodified molecules. Overall, rHSA-(ZHER2)2 could be used as a multifunctional pharmaceutical protein that not only inhibits the proliferation of HER2-positive cancer cells but also serves as a carrier to deliver fatty acid-modified payloads through non-covalent binding.


5


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 6 of 52

EXPERIMENTAL SECTION Design and expression of rHSA-ZHER2 and rHSA-(ZHER2)2. Genes encoding ZHER2:342 and (ZHER2:342)2 were first reversely translated from the published peptide sequences and then synthesized (Genscript). Recombinant rHSA-ZHER2 fusion protein DNA was cloned into pPICZαA vector (Invitrogen) by overlapping PCR. The HSA portion of the fusion protein was amplified by a 5’ primer containing a 21 base pair sequence overlapping with the N-terminus of HSA

cDNA

and

the

XhoI

cloning

site

of

the

vector

(5’-

ATCGCTCGAGAAAAGAGAGGCTAAGCGACGCACACAAGAGTGAGGTTGCT-3’) (primer 1), and a 3’ primer containing a portion of the C-terminus of HSA and a portion of the N-terminus

of

ZHER2:342 gene

(5’-ACAGATCCTCCTCCGGATCCGGCGCCTAAGGCA-

GCTTGACTTGC-3’) (primer 2). The ZHER2:342 portion of fusion protein was amplified by a 5’ primer containing a portion of the C-terminal of HSA and a portion of the N-terminus of ZHER2:342 gene (5’- AGTCAGGCGCCGGATCCGGAGGAGGATCTGTCGACAACAAATTCAACAAAG-3’) (primer 3), and a 3’ primer containing a portion of the C-terminus of ZHER2:342 (5’-TTATCGTCGACTTTCGGTGCCTGTGCGTC-3’) (primer 4). Two restriction sites as underlined, KasI and SalI, were designed to flank the ZHER2:342 DNA. The HSA portion and ZHER2:342 portion of amplified genes were then fused by overlapping PCR using primers 1 and 4. Finally, rHSA-ZHER2 gene was cloned into pPICZαA vector using XhoI and SalI cloning sites to obtain pHSA-ZHER2 plasmid. A His6 tag was attached to the C-terminus of the fusion protein to facilitate protein purification. When (ZHER2:342)2 DNA was designed, KasI and SalI were included at the 5’ and 3’ of the DNA sequence, respectively. (ZHER2:342)2 DNA was synthesized and cloned into pUC58 vector (Genscript). The (ZHER2:342)2 DNA fragment was first retrieved by KasI and SalI double digestion. This fragment was then cloned into pHSA-ZHER2 to replace the


6

Page 7 of 52

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


ZHER2:342 DNA fragment flanked by KasI and SalI restriction sites and yielded pHSA-(ZHER2)2 plasmid. The cloned genes were confirmed by DNA sequencing. Pichia pastoris yeast cells (Invitrogen, 18258-012) were then transformed using linearized pHSA-ZHER2 and pHSA(ZHER2)2. Colonies containing fusion protein expression plasmids were selected for zeocin resistance after 72 hours. Recombinant proteins were expressed in Pichia pastoris according to the manufacturer’s instructions (Invitrogen, K1740-01).

Purification of fusion proteins. Supernatant containing albumin fusion proteins with His-tag secreted by P. pastoris was collected and incubated with nickel-conjugated silica resin (USB, 78806) at 4 ºC for 1 hour (10 mg protein/ml resin). Then, the mixture was loaded into a chromatography column. Settled resins were washed with 10X bed volume of Tris-HCl buffer (20 mM Tris-HCl, 500 mM NaCl, pH 8.0) containing 5mM imidazole, and sequentially eluted by 3X volume of Tris-HCl buffer with 20 mM, 250 mM, and 400 mM imidazole, respectively. The flow-through was collected and the purity of fusion proteins in every fraction was confirmed by SDS-PAGE. The fraction with the highest purity was concentrated, dialyzed twice against 1X PBS, and stored at -20 ºC.

Gel-shift assay to identify albumin-bound fatty acids. Removal of endogenous fatty acids during yeast culture from rHSAs was performed according to a previously published protocol.34 Briefly, activated charcoal was first added to protein solution (0.5 g charcoal per gram albumin), then pH was adjusted to 3.0 using 0.2 N HCl. After incubating at 4 ºC for 1 hour, charcoal was removed by centrifugation at 13,000 x g for 20 minutes. The pH of supernatant was adjusted to 7.0 by adding 0.2 N NaOH. Defatted albumin and albumin fusion proteins were incubated with


7


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 8 of 52

FA-FITC (fatty acid-modified FITC, synthesized previously in lab35) at the indicated amount and ratio for 30 minutes at room temperature followed by native PAGE separation. Proteins bound by FA-FITC migrated slower than free FA-FITC and could be visualized under 302 nm UV.

Cell culture and In vitro growth inhibition assay. SK-BR-3, BT-474, MCF-7 and MDAMB-231 are epithelial cells obtained from ATCC. Cells were cultured in RPMI-1640 medium (LONZA) with 10% FBS (Fisher, 03600511). For growth inhibition assay, 100 µl cells (1x105 cells/ml) were seeded into each well of a 96-well plate. After 24 hours, old cell culture medium was replaced by 100 µl fresh medium (1% FBS) with indicated amount of wild type HSA, rHSA-ZHER2 or rHSA-(ZHER2)2. After 4 days, CyQUANT assay (Invitrogen, C35006) was applied to test cell proliferation.

In vitro cell uptake assay. Rhodamine-labeled albumin and albumin fusion proteins were obtained using NHS-Rhodamine (Thermo Scientific, 46406). NHS-Rhodamines and proteins (10:1 molar ratio) were incubated at room temperature for 1 hour followed by dialysis three times in 1X PBS. The average rhodamine to protein ratio of rhodamine-labeled protein is around 2, following a procedure provided by the NHS-Rhodamine manual. After incubating cells with the same amount of rhodamine-labeled proteins for the indicated time, the cellular uptake efficiency was evaluated by both fluorescent microscopy (Nikon Diaphot) and BD FACSCalibur flow cytometry with 585/42 (FL2) filter (BD Bioscience). To evaluate the uptake of pre-formed albumin/FA-FITC and albumin fusion proteins/ FA-FITC complexes, rhodamine labeled proteins (0.2 µM) were pre-mixed with FA-FITC (0.2 µM) at room temperature for 20 minutes before adding to SK-BR-3, BT-474, and MDA-MB-231 cells. Then fluorescence of rhodamine and


8

Page 9 of 52

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


FITC was observed 3 hours after incubation. Two fluorescent channels were merged using ImageJ software.

Biodistribution study. BT-474 cells (4x106) were inoculated to the left flank of mice. When tumors were approximately 50 mm3 in volume, mice were injected with 200 µg biotin-labeled rHSA wild type and rHSA-(ZHER2)2, respectively. Mice were sacrificed for tissue collection 24 hours after injection. The tumor, kidneys, spleen, heart, lungs, as well as a portion of the liver were dissected and weighted. For each organ, around 50 mg tissues were homogenized and lysed in RIPA buffer. After centrifugation at 13,000 x g for 15 minutes, protein concentration was quantified by Bradford assay. Proteins (10 µg for each lane) were subjected to SDS-PAGE followed by Western blot to detect biotin-labeled albumins. Densitometry was carried out using the LabWorks software (UVP Inc).

Cell Attachment Assay. Wells of a 96-well EIA/RIA plate (Corning Costar, 9017) were coated with 100 µl of 10 µg/ml wild type HSA, albumin fusion proteins, or trastuzumab for 3 hours (4 replicas for each protein). Wells were then blocked by adding 100 µl of freshly made heat-denatured BSA (Sigma, 1 mg/ml; denatured at 85 ºC for 10 minutes, DBSA) for 1 hour. After removing DBSA, each well was washed with pre-warmed (37 ºC) growth medium. Trypsinized cells were allowed to recover in growth medium at 37 ºC in an incubator for 1 hour. Then, 2x104 cells were added to each coated well for additional 1 hour incubation. Each well was carefully washed three times with 1X PBS, followed by quantifying attached cells using CyQUANT assay. Fluorescence was detected by Wallac 1420 plate reader with excitation/emission wavelength at 485/535 nm.


9


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 10 of 52

Co-immunoprecipitation, Western blot, and protein crosslinking. SK-BR-3 cells were collected and lysed with buffer containing 1% protease inhibitor (G-Biosciences, 786-108), 50 mM NaCl, 0.1% Triton-x 100, and 20 mM Tris-HCl pH7.5. Wild type albumin or fusion proteins were biotin-labeled with NHS-biotin (Quanta BioDesign, 10205) following a procedure similar to the NHS-Rhodamine labeling. Lysate (200 µg) was incubated with 1 µg biotin-labeled wild type HSA, rHSA-ZHER2, and rHSA-(ZHER2)2, respectively, at 4 ºC for 3 hours. To pull down biotin-labeled proteins, 20 µl of streptavidin resins (G-Biosciences, 786-590) were added to each reaction for one additional hour of incubation. Streptavidin resins and biotin-labeled protein complexes were harvested by spinning down at 1,000 x g. To pull down HER2 and HER2associated proteins, 1µg of anti-HER2 antibodies (Cell Signaling, 2165) were added to each reaction for one additional hour. Then, protein A resins (Genscript, L00210) were included and incubated for another one hour. Protein A resins and antibody complexes were harvested by spinning down at 1, 000 x g. Recovered resins were washed three times with lysis buffer. Resinbound proteins were eluted and heated at 95 ºC in 25 µl lysis buffer plus 25 µl SDS-PAGE loading buffer for Western blot. Anti-HER2 antibody (Cell Signaling, 2165), goat anti-rabbit IgG-HRP (Santa Cruz, sc-2004), and or streptavidin-HRP (Thermo scientific, 21130) were used for Western blot and detected by SuperSignal West Dura Chemiluminescent Substrate kit (Thermoscientific, 34075).

To detect the effect of fusion proteins on HER2 downstream signaling pathway, SK-BR-3 cells were seeded in a 24-well plate (3x104 cells/well) overnight. Then, cells were treated with the indicated amounts of wild type HSA, rHSA-ZHER2, or rHSA-(ZHER2)2 in fresh medium for 2


10

Page 11 of 52

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


hours or 1 day. Whole cell lysates were collected and subjected to Western blot. Trastuzumab and a small molecule kinase inhibitor (lapatinib), were used as controls. Protein phosphorylation was detected by anti-p-Tyr antibody (Santa Cruz, sc-7020), anti-AKT antibody (Cell Signaling, 4691L), anti-p-AKT antibody (Cell Signaling, 4060), anti-ERK antibody (Cell Signaling, 4695), anti-p-ERK antibody (Cell Signaling, 4370), and anti-HER2-pY1248 antibody (Cell Signaling, 2247). Anti-GAPDH antibody (Santa Cruz, sc-59541) was used as an internal control.

To crosslink HER2 and HER2-associated proteins, SK-BR-3 cells were treated with 0.1 µM of wild type HSA, rHSA-ZHER2, rHSA-(ZHER2)2, or trastuzumab for 3 hours. After treatment, cells were washed with 1X PBS and proteins were crosslinked in 5 µM BS3 (Bissulfosuccinimidyl suberate) (CovaChem, 13306) at room temperature for 30 minutes. The whole cell lysate (10 µg) was then separated by 4-15% gradient SDS-PAGE and detected by Western blot using anti-HER2 antibody.


11


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 12 of 52

RESULTS Design, expression, and purification of rHSA fusion proteins. The module in albumin fusion proteins which recognizes HER2 is adopted from affibody ZHER2:342. Interactions between ZHER2:342 and HER2 extracellular domain have been well elucidated.36 Residues on the interface of helices I and II (Met9, Arg10, Tyr13, Trp14, Ala17, Leu18, Asn24, Arg28, Arg32, and Tyr35) from ZHER2:342 are involved in HER2-binding via 11 inter-molecular hydrogen bonds. To obtain rHSA-ZHER2, an albumin fused with a monomeric ZHER2:342 affibody, a peptide linker (GSGGGS) was inserted between the C terminus of HSA and the N terminus of ZHER2:324 to increase the flexibility of affibody module (Figure 1A). Subsequently, to construct rHSA(ZHER2)2, an albumin fused with a dimeric HER2-binding affibody, two G4S motifs were included between the C terminus of rHSA-ZHER2 and the N terminus of the second ZHER2:324 (Figure 1A). The DNA sequence encoding ZHER2:342 was synthesized and fused to a wild type HSA gene to obtain rHSA-ZHER2 and rHSA-(ZHER2)2 as described in the Experimental Section. Fusion proteins were expressed in Pichia pastoris and purified to apparent homogenous identified by SDS-PAGE (Figure 1B). Approximately, 1 liter of yeast culture could yield 10 mg purified fusion proteins.


12

Page 13 of 52

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 1. Design and purification of rHSA fusion proteins. A) One or two copies of ZHER2:342 adopted from affibody ZHER2:342 (pink) were fused to the C terminus of HSA (green). B) Fusion proteins (lane 2, rHSA-ZHER2; lane 3, rHSA-(ZHER2)2) were expressed in Pichia pastoris system and purified by nickel-conjugated silica resins. Wild type HSA (lane 1, rHSA) was purified by cibacron blue dye agarose. Proteins (4 µg per well) were separated by SDS-PAGE and visualized by coomassie blue staining.


13


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 14 of 52

FA-FITC and rHSA fusion protein form stable complexes. As a main transporter of LCFAs inside the body, a human serum albumin possesses 6 LCFA binding sites with high affinity.33,37 It is feasible to take advantage of this unique physiological property of albumin to formulate albumins complexed with fatty acid-modified drugs in vitro then deliver these stable noncovalent complexes in vivo for long-lasting and targeting applications. This formulation strategy avoids any covalent modification on albumin and is easy to operate. As drug carriers, chemically modified albumins bind to endothelial surface proteins, gp18 and gp30.38 These two proteins, functioning as scavenger receptors, facilitate the quick elimination of chemically modified albumins from circulation. Albumin fusion proteins maintain the physiological functions of native albumins, especially, LCFA binding and transportation. In addition, LCFA binding assay can also be used to assess the proper protein folding of recombinant albumin fusion proteins.

The FA binding ability of recombinant albumins was assessed by gel-shift assay. Fatty acidmodified FITC molecules (FA-FITC) were able to form stable complexes with recombinant albumin and migrate slower in native PAGE than free FA-FITC. These complexes could be easily visualized under UV light. FA-FITC molecules were incubated with wild type rHSA, rHSA-ZHER2, or rHSA-(ZHER2)2 at different FA-FITC and protein ratios (1:1, 2:1, and 4:1). Products were separated by native PAGE and detected under UV light. FA binding ability of a wild type albumin and albumin fusion proteins are comparable (Figure 2). Although the fatty acid binding ability of rHSA-(ZHER2)2 slightly decreased under high concentration of FA-FITC (lane 10), every recombinant albumin was capable of binding 2-3 FA-FITC efficiently. This assay also implicated the minimum interference of the C terminal fusion module on fatty acid binding function. Meanwhile, it suggested that all proteins folded properly.


14

Page 15 of 52

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 2. Fatty acid binding assay of recombinant albumins. Defatted albumin and albumin fusion proteins were incubated with FA-FITC at the indicated amount for 30 minutes at room temperature. Complexes were separated by native PAGE. The upper bands correspond to rHSA/FA-FITC complex; while the lower band (arrow) indicate free FA-FITC. Fatty acid binding ratio labeled at the bottom of each lane was quantified by comparing the light density of each band to the loaded protein detected by coomassie blue staining. The fatty acid binding ratio for complex with 1:1 protein to FA-FITC ratio was normalized as 1.


15


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 16 of 52

HER2 interacts with rHSA fusion proteins. The interaction between rHSA fusion protein and HER2 was confirmed by co-immunoprecipitation. Wild type rHSA, rHSA-ZHER2 and rHSA-(ZHER2)2 were labeled by biotins as described in the Experimental Section. These biotinlabeled proteins were then incubated with SK-BR-3 whole cell lysates. Complexes pulled down by anti-HER2 antibodies were blotted by HRP-conjugated streptavidin to detect the association of rHSA-ZHER2 and rHSA-(ZHER2)2, respectively (Figure 3A and 3C). Reciprocally, streptavidin was used to catch biotin-labeled albumin fusion proteins and albumin-associated HER2 receptors. Complexes were blotted by anti-HER2 antibodies to detect the association of HER2 (Figure 3B and 3D). Co-immunoprecipitation clearly demonstrated the interaction between HER2 receptors and albumin fusion proteins. As a control, wild type albumin did not form a complex with HER2 receptor.


16

Page 17 of 52

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 3. Biochemical interactions between HER2 and rHSA-ZHER2 or rHSA-(ZHER2)2 confirmed by co-immunoprecipitation. SK-BR-3 cell lysates were incubated with equal amount of biotin-labeled wild type HSA, rHSA-ZHER2 (Figure 3A and 3B), or rHSA-(ZHER2)2 (Figure 3C and 3D). Protein complexes were then pulled down by anti-HER2 antibodies (IP HER2) (Figure 3A and 3C) to detect HER2 (IB HER2) and biotin-labeled albumin fusion proteins (IB Biotin). Protein complexes pulled down by streptavidins (IP Biotin) (Figure 3B and 3D) were subjected to detect HER2 (IB HER2) and biotin-labeled albumin (IB Biotin).


17


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 18 of 52

rHSA fusion proteins recognize HER2-positive cells. Interactions between HER2 receptors and rHSA fusion proteins were further confirmed by cell attachment assay using HER2-positive SK-BR-3 cells (Figure 4). Wild type rHSA, rHSA-ZHER2, rHSA-(ZHER2)2, trastuzumab, and denatured BSA were coated onto EIA/RIA plate, respectively. Then, coated and non-coated wells were blocked by heat-denatured BSA. Upon incubating HER2-positive SK-BR-3 cells, wells coated by HER2-binding molecules, such as rHSA-ZHER2, rHSA-(ZHER2)2, and trastuzumab, tended to bind and keep more cells. In contrast, without attaching to HER2-binding molecules, only a small number of cells would remain in wells after several round of washing. Albumin fusion protein–coated wells, rHSA-ZHER2 and rHSA-(ZHER2)2, were able to catch about 3 folds more SK-BR-3 cells than rHSA-coated wells. Trastuzumab was used as a positive control. Wells coated by trastuzumab bound 4 folds more SK-BR-3 cells than rHSA-coated wells. Wells treated by denatured BSA and PBS buffer showed much less cell attachment than rHSA-coated wells. MCF-7 cells express low level of HER2. Thus, rHSA fusion proteins only showed about 1.5 folds increase in MCF-7 cell binding. The low level increase of MCF-7 binding may be due to non-specific albumin uptake by cancer cells. Overall, cell attachment assay indicated that rHSA-ZHER2 and rHSA-(ZHER2)2 can recognize HER2-positive cells.


18

Page 19 of 52

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 4. Albumin fusion proteins bind to HER2-positive SK-BR-3 cells. Indicated proteins were used to coat EIA/RIA plate. Trastuzumab was used as a positive HER2-binding molecule control, while denatured albumin (DBSA) and non-coated wells (PBS buffer only) were used as negative controls. MCF-7 cell was included as a low HER2-expressing cell control. Cells were quantitated by CyQUANT assay and readings were normalized based on cells remained in rHSA-coated wells. Error bars represent the S.D. of three independent experiments. Student’s t test was performed (*p

Human Serum Albumin and HER2-Binding Affibody Fusion Proteins

Recommend Documents